Capping modification method based on functional nucleic acid molecules and application
By modifying the 5' end hat structure of nucleic acids with catalytic function, the problem of poor stability of nucleic acid drugs in vivo is solved, and its stability and activity in vitro and in vivo is significantly improved, and better performance in animal models are shown. Tumor targeted inhibitory effect.
Patent Information
- Application Number
- CN202410741188.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2024-12-13
AI Technical Summary
Existing gene therapy based on nucleic acid drugs faces problems of stability, poor catalytic activity, and instability in vitro and in vivo, resulting in limited application in biomedical development.
The 5'-end cap structure is used to cap and modify nucleic acids with catalytic functions to improve their stability and activity in vitro and in vivo. The mRNA sequences of genes such as KRAS, PDL1, and ALas1 are used as targets, and pistol ribozymes are used as representatives. Nucleic acid molecules are modified with caps.
It significantly improves the half-life and degradation rate of nucleic acids, enhances its target gene inhibition effect in cells, and shows better tumor-targeted inhibition effect in animals.
Smart Images
Figure CN119120461A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a capping modification method based on functional nucleic acid molecules and its application. Background Art
[0002] Gene therapy can achieve the purpose of efficiently regulating coding and non-coding target genes by specifically targeting specific genes in specific cells in tissues, splicing mRNA precursors, repairing defective RNA, or restoring gene function in an enzyme-dependent or enzyme-independent manner. It has broad therapeutic prospects for a variety of human diseases such as cancer, viral infection, and genetic diseases, and is one of the important therapeutic strategies for precision medicine. Functional nucleic acids, as candidate structures for the new generation of gene therapy strategies, mainly include antisense oligonucleotides, ribozymes and deoxyribozymes, small interfering RNA, various miRNA inhibitors, nucleic acid aptamers, etc., with the characteristics of strong specificity, high efficiency, low immunogenicity, and a wide range of applications. They are increasingly showing their important role and have potential clinical application prospects.
[0003] Nucleic acids with catalytic function are special nucleic acid molecules with enzymatic activity, which can catalyze reactions such as hydrolysis, ester transfer, and ligation like proteases. Specifically, they include various RNAs (such as Hammerhead ribozymes, Hairpin ribozymes, HDV ribozymes, Twister ribozymes, Twister Sister ribozymes, Pistol ribozymes, GroμpI intron, Groμp II intron, DNAzyme, XNAzyme, deoxyribozymes, introns, spliceosomes), deoxyribozymes (DNAzyme) | XNAzyme, and various other natural or artificially screened nucleic acid molecules with catalytic function. Among them, hammerhead ribozymes have been used as a representative nucleic acid with catalytic function in the development and research of small nucleic acid drugs. However, due to the fact that its stability in cells and catalytic activity are quite different from those in vitro, the biomedical development of small nucleic acid drugs based on ribozymes has come to a halt.
[0004] Nucleic acid drug molecules are structurally the same as endogenous nucleic acid molecules and are easily degraded by various endonucleases and exonucleases. Their ribose-phosphate backbone structure is negatively charged and highly polar, and cannot fully meet the basic conditions for use as a drug. Disadvantages such as rapid renal clearance and poor pharmacokinetic properties also limit the development of gene-based nucleic acid drug therapy. Therefore, it is crucial to optimize the performance and improve the stability of nucleic acid drugs in vivo by making various modifications to nucleic acid drugs.
[0005] Studies have found that the 5′ cap structure can regulate the splicing and maturation of mRNA, and help RNA transcription products pass through the selective pores of the nuclear membrane into the cytoplasm to avoid mRNA recognition through the cell's innate immune mechanism. In addition, the 5′ cap structure can also protect mRNA from degradation by nuclease exonucleases, stabilize and improve the translation of the protein it encodes, so the cap structure (cap) is crucial for mRNA. In the prior art, cap analog structures are mostly used in the modification research of mRNA. So far, there has been no precedent for applying this cap modification to other functional nucleic acids or more specifically to the modification of nucleic acids with catalytic functions. In view of the similarity between the composition of non-mRNA functional nucleic acids, including nucleic acids with catalytic functions and mRNA, the 5′ cap structure can also be used to cap nucleic acids with catalytic functions. This modification brings changes to the chemical and physical properties of nucleic acid molecules with catalytic functions. Summary of the invention
[0006] In view of this, the purpose of the present invention is to provide a method for modifying nucleic acids with catalytic functions: using a cap structure and its analogs to perform cap modification on the 5′ end of nucleic acids with catalytic functions. The functional nucleic acids modified with the cap structure have the following advantages: (1) high efficiency of in vitro enzyme cleavage; (2) long half-life in vitro and slow degradation rate in a simulated serum environment; (3) efficient degradation of target gene activity in cells; (4) better tumor targeting inhibition effect in animals than unmodified or otherwise modified nucleic acid sequences.
