Application of penicillium oxalicum in degrading metolachlor and promoting soil phosphate solubilization and preparation containing penicillium oxalicum

Abstract

The invention relates to the technical field of microbial preparations. The invention provides application of penicillium oxalicum to degradation of metolachlor and promotion of soil phosphate solubilization and a preparation containing the penicillium oxalicum, the preservation name of the penicillium oxalicum is penicillium oxalicum MET-F-1, the Latin name is Penicillium oxalicum, the preservation place is China General Microbiological Culture Collection Center, and the preservation number is CGMCC NO. The preservation date is May 24, 2018, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.15861. The penicillium oxalicum MET-F-1 and secretions thereof can be used as aboriginal degradation functional bacteria transport carriers and auxiliary carbon sources, the degradation efficiency of florae on new pollutants such as pesticides, antibiotics and hormones can be improved, soil hydrological characteristics and soil agglomeration can be improved, meanwhile, organic acids such as oxalic acid can be secreted, the soil pH can be reduced, the phosphorus dissolving effect can be achieved, and the penicillium oxalicum MET-F-1 and secretions thereof can be applied to soil remediation. Therefore, crop growth is promoted.

Description

Technical Field

[0001] The invention relates to the technical field of microbial preparations, and in particular to an application of Penicillium oxalicum in degrading metolachlor and promoting soil phosphate solubilization, and a preparation containing the Penicillium oxalicum. Background Art

[0002] Isopropylamine is a widely used and persistent chloroacetamide herbicide, commonly used to control annual grass weeds and broadleaf weeds on crops such as corn, cotton, potatoes and soybeans. As a commonly used herbicide, isopropylamine is more persistent in the soil than other chloroacetamide herbicides such as atrazine and acetochlor. Due to its relatively high water solubility, it easily leaches into groundwater and runs off into surface water. At the same time, isopropylamine is also a possible human carcinogen, identified as a Class C carcinogen by the US Environmental Protection Agency. Therefore, the environmental and human health problems caused by it are becoming increasingly serious and need to be solved urgently.

[0003] Studies have found that some herbicides such as isopropylamine are mainly degraded by functional microorganisms, which use herbicides and other pesticides as carbon sources or degrade them through co-metabolism with other nutrients, thereby accelerating the elimination of herbicides in the soil. Therefore, the development of microbial degradation technology has become an important technical guarantee for the remediation of isopropylamine-contaminated soil.

[0004] However, the development of microbial technology for reducing pollution and fertilizing farmland soil is still in its early stages. A large number of strains have single functions and are not suitable for the actual needs of farmland environments. Microorganisms need to be combined and strengthened before application to improve system stability and enrich the functions of strains that actually need to be complementary. However, the current bacterial community construction is often only a stacking of a few bacteria according to corresponding functions, which has poor stability in the actual environment and limited function. This is also one of the main technical bottlenecks that currently restrict the large-scale promotion and application of microbial regulation technology.

[0005] According to current research findings, functional fungi can build a complex flora with bacteria to synergistically exert their functions. Combined with laboratory research, it was found that Penicillium oxalicum has a good degradation effect on isopropylamine. At the same time, it can be used for plant disease prevention and control. The known disease prevention mechanisms include secretion of enzymatic substances, induction of resistance, etc. It also has the functions of dissolving phosphorus and degrading antibiotics, as well as improving the quality of agricultural products and promoting growth. Therefore, it is very feasible to use its degradation and growth-promoting effects to solve the problem of isopropylamine pollution in the field and promote crop growth. However, how to combine it with bacteria and introduce it into contaminated soil in farmland needs to be studied. Summary of the invention

[0006] The purpose of the present invention is to provide an application of Penicillium oxalicum in degrading metolachlor and promoting soil phosphate solubilization and a preparation containing the Penicillium oxalicum. In order to solve the problem of high residual amount of metolachlor in farmland, the present invention provides a microbial agent for degrading metolachlor in farmland soil. The microbial agent has good ability to degrade metolachlor, and provides a preparation method and application technology of the microbial agent.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides an application of oxalic acid Penicillium in degrading isopropylamine and / or promoting soil phosphate solubilization. The oxalic acid Penicillium is deposited as Penicillium oxalicum MET-F-1, its Latin name is Penicillium oxalicum, its deposit location is the General Microbiological Center of China National Committee for the Collection of Microorganisms, its deposit date is May 24, 2018, and its deposit number is CGMCC No.15861.

