Saline-alkali resistant cladosporium taro strain D5-11, bacterial fertilizer, soil conditioner and application thereof

Abstract

The invention provides a Cladosporium Colombiae strain D5-11, a bacterial fertilizer, a soil conditioner and application of the Cladosporium Colombiae strain D5-11, and belongs to the technical field of microorganisms. The preservation number of the cladosporium taro strain D5-11 is CGMCC (China General Microbiological Culture Collection Center) No.41143. The cladosporium taro strain D5-11 promotes agglomeration of saline-alkali soil by secreting extracellular polymers uronic acid and humic acid, and the saline-alkali environment for plant survival is effectively improved; the cladosporium taro strain D5-11 has strong alkali resistance, can improve the activity of microorganisms in an alkaline environment, and is suitable for saline-alkali farmlands. In addition, the cladosporium taro strain D5-11 can also improve the oxidation resistance of the plant in a saline-alkali environment.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a salt-alkali resistant Cladosporium colombiae strain D5-11, a bacterial fertilizer, a soil conditioner and applications thereof. Background Art

[0002] China has rich and widely distributed saline soil resources. The physical and chemical properties of saline-alkali soil are poor, and the utilization rate is low. Excessive alkaline salt makes it difficult for nutrients to be absorbed by crops, which is not conducive to plant growth. Therefore, improving the structure formation of saline-alkali land and the growth of plants is of great significance to improving the utilization rate of saline-alkali land. At present, microorganisms are widely studied and used in improving soil and promoting plant growth. However, in the prior art, the biological activity of most microorganisms in saline-alkali environments is severely restricted and cannot play a role in saline-alkali environments. Therefore, screening strains that still have the effect of improving soil and promoting plant growth in saline-alkali environments has positive significance.

[0003] Cladosporium colombiae is a saprophytic fungus of the subphylum Deuteromycotina. Studies have shown that Cladosporium colombiae can be made into biological agents to inhibit plant diseases such as rice blast, regulate arthropod toxins, inhibit the infection of pathogenic pests, and degrade polyethylene. However, the role of Cladosporium colombiae in alleviating saline-alkali disorders and promoting crop growth has not been documented. Summary of the invention

[0004] The invention aims to provide a Cladosporium taro strain D5-11, which has strong alkali resistance, can effectively improve the saline-alkali environment of soil, and can also improve the antioxidant capacity of plants.

[0005] The invention provides a Cladosporium colombiae strain D5-11, and the preservation number of the Cladosporium colombiae strain D5-11 is CGMCC No.41143.

[0006] The present invention provides a fermentation product and / or metabolite of the Cladosporium taro strain D5-11.

[0007] The invention provides a bacterial fertilizer, comprising the Cladosporium taro strain D5-11 or the fermentation product and / or metabolite and auxiliary materials.

[0008] The invention provides a soil conditioner, comprising the Cladosporium taro strain D5-11 or the fermentation product and / or metabolite and auxiliary materials.

[0009] The present invention provides application of the Cladosporium taro strain D5-11, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting.

[0010] Preferably, the improved plant living environment includes at least one of the following: promoting soil aggregation, reducing the concentration of soluble ions in the environment and improving the growth performance of microorganisms.

[0011] Preferably, the microorganisms include microorganisms that grow in saline-alkali environments.

[0012] Preferably, the plant cultivation includes improving the plant's antioxidant capacity.

[0013] Preferably, the method of improving the salt-alkali resistance of plants includes at least one of the following: increasing the superoxide dismutase content and / or malondialdehyde content in the roots of plants.

[0014] Preferably, the plants include food crops and / or cash crops.

[0015] Beneficial effects:

[0016] The invention provides a Cladosporium colombiae strain D5-11, with a deposit number of CGMCC No. 41143. The Cladosporium colombiae strain D5-11 has strong alkali resistance and can still maintain a high growth rate when the pH value is 10.33; the Cladosporium colombiae strain D5-11 can promote the agglomeration of saline-alkali soil by secreting extracellular polymer uronic acid and humic acid, and promote the formation of large aggregates of saline-alkali soil; the Cladosporium colombiae strain D5-11 can reduce the sodium ion concentration in the matrix and improve the plant growth environment; the Cladosporium colombiae strain D5-11 is inoculated into the plant growth environment to improve the antioxidant property of the plant.

[0017] The present invention provides the application of the taro cladosporium strain D5-11, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the living environment of plants and / or plant planting. The present invention carries out an experiment of inoculating the taro cladosporium strain D5-11 into the soil, and the results show that the inoculation of the taro cladosporium strain D5-11 can significantly increase the content of uronic acid and humic acid in the soil, and significantly increase the proportion of large aggregates in the soil, and improve the aggregate MWD and GWD index, indicating that the inoculation of the taro cladosporium strain D5-11 promotes the formation of large aggregates in saline-alkali soil by secreting extracellular polymers uronic acid and humic acid. Another embodiment of this invention determines the effect of the taro cladosporium strain D5-11 on the sodium ion content in the soil environment, and the results show that the taro cladosporium strain D5-11 can significantly reduce the concentration of soluble Na ions in the soil environment. The present invention also measures the effect of the metabolites of Cladosporium taro strain D5-11 on the growth rate of fertile soil fungi Mortierella capitis and Mortierella longispore in an alkaline environment. The results show that the metabolites of Cladosporium taro strain D5-11 have the effect of enhancing the alkali resistance of Mortierella capitis and Mortierella longispore. Under relatively high alkaline conditions, the metabolites of D5-11 can significantly increase the growth rate of both Mortierella. The present invention further measures the effect of Cladosporium taro strain D5-11 on plant growth in saline-alkali soil. The results show that Cladosporium taro has a strong alkali resistance, can be applied to farmland with a moderate degree of salinity, and can increase the superoxide dismutase content and malondialdehyde content in the roots of rice to enhance the antioxidant capacity of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : are morphological images of Cladosporium taro strain D5-11, wherein a is a front view in PDA medium, b is a reverse view in PDA medium, and c is a morphological image in soil after air-drying;