[0007] The present invention adopts the following technical scheme: using the mRNA sequences of genes such as KRAS, PDL1, ALas1 as representative targets, and using pistol ribozymes targeting the corresponding genes as representative nucleic acid molecules with catalytic functions for capping modification. Through in vitro enzyme activity assays, cell experiments, and animal experiments, it was verified that this capping modification has a significant effect on improving the activity and stability of nucleic acids with catalytic functions.
[0008] The functional nucleic acid molecule is characterized in that the basic combination is Formula 1:
[0009]
[0010] in,
[0011] R is
[0012] X1 and X2 are any of natural, non-natural or modified nucleoside bases A, U, C and G;
[0013] R1, R2, R3 are O or S;
[0014] R4 and R5 can be H, OH or O-CH3 independently or simultaneously;
[0015] Preferably,
[0016] R is
[0017] X1 and X2 are one of the natural nucleoside bases A, U, C, and G;
[0018] R1, R2, and R3 are O;
[0019] R4 is OH;
[0020] R5 is OH;
[0021] Preferably, the RNA / DNA is a functional nucleic acid molecule, mainly including Pistol ribozyme and its derivative structures.
[0022] Preferably, the functional nucleic acid molecule itself or after binding to a ligand, has the ability to target and degrade the target nucleic acid molecule and its various chemically modified derivatives.
[0023] Preferably, the functional nucleic acid molecule is characterized in that: its 5′ end is a single-stranded RNA molecule with a 5′-triphosphate, or can form a 5′-triphosphate structure through chemical modification or phosphorylation reaction.
[0024] Preferably, the ribozyme is as shown in the sequence of SEQ ID NO.1;
[0025] Preferably, the ribozyme can specifically recognize and cleave mutant KRAS G12V gene mRNA by base complementary pairing, exhibits more efficient and stable cleavage properties in in vitro enzyme activity assays, and can better inhibit KRAS gene expression in cells and animals.
[0026] Preferably, after the ribozyme is capped, its inhibitory activity on genes PDL1 and ALas1 in cells is higher.
[0027] Preferably, the method for preparing the capping modification of the nucleic acid molecule having catalytic function comprises the steps of:
[0028] (1) Taking the pistol ribozyme as an example, the pistol ribozyme molecule is prepared by transcription;
[0029] (2) Taking Cap0 as an example, the prepared pistol ribozyme was capped using the cap structure Cap0.
[0030] Preferably, the capped modified pistol ribozyme has better targeted inhibition of KRAS G12V gene mRNA target than the unmodified same pistol ribozyme sequence in in vitro and in vivo validation experiments and applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Schematic diagram of the design structure of the capping modified ribozyme of the present invention;
[0032] Figure 2 This is a diagram showing the electrophoresis purification result of the ribozyme after capping in Example 2;
[0033] Figure 3 is a comparison diagram of the cleavage of the substrate by the ribozyme before and after capping in Example 3;
[0034] Figure 4 is a comparison diagram of the in vitro simulated stability of ribozyme molecules before and after capping in Example 4;
[0035] Figure 5 is a comparison chart of the in vitro serum stability of ribozyme molecules before and after capping in Example 5;
[0036] Figure 6 The results of fluorescence quantitative PCR and Western Blot of ribozyme molecules targeting KRAS target gene before and after capping in Example 6; A. Fluorescence quantitative PCR result of ribozyme targeting KRAS before and after capping; B. Western Blot result of ribozyme targeting KRAS before and after capping; C. Fluorescence quantitative PCR result of ribozyme targeting gene PDL1 before and after capping; D. Fluorescence quantitative PCR result of ribozyme targeting gene ALas1 before and after capping;
[0037] Figure 7 This is a graph showing the toxicity test results of the ribozyme molecules before and after capping in Example 7 at the SW620 cell level;
[0038] Figure 8 It is the changes of tumor volume and body weight of nude mice during drug administration.
[0039] Fig. 9 These are the results of mouse tumor tissue sections, including HE staining (A) and immunohistochemistry (B). DETAILED DESCRIPTION
[0040] The embodiments of the present invention are described below with reference to the accompanying drawings.
[0041] Example 1: Obtaining Ribozyme Molecules by In Vitro Transcription
[0042] The designed ribozyme molecules are amplified and transcribed by PCR.