[0009] Preferably, the DNA gene sequence of the Penicillium oxalicum is as shown in SEQ ID NO.1.

[0010] The present invention also provides the use of Penicillium oxalicum MET-F-1 in preparing a preparation for degrading metolachlor and / or promoting soil phosphorus solubilization.

[0011] The present invention also provides a method for preparing a preparation for degrading isopropylamine and / or promoting soil phosphorus solubilization, comprising the following steps:

[0012] (1) inoculating Penicillium oxalicum MET-F-1 into a culture medium, and obtaining green mycelium of Penicillium oxalicum MET-F-1 after culturing;

[0013] (2) transferring the mycelium of Penicillium oxalate MET-F-1 into water to obtain a spore suspension of Penicillium oxalate MET-F-1;

[0014] (3) The bacterial liquid of Penicillium oxalicum MET-F-1 and wheat bran are mixed and cultured to obtain the preparation.

[0015] Preferably, the culture medium in step (1) uses water as a solvent and contains the following raw materials in concentrations: 4-8 g / L potato extract, 15-25 g / L agar, and 15-25 g / L glucose; the pH value of the culture medium is 5.4-5.8, and the culture medium is sterilized at 115-121° C. for 15-25 min before use.

[0016] Preferably, in step (1), the culture time of Penicillium oxalicum MET-F-1 is 66 to 78 hours, and the culture temperature is 28 to 32°C.

[0017] Preferably, the concentration of the spore suspension of Penicillium oxalicum MET-F-1 in step (2) is 1×10 5 CFU / g~1×10 7 CFU / g.

[0018] Preferably, the inoculation amount of the spore suspension of Penicillium oxalicum MET-F-1 in the wheat bran in step (3) is 10-20% of the mass of the wheat bran.

[0019] Preferably, the effective viable count of Penicillium oxalicum MET-F-1 in the preparation in step (3) is 1.5×10 8 CFU / g~3.5×10 8 CFU / g.

[0020] The present invention also provides a preparation for degrading metolachlor and / or promoting soil phosphorus solubilization, which is prepared by the preparation method.

[0021] The invention provides an application of Penicillium oxalicum in degrading metolachlor and promoting soil phosphate solubilization and a preparation containing the Penicillium oxalicum. The deposited name of the Penicillium oxalicum is Penicillium oxalicum MET-F-1, the Latin name is Penicillium oxalicum, the deposited place is the General Microbiological Center of China National Committee for the Collection of Microorganisms, the deposited date is May 24, 2018, and the deposited number is CGMCC No.15861.

[0022] The present invention found that the interaction between fungi and bacteria plays an important role in the co-metabolic biotransformation of new pollutants. The oxalicum Penicillium MET-F-1 of the present invention not only has a strong survival ability under extreme environmental conditions, but also its fungi and secretions can be used as a transport carrier and auxiliary carbon source for indigenous degradation functional bacteria (such as Figure 1 Fungi and bacteria often coexist in the same micro-regions to carry out nutrient cycling and other biogeochemical processes, such as biotransformation of organic pollutants. Filamentous fungi are highly adapted to heterogeneous environments due to their space-filling hyphal structure and are able to transport nutrients from their hyphae to oligotrophic areas to provide nutrients for functional bacteria and achieve the purpose of pollutant degradation.