[0019] Figure 2 This is a microscopic structure of Cladosporium taro D5-11, where the scale bar is 50 μm;

[0020] Figure 3 This is the evolutionary tree of Cladosporium tarosum strain D5-11 constructed based on ITS sequences;

[0021] Figure 4 The growth trend of Cladosporium taro strain D5-11 on different buffer system mineral medium (GY)

[0022] Figure 5 This is a morphological picture of Cladosporium taro strain D5-11 on the funnel soil culture medium, where a is the indigenous microorganisms as the control group, and b is Cladosporium taro strain D5-11;

[0023] Figure 6 The diagram of the salt excretion determination process of saline-alkali soil in different treatment groups, where a is the blank control and b is the Cladosporium taro strain D5-11;

[0024] Figure 7 This is a graph showing the growth of Mortierella cephalosporium Y61 in GY medium, where the first row is the control group, the second row is the metabolite group of Cladosporium truncatum D5-11, and the pH values ​​of the GY medium from left to right are 7.08, 8.04, 9.02, 10.00 and 11.00;

[0025] Figure 8 This is a graph showing the growth of Mortierella longispora F30 in GY medium, where the first row is the control group, the second row is the metabolite group of Cladosporium truncatum D5-11, and the pH values ​​of GY medium from left to right are 7.08, 8.04, 9.02, 10.00 and 11.00;

[0026] Fig. 9 This is a graph showing the growth of Mortierella in different gradient pH media.

[0027] Biomaterial Deposit Information

[0028] The Cladosporium colombiae strain was deposited in the General Microbiology Center of the China Culture Collection Administration on April 2, 2024. The abbreviation of the unit is Institute of Microbiology, Chinese Academy of Sciences, and the address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCCNo.41143 and the strain number is D5-11. DETAILED DESCRIPTION

[0029] The invention provides a Cladosporium colombiae strain D5-11, whose preservation number is CGMCC No.41143.

[0030] In the present invention, the Cladosporium taro strain D5-11 is isolated from saline-alkali farmland soil. The Cladosporium taro strain D5-11 grows on potato dextrose agar (PDA) medium, and the colony morphology of Cladosporium taro D5-11 is irregular, and the colony surface has wrinkles after culturing and maturation. The ITS sequence of the strain D5-11 is as shown in SEQ ID NO: 1 (AAAAATTAGGTGACCCCGGTCTACCACCGGGATGTT CATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGG Based on the NCBIblast results, the strain had a sequence similarity of 98.89% with Cladosporium colombiae, and the phylogenetic tree was constructed using the Mega 7.0 neighbor-joining method ( Figure 3 ), combined with phylogenetic tree analysis, morphological analysis and physiological and biochemical characteristics of the strain, strain D5-11 was identified as Cladosporium colombiae.

[0031] The present invention provides a fermentation product and / or metabolite of the Cladosporium taro strain D5-11.

[0032] In the present invention, the fermented product is preferably prepared by the following method: the Cladosporium taro strain D5-11 is inoculated into a potato dextrose agar (PDA) medium for static culture to obtain an activated mycelium block, and the activated mycelium block is cultured in potato dextrose water (PD) to obtain a fermented product. The temperature of the static culture and the culture is preferably 23-28°C, more preferably 24-26°C, and most preferably 25°C, and the time is independently preferably 3-8d, more preferably 4-6d, and most preferably 5d. The components of the PDA medium preferably include 180-220g of potato, 18-22g of glucose, and 18-22g of agar per 1000mL of deionized water, and more preferably include 200g of potato, 20g of glucose, and 20g of agar; the pH value of the PDA medium is preferably 6-8, more preferably 6.5-7.5, and most preferably 7. The components of the PD are preferably based on the components of the PDA medium without agar. The metabolite is preferably prepared by the following method: filtering the fermented product and separating the liquid phase, wherein the liquid phase is the metabolite. The effective viable count of Cladosporium taro strain D5-11 per milliliter of the fermented product is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6 Copy number.

[0033] The Cladosporium taro strain D5-11 of the present invention has strong alkali resistance and can still maintain a high growth rate when the pH value is 11; the Cladosporium taro strain D5-11 can promote the agglomeration of saline-alkali soil by secreting extracellular polymer uronic acid and humic acid, and promote the formation of large aggregates of saline-alkali soil; the Cladosporium taro strain D5-11 is inoculated into a matrix, so as to reduce the sodium ion content in the matrix and improve the plant growth environment; the Cladosporium taro strain D5-11 is inoculated into the plant growth environment, so as to improve the antioxidant property of the plant; in addition, the Cladosporium taro strain D5-11 can also improve the alkali resistance of Mortierella capitis and Mortierella longispora in an alkaline environment and promote their growth.

[0034] Based on the property of the strain D5-11 in promoting plant growth, the present invention provides a bacterial fertilizer, comprising the Cladosporium taro strain D5-11 or the fermentation product and / or metabolite and auxiliary materials.