[0023] The oxalic acid Penicillium MET-F-1 of the present invention increases the degradation efficiency of the bacterial community to new pollutants such as pesticides, antibiotics and hormones, and can also improve the soil hydrological characteristics and soil agglomeration through static electricity, adhesion and entanglement mechanisms. At the same time, it can also secrete organic acids such as oxalic acid, reduce soil pH, and achieve the effect of dissolving phosphorus, thereby promoting crop growth. Combined with its characteristics, it is very feasible to use this fungus to carry out MET contaminated soil remediation. According to laboratory research on different loading materials, it is found that the number of effective live bacteria of oxalic acid Penicillium loaded with wheat bran is the largest (as shown in Table 1), so subsequent studies select wheat bran to load functional bacteria. The repair technology of this functional fungus composite bacteria will show an important role in new quality productivity and provide a strong technical guarantee for farmland soil decontamination and efficiency enhancement.

[0024] Collection Instructions

[0025] Penicillium oxalicum, the preservation name is Penicillium oxalicum MET-F-1, the Latin name is Penicilliumoxalicum, the preservation location is the General Microbiology Center of China Microorganism Culture Collection Administration, the preservation date is May 24, 2018, the preservation address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.15861. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Transporting nutrients for fungi and assisting in the growth of bacterial metabolism maps;

[0027] Figure 2 is the residue and degradation rate of metolachlor in soil;

[0028] Figure 3 is the soil pH change curve in the soil;

[0029] Figure 4 It is the change of soil available phosphorus content in soil;

[0030] Figure 5 is the effective viable count of Penicillium oxalicum in the MBF treatment group;

[0031] Figure 6 is the residue of isopropylamine in farmland soil. DETAILED DESCRIPTION

[0032] The invention provides an application of oxalic acid Penicillium in degrading isopropylamine and / or promoting soil phosphate solubilization. The oxalic acid Penicillium is deposited as Penicillium oxalicum MET-F-1, its Latin name is Penicillium oxalicum, its deposit location is the General Microbiological Center of China National Committee for the Collection of Microorganisms, its deposit date is May 24, 2018, and its deposit number is CGMCC No.15861.

[0033] In the present invention, the DNA gene sequence of the Penicillium oxalicum is shown as SEQ ID NO.1.

[0034] The present invention also provides the use of Penicillium oxalicum MET-F-1 in preparing a preparation for degrading metolachlor and / or promoting soil phosphorus solubilization.

[0035] The present invention also provides a method for preparing a preparation for degrading isopropylamine and / or promoting soil phosphorus solubilization, comprising the following steps:

[0036] (1) inoculating Penicillium oxalicum MET-F-1 into a culture medium, and obtaining green mycelium of Penicillium oxalicum MET-F-1 after culturing;

[0037] (2) transferring the mycelium of Penicillium oxalate MET-F-1 into water to obtain a spore suspension of Penicillium oxalate MET-F-1;

[0038] (3) The bacterial liquid of Penicillium oxalicum MET-F-1 and wheat bran are mixed and cultured to obtain the preparation.

[0039] In the present invention, the culture medium in step (1) preferably uses water as a solvent, more preferably sterile water, and preferably contains the following raw materials in the following concentrations: 4-8 g / L potato extract powder, 15-25 g / L agar, and 15-25 g / L glucose, and more preferably: 6 g / L potato extract powder, 20 g / L agar, and 20 g / L glucose; the pH value of the culture medium is preferably 5.4-5.8, and more preferably 5.6. The culture medium is preferably sterilized at 115-121° C. for 15-25 min before use, and more preferably sterilized at 115° C. for 20 min.

[0040] In the present invention, the culture time of Penicillium oxalicum MET-F-1 in the culture medium in step (1) is preferably 66 to 78 hours, more preferably 72 hours, and the culture temperature is preferably 28 to 32°C, more preferably 30°C.

[0041] In the present invention, the concentration of the spore suspension of Penicillium oxalicum MET-F-1 in step (2) is preferably 1×10 5 CFU / g~1×10 7 CFU / g, more preferably 1×10 6 CFU / g.

[0042] In the present invention, the inoculation amount of the spore suspension of Penicillium oxalicum MET-F-1 in the wheat bran in step (3) is preferably 10-20% of the mass of the wheat bran, and more preferably 15%.

[0043] In the present invention, the effective viable count of Penicillium oxalicum MET-F-1 in the preparation in step (3) is preferably 1.5×10 8 CFU / g~3.5×10 8 CFU / g, more preferably 2.5×10 8 CFU / g.

[0044] The present invention also provides a preparation for degrading metolachlor and / or promoting soil phosphorus solubilization, which is prepared by the preparation method.

[0045] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0046] Example 1 Preparation and use of a bacterial agent containing Penicillium oxalicum MET-F-1

[0047] 1. A method for preparing a microbial agent containing Penicillium oxalicum MET-F-1 for degrading isopropylamine and / or promoting soil phosphate solubilization, comprising the following steps:

[0048] Step 1: Use potato dextrose agar solid culture medium to culture Penicillium oxalicum MET-F-1 until green hyphae appear on the surface of the culture medium.

[0049] Step 2: Transfer the cultured Penicillium oxalicum MET-F-1 into sterile water, stir evenly, and measure the viable bacteria count. 6 About CFU / g can be used for experiments.

[0050] Step 3: Weigh a certain amount of fine wheat bran, sterilize it with wet heat, and place it in a sterile environment. Add sterile water to a water content of 60%, add an appropriate amount of MET-F-1 strain spore suspension (inoculation volume is 15%), stir evenly, and regularly stir and ventilate. When the wheat bran turns obviously light green, it can be used. At this time, the number of viable bacteria reaches 2.5*10 8 CFU / g or so.

[0051] Note: In the step 1, take out the oxalicum Penicillium MET-F-1 stored at 4°C, scrape a small amount of mycelium with an inoculation loop, streak it on potato dextrose agar solid culture medium, and culture it in an artificial climate incubator at 30°C.

[0052] In the step 1, the composition and content of the potato dextrose agar solid culture medium per liter are: potato extract powder 6g / L; agar: 20g / L; glucose: 20g / L; pH value 5.6±0.2; high pressure sterilization at 115°C for 20 minutes.

[0053] 2. Method for using the prepared microbial agent for degrading isopropylamine and / or promoting soil phosphate solubilization:

[0054] (1) Broadcasting: The prepared microbial agent is crushed and evenly spread on the field;

[0055] (2) Soil turning and watering: Turn the soil to make the applied microbial agent evenly distributed in the surface soil, and water the soil promptly after turning the soil.

[0056] The rDNA-ITS sequence of the oxalicum Penicillium MET-F-1 is shown in SEQ ID NO.1:

[0057] SEQ ID NO.1:

[0058] GAGCACAACACGACAATTCCTCGTGTCGTGCTTCGATCTAATATGAGAACCAAACTGACTCAAGATTCAGGCAAACCATTGCTGGTGAGCACGGCCTTGACGGCGATGGCCAGTAAGTCAACAGTTTGGCCCCCCCCCCCCCCACGATGAGATCTTGACGACAGAGAATGGCGGTCTGATATTTTCGGTTCAGCTACAACGGTTCC TCCGACCTCCAGCTGGAGCGCCTGAACGTCTACTTCACCCACGTAAGTCGTGAAAAATGTCTTCCCAATCACAGAAATCTCCCAAACCTGACCATTGAAACGTTCAATTTTCCAGGCTAGCGGTGACAAGTATGTTCCCCGTGCCGTTCTCGTCGACCTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCCTTTTGGCAAGCT.

[0059] The above rDNA-ITS sequence consists of 414 bases (bp).

[0060] Table 1 Effective viable bacterial counts of Penicillium oxalicum on different loading materials stored at room temperature (×10 5 CFU / g)

[0061]

[0062] Detailed description: This table shows the screening of Penicillium oxalicum loading materials. Under normal temperature conditions, 15% of each loading material was inoculated and stored indoors to test the survival of the bacteria over time. As can be seen from Table 1, both wheat bran and rice bran, two loading materials, showed good loading effects, maintaining a high level of survival and proliferation rate of Penicillium oxalicum. In particular, wheat bran performed more prominently, with the number of live bacteria after 90 days of culture reaching more than 8 times that of the initial culture. Therefore, wheat bran was selected as the loading material for the bacteria.