[0035] In the present invention, the effective viable count of Cladosporium taro strain D5-11 per gram of the bacterial fertilizer is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6The preparation method of the bacterial fertilizer is not particularly limited, and the preparation scheme of the bacterial fertilizer well known in the art can be used, for example, the activated and expanded Cladosporium taro strain D5-11 is mixed with auxiliary materials. The present invention does not specifically limit the components of the auxiliary materials, and the auxiliary materials of the bacterial fertilizer well known in the art can be used, such as macroelements, secondary elements, trace elements, and components that promote soil aggregate formation, improve soil compaction, etc.

[0036] Based on the property of strain D5-11 in improving the plant growth environment, the present invention provides a soil conditioner, comprising the Cladosporium taro strain D5-11 or the fermentation product and / or metabolite and auxiliary materials.

[0037] In the present invention, the effective viable count of Cladosporium coriaceae strain D5-11 per gram of the soil conditioner is preferably not less than 10 4 The copy number is preferably 10 5 ~10 8 The copy number is preferably 10 6 The present invention has no special limitation on the preparation method of the soil conditioner, and the soil conditioner preparation scheme known in the art can be adopted, for example, the activated and expanded Cladosporium taro strain D5-11 is mixed with auxiliary materials to obtain the soil conditioner.

[0038] The present invention provides application of the Cladosporium taro strain D5-11, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting.

[0039] In the present invention, the plants preferably include food crops and / or cash crops. The food crops preferably include any one of the following: wheat, rice, corn, oats, rye, barley, millet, sorghum and highland barley. The cash crops preferably include any one of the following: vegetable crops, fiber crops, oil crops, sugar crops, oil crops and medicinal crops. The pH value of the plant's living environment or planting matrix is ​​preferably 5 to 9.2, more preferably 8 to 9.2, and most preferably 9. The salt content of the plant's living environment or planting matrix preferably includes 0.05% to 0.2%, more preferably 0.08% to 0.12%, and most preferably 0.1%.

[0040] In the present invention, the improved plant living environment preferably includes at least one of the following: promoting soil aggregation, reducing the concentration of soluble ions in the environment and improving the growth performance of microorganisms.

[0041] In the present invention, the matrix of the plant living environment preferably includes ordinary soil and saline-alkali soil. The saline-alkali soil preferably contains the following components: total nitrogen 0.45-0.5g / kg, alkaline nitrogen 40-50mg / kg, available phosphorus 15-20mg / kg, available potassium 140-160mg / kg, organic matter 10-11g / kg, salt concentration 0.9-1.1g / kg, pH=8.5-11; more preferably: total nitrogen 0.47g / kg, alkaline nitrogen 46.50mg / kg, available phosphorus 17.50mg / kg, available potassium 153mg / kg, organic matter 10.58g / kg, salt concentration 1.08g / kg, pH=9.16.

[0042] One embodiment of the present invention determines the effect of Cladosporium taro strain D5-11 on soil agglomeration, and the results show that compared with the control, Cladosporium taro strain D5-11 significantly increases the proportion of large aggregates in the soil, aggregate MWD and GWD index, indicating that inoculation of Cladosporium taro strain D5-11 has a significant effect on promoting soil agglomeration. The present embodiment further determines the content of extracellular polymers in the soil after inoculation of Cladosporium taro strain D5-11, and the results show that compared with the control, Cladosporium taro strain D5-11 can significantly increase the content of uronic acid in the soil, indicating that the strain promotes the formation of large aggregates in saline-alkali soil to a certain extent by secreting extracellular polymer uronic acid. One embodiment of the present invention determines the sodium ion content in the environment of Cladosporium taro strain D5-11, and the results show that compared with the control, Cladosporium taro strain D5-11 can significantly reduce the soluble ion concentration and sodium ion content in the environment.

[0043] In the present invention, the microorganisms preferably include microorganisms that grow in saline-alkali environments.

[0044] In one embodiment of the present invention, the effect of the metabolites of Cladosporium taro strain D5-11 on the growth rate of Mortierella capitis and Mortierella longispora in an alkaline environment was determined. The results showed that the metabolites of Cladosporium taro strain D5-11 have the effect of enhancing the alkali resistance of Mortierella capitis and Mortierella longispora. Under relatively high alkaline conditions (pH = 10), the D5-11 metabolites can significantly increase the growth rate of both Mortierella.

[0045] In the present invention, the promoting plant growth preferably includes improving plant antioxidant capacity.

[0046] In the present invention, the improving the salt-alkali resistance of plants preferably includes at least one of the following: increasing the superoxide dismutase content and / or malondialdehyde content in the roots of plants.

[0047] One embodiment of the present invention determines the effect of Cladosporium taro strain D5-11 on rice growth in saline-alkali soil, and the results show that the fresh weight of rice roots inoculated with Cladosporium taro strain D5-11 is significantly increased compared with the control group, indicating that Cladosporium taro strain D5-11 can promote root growth in saline-alkali environments. The content of proline, malondialdehyde and superoxide dismutase in the rice root system inoculated with Cladosporium taro strain D5-11 is extremely significantly increased compared with the control group, indicating that Cladosporium taro strain D5-11 improves the salt-alkali resistance of the rice root system.

[0048] In the present invention, the method for using the Cladosporium taro strain D5-11, the fermentation product and / or metabolite, the bacterial fertilizer or the soil conditioner in improving the plant living environment and / or plant planting is preferably: applying the fermentation product and / or metabolite of the Cladosporium taro strain D5-11, the bacterial fertilizer or the soil conditioner to the roots of the plants. The effective viable bacterial count of the Cladosporium taro strain D5-11 is preferably not less than 10 4 The number of copies / g is preferably 10 5 ~10 8 The number of copies / g is preferably 10 6 Copy number / g.