[0063] Example 2 Laboratory Test

[0064] 1. Materials and methods

[0065] 1.1 Samples, instruments, reagents and culture media

[0066] 1.1.1 Test soil

[0067] The test soil was collected from the surface soil (0-20 cm) of Shandong Qingyun Experimental Base, and the sample soil was sieved through a 2 mm sieve.

[0068] 1.1.2 Test strains

[0069] Laboratory culture of Penicillium oxalicum MET-F-1

[0070] 1.1.3 Main reagents and instruments

[0071] Reagents: Isopropylamine technical was purchased from Tianjin Alta Technology Co., Ltd.; methanol and formic acid (chromatographic grade) were purchased from Thermo Fisher Scientific Inc., USA; acetonitrile (analytical grade) was purchased from Tianjin Concord Technology Co., Ltd.; PSA was purchased from Tianjin Bonaiger Technology Co., Ltd.; anhydrous magnesium sulfate and sodium chloride (analytical grade) were purchased from Shanghai McLean Biochemical Technology Co., Ltd.; wheat bran was purchased from Shandong Aikote Pesticide Development Co., Ltd.

[0072] Instrument consumables: ML104 electronic balance, purchased from Mettler Toledo China Co., Ltd.; MTV-100 multi-tube vortex mixer, purchased from Hangzhou Aosheng Instrument Co., Ltd.; H2050R-1 centrifuge, purchased from Hunan Xiangyi Laboratory Instrument Development Co., Ltd.; 0.22 μm microporous filter membrane (Pall, USA), purchased from Coretech Technology Co., Ltd.

[0073] 2. Methods

[0074] 2.1 Wheat bran inoculant culture

[0075] Scrape the mycelium of Penicillium oxalicum MET-F-1 cultured in the laboratory into sterile water, shake well, take 20 ml and add it into a beaker containing 60 g of wheat bran and stir evenly, place it in an artificial climate incubator and culture it until more blue mold appears on the wheat bran. The viable bacteria count is 10 6CFU / g or so can be used for the experiment. The same operation was performed on the wheat bran treatment group, except that the bacterial solution was replaced with sterile water, and the amount of water added was consistent with the amount of bacterial solution to ensure the consistency of the experiment.

[0076] Sterile water was added to the cultured wheat bran inoculum to moisten the inoculum to prevent the escape of mold spores. At the same time, the same amount of sterile water was added to the wheat bran to ensure consistent treatment for subsequent experimental additions.

[0077] 2.2 Experimental procedures

[0078] The experiment was divided into three treatments, CK, MB, and MBF. Each treatment was repeated three times. The experimental settings are shown in Table 2. The specific experimental steps are as follows: Weigh 4 kg of air-dried soil that had passed through a 2 mm sieve, add 4 mL of 50 g / L isopropylamine mother solution to make the actual concentration of pesticide in the soil 50 mg / kg, place it in a fume hood and wait for the solvent acetone to evaporate, then fully mix the soil for use. According to the treatment group settings, add the corresponding wheat bran and wheat bran fungus agent and mix them, and divide 200 g of the contaminated soil into a 250 mL beaker, then add distilled water to adjust the soil moisture content to 60% of the maximum water holding capacity (i.e., the soil moisture content is 23% w / w), and place it in an artificial climate box for cultivation. The culture conditions are: temperature, 20 ° C; light: night = 16:8h; light intensity, 800 lux; humidity, 80%. Distilled water was added to the beaker every 72 hours to maintain the soil moisture content. The experimental period was 21 days, and soil samples were collected on days 0, 3, 7, 14, and 21. After the experiment, the soil samples were freeze-dried and sieved, and 5.00 g was accurately weighed in a 50 ml centrifuge tube. After adding 5 ml ultrapure water and 10 ml acetonitrile solution, the mixture was vortexed at 2500 r / min for 5 min. After adding 3 g NaCl, the mixture was vortexed again at 2500 r / min for 5 min, and then centrifuged at 8000 r / min for 5 min. 2.5 mL of the supernatant was transferred to a 10 mL centrifuge tube, 80 mg Cleanert PSA and 150 mg anhydrous magnesium sulfate were added, and the mixture was vortexed at 1000 r / min for 5 min, and then centrifuged at 4000 r / min for 5 min to obtain the supernatant. 0.5 mL of the supernatant was taken, 0.5 mL of ultrapure water was added, and the mixture was vortexed and mixed to pass through a 0.22 μm filter membrane. The residual amount of isopropylamine was determined by ultra-high performance liquid chromatography. The specific settings and results are shown in Tables 2 and 3.