[0049] In order to further illustrate the present invention, the embodiments provided by the present invention are described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be understood as limiting the protection scope of the present invention.

[0050] Medium composition and preparation of mycelial blocks

[0051] Preparation of potato dextrose agar (PDA) medium: 200 g of potato, 20 g of glucose and 20 g of agar were included in every 1000 mL of deionized water.

[0052] Preparation of mineral culture medium (GY): 20 g glucose, 10 g yeast extract, 2 g KNO3, 1 g NaH2PO4, 0.3 g MgSO4·7H2O, dilute to 1000 mL with buffer, wherein the pH buffer system is prepared as follows: pH = 7.0-8.0 (0.1 M KH2PO4 + 0.1 M NaOH); pH 9.0-10.0 (0.1 M NaHCO3 + 0.1 M Na2CO3); pH 11.0 (0.05 M Na2HPO4 + 0.1 M NaOH) (Wu et al., 2019. Thermomonospora catenispora sp.nov., isolated from mushroom comppost, Int J Syst Evol Microbiol 69: 2465-2470). After adjusting the pH of the culture medium with 1M NaOH solution or 1M HCl solution, dispense into Erlenmeyer flasks (100mL / bottle) and add 2g of agar. After sufficient shaking, seal and sterilize with high-pressure steam. After sterilization, pour the plate into a clean bench.

[0053] Preparation method of mycelial block of Cladosporium taro strain D5-11: pick up mycelium of Cladosporium taro strain D5-11 in a clean bench and place it in a PDA plate culture medium with pH 7.0 for activation, and culture it upright in the dark at 25° C. for 5 days, and use a puncher of corresponding size to punch holes to obtain mycelial blocks.

[0054] Preparation method of blank agar block: Pour the prepared PDA culture medium into the culture dish, and after condensation, an agar block with a thickness of 0.3 cm is obtained. The PDA flat culture dish is cultured upright at 25°C in the dark for 5 days to obtain a blank agar block. Use a puncher of corresponding size to punch holes to obtain a blank agar block.

[0055] Preparation method of Laburnicola dactylidis D1-1 mycelium block: the same as the preparation method of Cladosporium corophyllum strain D5-11 mycelium block, the only difference is that the selected mycelium is Laburnicola dactylidis mycelium block. Laburnicola dactylidis D1-1 strain was isolated from saline-alkali soil and preserved for a long time by the farmland productivity green regulation and functional fertilizer research group of the College of Resources and Environment of Henan Agricultural University.

[0056] Example 1

[0057] Screening method for Cladosporium corophyllum strains

[0058] Strain D5-11 was isolated from saline-alkali farmland soil. The colony morphology of strain D5-11 on PDA plate was irregular, and the surface of the colony was wrinkled after cultivation (see Figure 1 A and Figure 1 b), the microstructure of Cladosporium taro strain D5-11 is shown in Figure 2 .

[0059] Molecular identification of strain D5-11: DNA of strain D5-11 was extracted and amplified by PCR using ITS-F and ITS-R primers. The ITS sequence was obtained by sequencing as shown in SEQ ID NO: 1 (AAAAATTAGGTGACCCCGGTCTACCACCGGGATGTTCATAACCCTTTGTT GTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTT The strain was aligned with the sequence in the GenBank database by BLAST. Based on the NCBIblast results, the sequence similarity between the strain and Cladosporium colombiae was as high as 98.89%. The phylogenetic tree was constructed using the Mega7.0 neighbor-joining method ( Figure 3 ), combined with phylogenetic tree analysis, morphological analysis and physiological and biochemical characteristics of the strain, strain D5-11 was identified as Cladosporiumcolombiae.

[0060] Cladosporium colombiae strain D5-11 was deposited in the General Microbiological Center of China Microorganism Culture Collection on April 2, 2024, with the deposit number CGMCC No. 41143. The address of the deposit center is Institute of Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0061] Example 2

[0062] Growth rate of Cladosporium tarosum strain D5-11 under saline-alkali conditions

[0063] Experimental group: The activated mycelium of Cladosporium taro strain D5-11 was inoculated into GY medium with different pH values, with a mycelium block size of 5.0 mm. Three groups of different pH mediums were made in parallel. The culture was carried out at room temperature (28°C) in the dark for ten days, during which the mycelium growth rate was recorded.

[0064] Mortierella longispora control: The treatment was the same as the experimental group, except that the activated Mortierella longispora hyphae blocks were inoculated into GY culture media with different pH values.

[0065] When the colony is about to fill the plate, measure its diameter, record the culture time, and calculate the growth rate of the bacteria. The statistical results of mycelium growth diameter under different pH conditions are shown in Figure 4 .Depend on Figure 4 It can be seen that the pH of the culture medium has a significant effect on the growth of the D5-11 strain. Overall, as the pH value of the culture medium increases, the growth rate of the strain slows down to a certain extent. However, in different buffer systems, the degree of reduction in the growth rate of the strain varies. Among them, there is a large amount of CO3 in the culture medium with pH = 10.01. 2- and HCO3 - The combined effects of high alkalinity and large amounts of carbon salts had a serious toxic effect on the D5-11 strain; however, the strain could still grow in the medium with pH = 9.06, indicating that the reduction of alkalinity in the medium would alleviate the CO3 2- and HCO3 - Effect on strain activity. In the medium with pH = 11.05, D5-11 quickly recovered to the pH level of 8.00, indicating that D5-11 has a strong ability to withstand high pH, ​​but it is not very sensitive to CO3 2- and HCO3 - The tolerance level is limited.