[0079] 2.3 Detection method of pesticide metolachlor residues

[0080] 2.3.1 External standard method: Dilute the isopropylamine standard solution with equal volumes of acetonitrile: deionized water (1:1) to concentrations of 10, 5, 2, 1, 0.5, 0.2, 0.1, and 0.05 mg / L, and then measure with ultra-high performance liquid chromatography, inject 1 μL each time, process each sample 3 times, and take the average value of the peak area. Make a standard curve with concentration as the horizontal axis and peak area as the vertical axis.

[0081] 2.3.2 Liquid chromatography conditions of isopropylamine: Waters ACQUITY UPLC HSS T3 chromatographic column, 1.8 μm*2.1 mm*100 mm; column oven temperature: 30°C; mobile phase: gradient elution, 0 min: acetonitrile: ultrapure water (10:90), 1 min: acetonitrile: ultrapure water (10:90), 5 min: acetonitrile: ultrapure water (70:30), 7 min: acetonitrile: ultrapure water (10:90), hold for 2 min; wavelength: 230 nm.

[0082] Table 2 The significance of different numbered processing representations

[0083]

[0084]

[0085] Table 3 Residues and degradation rates of metolachlor in different treatments

[0086]

[0087] Table 4 Changes of pH value in different treatments

[0088]

[0089] Table 5 Available phosphorus content in different treatments

[0090]

[0091] The results showed that the degradation effect of isopropylamine in the wheat bran treatment group (MB) (degradation rate was 35.58% after 7 days of cultivation) was significantly improved compared with CK (degradation rate was 5.62% after 7 days of cultivation), but the degradation effect of isopropylamine in the wheat bran inoculant treatment group (MBF) (degradation rate was 80.90% after 7 days of cultivation) was better than that in the MB treatment group, and the difference between the two groups was significant. As can be seen from Tables 4 and 5, the addition of wheat bran inoculants will also have an impact on the physical and chemical properties of the soil. After adding wheat bran and wheat bran inoculants, the pH value can be reduced and the available phosphorus content can be increased. However, the effect of the MBF group on the physical and chemical properties was higher than that of the MB group. In the presence of Penicillium oxalicum, organic acids were secreted, which reduced the soil pH value and increased the available phosphorus content in the soil. At the same time, Figure 6It can be seen that after one week of cultivation, the number of live bacteria of Penicillium oxalicum is still at a relatively high level, and MET degradation can continue to play a degradation and growth-promoting role in the subsequent soil.

[0092] Example 3 Field test

[0093] 1. Wheat bran inoculant culture

[0094] Fine wheat bran was placed in a clean plastic box, and the solid plate of Penicillium oxalicum cultured in the laboratory was scraped into 300 ml of sterile water with an inoculation loop. After the mycelium was mixed, it was added to the fine wheat bran according to the treatment (sterile water was added to the MCK group, 50 ml of bacterial solution was added to the MB group, and 250 ml of bacterial solution was added to the HMB group).

[0095] At the same time, sterile water was added to make the moisture content of wheat bran 23%, and then stirred evenly. Plastic film was covered on top and punctured to maintain air permeability. Isopropylamine was sprayed on the farmland at twice the recommended field application rate, and the wheat bran inoculant cultured in the laboratory was crushed and evenly spread on the field. The soil was turned over to make the inoculant evenly distributed in the surface soil, and then sprinkled to maintain soil moisture. After 60 minutes, the five-point method was used for sampling, which was the 0th day. The specific settings and results are shown in Tables 6 and 7.