[0066] Example 3

[0067] Function of Cladosporium tarosum strain D5-11 in promoting aggregate formation in saline-alkali soil

[0068] Preparation of soil matrix: Saline-alkali soil with a pH value of 9.16 was sieved through a 100-mesh sieve, and corn stalks were sieved through a 75-mesh sieve and then sterilized with high-pressure steam. The sterilized saline-alkali soil and corn stalks were mixed in a clean bench at a mass ratio of 100:1, and distributed onto plates (15 g per plate). Sterile water was added dropwise to the center of the plate to adjust the moisture content to 60% to simulate the field water holding capacity, and water was added in time according to the water loss during the cultivation process.

[0069] Experimental group: A 1-cm-diameter agar mycelium block of Cladosporium taro strain D5-11 was inoculated in the center of the soil matrix, 0.5 mL of PD culture solution was dripped around the mycelium block, and cultured under sterile constant temperature conditions at 25°C.

[0070] Blank control: The treatment method was the same as the experimental group, the only difference being that the soil matrix was not sterilized during preparation, and a blank agar block was implanted in the center of the non-sterilized soil matrix containing indigenous microorganisms.

[0071] D1-1 strain control: The treatment method was the same as the experimental group, the only difference being that a Laburnicoladactylidis D1-1 agar mycelium block was inoculated in the center of the soil matrix.

[0072] Twenty plates were prepared for each treatment, and the soil aggregate content and the amount of extracellular polymers produced in each treatment group were determined after forty days of cultivation.

[0073] The determination method of soil aggregate content in each treatment group is as follows:

[0074] After 40 days of cultivation, 15 plates were randomly selected from each treatment group and air-dried (see Figure 1 c), the air-dried soil culture medium is randomly divided into three groups and placed in ziplock bags for aggregate component screening, and the method is as follows: accurately weigh 50.00g of soil sample, place it on a 1mm sieve, add distilled water to cover the soil sample and let it stand for 3 minutes, shake for two minutes, with an amplitude of 3cm, one up and one down of the sieve, and a frequency of 30 times / min. Then transfer the soil sample on the sieve, and then sieve it through 0.25mm and 0.053mm sieves in turn and transfer it (repeat the above operation three times in parallel). Dry and weigh each component after screening, record the data, calculate the average weight diameter according to formula I, and calculate the geometric mean diameter according to formula II.

[0075]

[0076] Where MWD is the mean weight diameter, is the average diameter of the i-th level soil aggregates (mm); W i is the mass percentage (%) of the corresponding size aggregates in the total aggregates; n is the number of separated aggregates.

[0077]

[0078] Where GWD is the geometric mean diameter, is the average diameter of soil aggregates of the ith particle size (mm); W i is the mass percentage of the corresponding size aggregates in the total aggregates (%); n is the number of separated aggregates

[0079] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The results of soil aggregate content determination in each treatment group are shown in Table 1. As shown in Table 1, compared with the blank control, the proportion of aggregates of particle size >0.25 mm in the embodiment increased by 68%, the average mass diameter (MWD) increased by 27.5%, and the geometric mean diameter (GWD) increased by 15.5%, indicating that the inoculation of Cladosporium taro strain D5-11 has a significant effect on promoting soil agglomeration. The inoculation of Cladosporium taro D5-11 significantly increased the proportion of large aggregates in saline-alkali soil, and at the same time increased the average mass diameter and geometric mean diameter of aggregates in saline-alkali soil.

[0080] Table 1 Determination of soil aggregate content in each treatment group

[0081]

[0082] Note: Different small letters represent significance at the p≤0.05 level.

[0083] The method for determining the extracellular polymer production capacity of each treatment group is as follows:

[0084] (1) Extraction of extracellular polymers: After 40 days of cultivation, 3 g of fresh soil samples from 5 plates were taken from each treatment group and placed in a 50 mL polypropylene centrifuge tube. 30 mL of 0.1 M CaCl2 solution was added and mixed evenly to remove soluble organic matter in the soil. The centrifuge tube was placed in ice, vibrated back and forth at 120 rpm for 2 h, and centrifuged at 3200 g for 30 min. The supernatant was discarded, and 15.98 g of sodium ion exchange resin CER and 25 mL of buffer were added to the precipitate. The supernatant containing extracellular polymers was transferred to a new test tube, quickly frozen in liquid nitrogen, and stored at -80 °C for later use. Three parallel experiments were repeated.

[0085] The buffer solution is prepared by containing 0.76 g Na3PO4·12H2O, 0.552 g NaH2PO4·H2O, 0.526 g NaCl, and 0.0746 g KCl per 1 L of sterile water, adjusting the pH value to 7.0 with 1 M HCl solution, and precooling at 4°C.

[0086] (2) Determination of extracellular polymer uronic acid: Take 200 μL of the supernatant containing extracellular polymers, add 1.2 mL of 0.0125 M sodium tetraborate solution (prepared with concentrated sulfuric acid), and vortex for 45 seconds. Place in a 100°C water bath for 5 minutes and cool on ice. After 3 minutes, add 20 μL of 0.15% (v / v) m-m-hydroxybiphenyl solution (the solvent is 0.5% sodium hydroxide solution). Shake gently to mix the solution and let it stand for 4 minutes. Take a sample of 200 μL and use an ELISA reader to measure the absorbance at 520 nm.

[0087] Method for preparing the standard curve: 0, 4, 20, 60, 100 and 200 μL of 25 μg / mL D-glucronic acid stock solution were respectively drawn, and the volume was supplemented to 200 μL with deionized water for reaction and colorimetry.

[0088] (3) Determination of extracellular polymer humic acid: prepare two plates, marked as A and B plates. Add 100 μL of the supernatant containing extracellular polymers to each well of plate A, then add 100 μL of solution A, and mix the solution by vertically aspirating with a pipette; add the same volume of solution B to plate B, and perform other operations the same as plate A. Repeat 3 times for each sample in plates A and B. After placing the two plates in a dark environment for 10 minutes, immediately add 100 μL of Folin reagent to terminate the reaction to reduce time error. After standing for 30 minutes, use an ELISA reader to measure the absorbance at 750 nm.

[0089] Prepare Folin phenol solution: dilute 2N Folin phenol solution 10 times with deionized water for later use.

[0090] Prepare liquid A: weigh 3.5 g of copper sulfate pentahydrate and dissolve it in 100 mL of water to obtain liquid (a); weigh 7.0 g of potassium sodium tartrate and dissolve it in 100 mL of water to obtain liquid (b); weigh 70 g of sodium carbonate and dissolve it in 1 L of 0.35 N sodium hydroxide solution to obtain liquid (c); mix liquid (a), liquid (b) and liquid (c) in a ratio of 1:1:100 (5 mL, 5 mL, 500 mL) to obtain liquid A.

[0091] Prepare Solution B by mixing 5 mL, 5 mL and 500 mL of deionized water, Solution (b) and Solution (c).

[0092] The humic acid content was calculated according to formula III.

[0093] Humic acid content = 1.25Abs B-0.25Abs A Formula III

[0094] Where Abs B represents the absorbance of plate B, and AbsA represents the absorbance of plate A.

[0095] Method for preparing humic acid standard curve: 0.04g humic acid was diluted to 100mL with deionized water. Three replicates were set for each group. 0μL, 25μL, 50μL, 75μL, and 100μL of bovine serum albumin solution and humic acid solution were added to different wells of two plates, and the buffer was added to 100μL. The other steps were repeated for the sample determination, and the reaction and colorimetry were performed.

[0096] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The results of the determination of the extracellular polymer content of each group are shown in Table 2. As shown in Table 2, after the inoculation of Cladosporium corophyllum strain D5-11, the content of uronic acid in the soil was significantly higher than that of the blank control and the D1-1 strain control, with an increase of 35.59% compared with the blank control; its humic acid content increased by nearly 20% compared with comparative example 1, indicating that the strain promotes the formation of large aggregates in saline-alkali soil by secreting extracellular uronic acid and humic acid.

[0097] Table 2 Determination of extracellular polymer content in soil of each treatment group

[0098] deal with Uronic acid content (mg / kg) Humic acid content (mg / kg) Experimental Group 77.75±9.83a 205.21±1.96a Blank control 57.34±0.60b 171.35±18.73a D1-1 strain control 54.56±7.13b 163.67±12.78a

[0099] Note: Different small letters represent significance at the p≤0.05 level.

[0100] Example 4

[0101] Function of Cladosporium taro strain D5-11 in promoting salt removal from saline-alkali soil

[0102] Preparation of culture medium: Plug the neck of the short-necked funnel with absorbent cotton, seal the upper opening with sealing film and newspaper, put it in a plastic bag and seal it with high-pressure steam sterilization (121℃, 5min). After sterilization, seal the bottom of the funnel tightly with sealing film in the clean bench to make the funnel in a fully sealed and sterile state. Complete the packaging of sterile soil samples in the clean bench, and add 20g of sterilized straw and sterilized soil samples (the mass ratio of saline-alkali soil: corn straw is 100:1) to each funnel. After packaging, carefully drop 6mL of sterile water for balance and standby.

[0103] Experimental group: The agar mycelium block of Cladosporium taro strain D5-11 was inoculated into the prepared culture medium with an inoculation shovel, 0.5 mL of PD culture solution was added around the inoculated mycelium block, the funnel was sealed and cultured at a constant temperature of 25°C for 13 days, with four replicates.

[0104] Blank control: The treatment method is the same as the experimental group, the only difference is that the culture medium is not sterilized during preparation and blank agar blocks are inoculated.

[0105] After the culture is completed, the mixture is air-dried to a constant weight without disturbance (see Figure 5), put it on a 100mL measuring bucket, add 50mL of distilled water at one time, let it stand for 30 minutes, open the sealing film under the funnel, and wait for the water to flow down automatically under the action of gravity (see Figure 6 ). When the water stops flowing downward, record the water volume of each sample and calculate the change of the maximum water holding capacity in the field. Collect the solution in the bucket, measure the pH value and EC value, and then pass the filtrate through a 0.45μm membrane to measure its Na ion content with a flame photometer. Continue to dry the soil in the funnel and measure the soil EC value.

[0106] SPSS20.0 statistical software was used for analysis, and the experimental data were expressed as "mean ± standard error". The filtrate and soil pH, EC and sodium ion content of each treatment group are shown in Table 3. As shown in Table 3, compared with the blank control, the EC value and sodium ion content of the filtrate were significantly increased after inoculation with Cladosporium taro D5-11, among which the EC value of the filtrate increased by 41.4% and the sodium ion content increased by 46.2%. At the same time, the EC value of the soil decreased significantly, decreasing by 26.0%. From this data, it is inferred that the inoculation of Cladosporium taro D5-11 will affect the adsorption and fixation of cations in the soil to a certain extent, and promote the conversion of some non-free sodium into free sodium. This phenomenon shows that the inoculation of Cladosporium taro D5-11 can promote the salt discharge process of saline-alkali soil to a certain extent.