[0096] Table 6 The significance of different numbering treatments

[0097] Processing number Processing significance MET Only spraying isopropylamine in the field MCK Adding wheat bran to MET MB Add 0.5% wheat bran fungus agent to MET HMB Add 2.5% wheat bran fungus agent to MET

[0098] Table 7 MET residues in different treatments

[0099]

[0100]

[0101] From the above results, it can be seen that the use of the microbial agent provided by the present invention for the remediation of the soil contaminated by isopropylamine has a good effect on the degradation of isopropylamine, and the residual amount of isopropylamine is greatly reduced compared with the treatment without the agent. It is also found that in the presence of the microbial agent, organic acids can be secreted to reduce the soil pH, achieve the effect of dissolving phosphorus, and thus promote crop growth.

[0102] It can be seen from the above embodiments that the present invention provides an application of Penicillium oxalicum in degrading isopropylamine and promoting soil phosphate solubilization and a preparation containing the Penicillium oxalicum. The deposited name of the Penicillium oxalicum is Penicillium oxalicum MET-F-1, the Latin name is Penicillium oxalicum, the deposited place is the General Microbiological Center of the China Microbiological Culture Collection Administration, the deposited date is May 24, 2018, and the deposited number is CGMCC No. 15861. The Penicillium oxalicum MET-F-1 and its secretions of the present invention can be used as a transport carrier and auxiliary carbon source for indigenous degradation functional bacteria, increase the degradation efficiency of the bacterial community to new pollutants such as pesticides, antibiotics and hormones, and can also improve the soil hydrological properties and soil agglomeration. At the same time, it can also secrete organic acids such as oxalic acid, reduce soil pH, achieve phosphate solubilization effect, and thus promote crop growth.

[0103] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of Penicillium oxalicum in degrading metolachlor and / or promoting soil phosphate solubilization, characterized in that: The deposited name of the oxalic acid Penicillium is Penicillium oxalicum MET-F-1, its Latin name is Penicillium oxalicum, its deposit location is the General Microbiology Center of China Microorganism Culture Collection Administration, its deposit date is May 24, 2018, and its deposit number is CGMCC No.15861.

2. The use according to claim 1, characterized in that: The DNA gene sequence of the Penicillium oxalicum is shown as SEQ ID NO.

1.

3. Application of Penicillium oxalicum MET-F-1 in the preparation of preparations for degrading isopropylamine and / or promoting soil phosphate solubilization.

4. A method for preparing a preparation for degrading isopropylamine and / or promoting soil phosphate solubilization, characterized in that: The steps include: (1) inoculating Penicillium oxalicum MET-F-1 into a culture medium, and obtaining green mycelium of Penicillium oxalicum MET-F-1 after culturing; (2) transferring the mycelium of Penicillium oxalate MET-F-1 into water to obtain a spore suspension of Penicillium oxalate MET-F-1; (3) The bacterial liquid of Penicillium oxalicum MET-F-1 and wheat bran are mixed and cultured to obtain the preparation.

5. The use according to claim 4, characterized in that: The culture medium in step (1) uses water as a solvent and contains the following raw materials in concentrations: 4-8 g / L potato extract powder, 15-25 g / L agar, and 15-25 g / L glucose; the pH value of the culture medium is 5.4-5.8, and the culture medium is sterilized at 115-121° C. for 15-25 min before use.

6. The use according to claim 4, characterized in that: The culturing time of the oxalicum Penicillium MET-F-1 in step (1) is 66 to 78 hours, and the culturing temperature is 28 to 32°C.

7. The use according to claim 4, characterized in that: The concentration of the spore suspension of Penicillium oxalicum MET-F-1 in step (2) is 1×10 5 CFU / g~1×10 7 CFU / g.

8. The use according to claim 4, characterized in that: The inoculation amount of the spore suspension of Penicillium oxalicum MET-F-1 in the wheat bran in step (3) is 10-20% of the mass of the wheat bran.

9. The use according to claim 4, characterized in that: The effective viable count of Penicillium oxalicum MET-F-1 in the preparation in step (3) is 1.5×10 8 CFU / g~3.5×10 8 CFU / g.

10. The preparation for degrading metolachlor and / or promoting soil phosphorus solubilization prepared by the preparation method according to claims 4 to 9.

Images