[0107] Table 3 Filtrate and soil pH, EC and sodium ion content of each treatment group

[0108]

[0109] Note:" * "Indicates that the difference is significant at the P = 0.05 level." ** ” indicates that the difference reached significance at the P = 0.01 level.

[0110] Example 5

[0111] Effects of Cladosporium corophylla on rice growth in saline-alkali soil

[0112] Preparation of liquid culture medium: The soil sample was selected from Northeast saline-alkali soil, with a total nitrogen content of 0.47 g / kg, alkaline nitrogen content of 46.50 mg / kg, available phosphorus content of 17.50 mg / kg, available potassium content of 153 mg / kg, organic matter content of 10.58 g / kg, pH = 9.16, and soil salt content of 1.08 g / kg. Pass through a 20-mesh sieve, weigh 40 g of soil sample, put it into a 250 mL conical flask, add 100 mL of sterile water, seal the upper opening with sealing film and newspaper, and sterilize with high-pressure steam (121°C, 5 min).

[0113] Experimental group: In the clean bench, inoculate a 0.8cm diameter agar mycelium block of Cladosporium taro D5-11 in the soil liquid culture medium. After sealing, shake the flask for ten seconds and place it on the table at room temperature of 25℃ for incubation. Incubate at room temperature for 13 days with three parallel sets.

[0114] Blank control: No mycelium blocks were inoculated into the soil liquid culture matrix, and other conditions were the same as those of the experimental group.

[0115] D1-1 strain control: Agar mycelium blocks of Laburnicola dactylidis D1-1 were inoculated in the soil liquid matrix, and the rest were the same as the experimental group.

[0116] After the culture is completed, the supernatant in the culture medium is carefully collected in a clean bench to measure the pH and EC. The supernatant is then carefully drained and the remaining soil is sealed with a sealing film for rice cultivation.

[0117] Disinfection and germination of rice: Select Songliao 186 rice, select 50 rice seeds, soak and disinfect them in 30% hypochlorous acid for 10 minutes, and rinse them with sterile water 5 times. Completely wash away the residual hypochlorous acid solution. Soak the rice seeds in distilled water at 37°C in the dark for 3 days to germinate.

[0118] Rice inoculation and cultivation: In a clean bench, germinated rice seeds were planted in triangular bottles, with 3 germinated seeds in each bottle. After sealing with sealing film, they were placed in a constant temperature incubator for cultivation. The daytime was set to 16 hours, 28°C, and the light intensity was 30,000 lm (level 10, 30,000 lumens); the night was set to 8 hours, 20°C, and dark. The cultivation lasted for 14 days. On the 5th day, 100 mL of sterile distilled water was added. When the plant height was 10 cm, the seedlings were removed, and 1 seedling was left in each pot. After 14 days of cultivation, the root system was scanned and its aboveground biomass, root proline, malondialdehyde, catalase, and superoxide dismutase were measured. The superoxide dismutase, malondialdehyde, catalase, and proline contents of rice roots were determined using superoxide dismutase, malondialdehyde, catalase, and proline kits, respectively (Suzhou Keming Biotechnology Co., Ltd.).

[0119] After the incubation, the upper soil liquid was removed, and the remaining soil was dried to determine the soil exchangeable sodium and alkalinity. SPSS statistical software was used for analysis, and the experimental data were expressed as "mean ± standard deviation".

[0120] The physicochemical indexes of the supernatant of the soil rice culture medium of each treatment group are shown in Table 4, and the content of the stress resistance index of the rice root system of each treatment group is shown in Table 5. According to the data in Tables 4 and 5, the EC value in the soil solution of the experimental group is significantly lower than that of the control, indicating that Cladosporium taro D5-11 has the effect of adhering to salt ions in saline-alkali soil and reducing the toxicity of crop roots. The superoxide dismutase content of the rice root system in the experimental group is extremely significantly higher than that of the control group, and the malondialdehyde content is significantly higher than that of the control, indicating that Cladosporium taro D5-11 strains improve the antioxidant capacity of rice.

[0121] Table 4 Physicochemical indexes of rice culture medium supernatant in each treatment group

[0122] deal with pH EC(μs / cm) Experimental Group 7.52±0.18a 1439.00±47.04b Blank control 7.38±0.08a 1966.33±224.07a D1-1 strain control 7.98±0.03a 1967.00±89.76a

[0123] Note: Different lowercase letters represent significant differences at the P=0.05 level.

[0124] Table 5 Contents of stress resistance indexes of rice roots in each treatment group

[0125]

[0126]

[0127] Note: Different lowercase letters represent significant differences at the P=0.05 level.

[0128] Example 6

[0129] Effects of the metabolites of Cladosporium truncatum D5-11 on the pH tolerance of Mortierella

[0130] Preparation of D5-11 metabolites: Operate in a clean bench, inoculate activated D5-11 mycelium blocks into autoclaved PD culture bottles, seal and place in a shaker for culture (25°C, 160rpm) for five days, and take out and let stand after the culture. Filter the supernatant with a 0.22-micron sterile filter in a clean bench to prepare a sterile filtrate of Cladosporium taro D5-11 metabolites, seal and sterile and store for later use.

[0131] Control group: After mineral culture media with different gradient pH values ​​were poured onto plates in the clean bench, activated Mortierella capitis (Y61) and Mortierella longispora (F30) were inoculated with a single bacterium, and three plates were made in parallel for each pH gradient.

[0132] Metabolite group: The prepared mineral culture medium with different pH gradients was heated in a microwave oven to melt and then cooled to warm temperature. The metabolites of Cladosporium tarosum D5-11 (5 mL metabolites / 100 mL mineral culture medium) were added to the warm culture medium in an ultra-clean bench. After being shaken thoroughly, the plates were poured and inoculated with activated Mortierella capitis and Mortierella longispora blocks respectively. Three plates were repeated in parallel for each pH gradient.

[0133] After all the inoculations were completed, the samples were sealed with sealing film and moved into a constant temperature incubator (25°C) to be cultured in the dark. The growth of Mortierella capitis (Y61) and Mortierella longispora (F30) was observed. Figure 7 and Figure 8 ) and record the length of hyphae growth.

[0134] The results of mycelium length determination of the control group Mortierella cephalosporin (Y61) and the metabolite group Mortierella cephalosporin (Y61+D5-11 metabolites) are shown in Table 6, and the results of mycelium length determination of the control group Mortierella longisporin (F30) and the metabolite group Mortierella longisporin (F30+D5-11 metabolites) are shown in Table 7. Fig. 9 The following is a statistical chart of the growth of Mortierella in different gradient pH media. Fig. 9 As shown in Table 7, with the increase of pH value, the hyphae growth rate of Mortierella cephalosporin (Y61) showed a decrease to varying degrees. Compared with the control group, after adding the D5-11 metabolite, the decline in the hyphae growth rate of Mortierella cephalosporin was slowed down, indicating that the D5-11 metabolite improved the alkali resistance of Mortierella cephalosporin to a certain extent. Among them, on the mineral culture medium with pH = 8.04, the growth rate of Mortierella cephalosporin in the embodiment was significantly different from that of the control example; under the relatively high alkaline pH = 11.00 condition, the embodiment was extremely significantly different from the control example. It is inferred that under the alkaline conditions of pH = 8.04 and pH = 11.00, the D5-11 metabolite has a better effect on improving the alkali resistance of Mortierella cephalosporin.

[0135] Under alkaline conditions of pH=7.08, pH=8.04, and pH=9.02, the growth rate of Mortierella longispora after adding D5-11 metabolites was lower than that of the control group, and reached significant differences under alkaline conditions of pH=7.08 and pH=9.02, indicating that under relatively low alkaline conditions, D5-11 metabolites weakened the alkali resistance of Mortierella longispora to a certain extent. Under alkaline conditions of pH=10.00, the growth rate of Mortierella longispora in the example was good, and there was a very significant difference compared with the comparative example. The results showed that under this alkaline condition, the addition of D5-11 metabolites can significantly enhance the alkali resistance of Mortierella longispora.

[0136] The above results show that the metabolite D5-11 has the effect of enhancing the alkali resistance of Mortierella capitis and Mortierella longispora. For Mortierella capitis and Mortierella longispora, the effect of D5-11 metabolites on enhancing their alkali resistance is different, but under high alkaline conditions, D5-11 metabolites can significantly enhance the alkali resistance of both Mortierella, showing a good effect.

[0137] Table 6 Determination of hyphae length of the control group Mortierella cephalosporium (Y61) and the metabolite group (Y61+D5-11 metabolite)

[0138]

[0139] Note: "*" represents significant difference at P = 0.05 level. "**" represents significant difference at P = 0.01 level.

[0140] Table 7 Determination of hyphae length of the control group Mortierella longispora (F30) and the metabolite group (F30+D5-11 metabolite)

[0141]

[0142] Note: "*" represents significant difference at P = 0.05 level. "**" represents significant difference at P = 0.01 level.

[0143] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A Cladosporium colombiae strain D5-11, characterized in that The deposit number of the Cladosporium taro strain D5-11 is CGMCC No.41143.

2. A fermentation product and / or metabolite of the Cladosporium tarosum strain D5-11 according to claim 1.

3. A bacterial fertilizer, characterized in that: It comprises the Cladosporium taro strain D5-11 according to claim 1 or the fermentation product and / or metabolite and auxiliary materials according to claim 2.

4. A soil conditioner, characterized in that: It comprises the Cladosporium taro strain D5-11 according to claim 1 or the fermentation product and / or metabolite and auxiliary materials according to claim 2.

5. Use of the Cladosporium taro strain D5-11 according to claim 1, the fermentation product and / or metabolite according to claim 2, the bacterial fertilizer according to claim 3 or the soil conditioner according to claim 4 in improving the living environment of plants and / or plant planting.

6. The use according to claim 5, characterized in that: The improved plant living environment includes at least one of the following: promoting soil aggregation, reducing the concentration of soluble ions in the environment and improving the growth performance of microorganisms.

7. The use according to claim 6, characterized in that: The microorganisms include microorganisms that grow in saline-alkali environments.

8. The use according to claim 5, characterized in that: The plant cultivation includes improving the antioxidant capacity of the plant.

9. The use according to claim 7, characterized in that: The method of improving the salt-alkali resistance of plants comprises at least one of the following: increasing the superoxide dismutase content and / or malondialdehyde content in the roots of plants.

10. The use according to any one of claims 5 to 9, characterized in that: The plants include food crops and / or cash crops.

Images