[0043] The RNA sequence of each designed ribozyme was converted into a corresponding DNA sequence, and a T7 RNA polymerase recognition site was added upstream of each DNA sequence. The sequence was shown in SEQ ID NO.1 to form a DNA forward primer sequence required for transcribing each ribozyme molecule. The corresponding reverse complementary sequence was obtained using sequence analysis software, and the primer synthesis company synthesized the primer.
[0044] SEQ ID NO.1: GGTAATACGACTCACTATAGCG
[0045] The synthesized DNA primers were purified and recovered by 10% polyacrylamide gel, resuspended in Hepes (pH 7.0, 5 mM NaCl) buffer and the sample concentration was adjusted to 5 μM. Then, two complementary DNA primers of equal volume were mixed and heated in a 95°C dry bath for 10 minutes, and cooled on ice for annealing and hybridization. The double-stranded DNA molecules after hybridization were used as templates for RNA in vitro transcription, and the sequence of ribozyme P12V-17 was obtained by T7 RNA polymerase transcription method. SEQ ID NO.2: CGUGGUUAGGGCCACGUUAAAUAGGCCAUUAAGCCCUAAGCGAGCUCCAACUACCACAA.
[0046] The in vitro transcription reaction system and transcription conditions are as follows:
[0047] 5× transcription buffer 10 μL (components include Tris HCl, MgCl2, DTT, spermine, and distilled water);
[0048] 80 mM NTP 5 μL;
[0049] 5 μL of double-stranded DNA template;
[0050] T7 RNA polymerase 2 μL;
[0051] Fill the system to 50 μL with ultrapure water;
[0052] In vitro transcription conditions: Incubate in a 37°C water bath or constant temperature incubator for 3 h.
[0053] After the transcription is completed, add Loading bμffer to terminate the reaction, purify by electrophoresis with 10% polyacrylamide gel, recover the ribozyme sample by electroelution, and then add an equal volume of pre-cooled isopropanol for precipitation. The ribozyme sample after precipitation is centrifuged at high speed, the supernatant is removed, and the white precipitate is the ribozyme, which is placed in a vacuum dryer and evaporated for later use.
[0054] Example 2: The purified P12V-17 ribozyme (SEQ ID NO. 2) was subjected to a capping reaction, and the reaction system was as follows:
[0055] Table 1 Ribozyme capping system
[0056]
[0057] Reaction conditions: 37℃ water bath for 60min. After capping, polyacrylamide gel electrophoresis was performed again to remove the bμffer components in the reaction system. The electrophoresis results are as follows: Figure 2 As shown, the target band was electro-washed and recovered, and the capped-modified ribozyme capped-P12V-17 (SEQ ID NO. 3: capped-CGUGGUUAGGGCCACGUUAAAUAGGCCAUUAAGCCCUAAGCGAGCUCCAACUACCACAA) was precipitated with isopropanol and used for subsequent experiments after the concentration was determined.
[0058] Example 3: Comparison of in vitro enzymatic activity of ribozyme molecules before and after capping
[0059] The wild-type P12V-17 (SEQ ID NO.2) or the capped-P12V-17 (SEQ ID NO.3) with the concentration of 0.25 μM, 0.5 μM, 1 μM was reacted with the target gene substrate KRAS (SEQ ID NO.4: GUUGGAGCUGUUGGCGGUGAUCUGGACUAGACAGAUCC) at pH=7 and 1 mM magnesium ion concentration in a 37°C water bath for 2 hours. The products were separated by 10% PAGE gel and stained with DNA dye, and the enzyme cleavage bands were observed by ultraviolet light. Figure 3 As shown, KRAS mRNA molecules can be cleaved into short RNA fragments by the corresponding pistol ribozyme molecules. The positions of the cut RNA fragments are shown by the arrows in the figure. It can be seen that the capping modification of the ribozyme does not affect the activity of the original wild ribozyme, and from the quantitative results, the in vitro enzymatic cleavage activity of the capped ribozyme is enhanced to a certain extent.
[0060] Example 4: Comparison of in vitro stability of ribozyme molecules before and after capping
[0061] The wild-type P12V-17 or the capped-P12V-17 with a concentration of 2 μM was placed in a 37°C metal bath for 12 h, 24 h, 36 h, and 48 h, respectively. At the corresponding time point, 201 μL of sample was taken out and denatured Loading buffer was added thereto, and the sample was stored at -80°C. After the samples of equal volumes at all time points were collected, polyacrylamide gel electrophoresis was performed. The electrophoresis results are shown in the following table. Figure 4As shown in the figure, the analysis and comparison of the stability of the two ribozymes at different times showed that the wild-type ribozyme P12V-17 began to show degradation bands at 24 hours of the experiment, and the degree of degradation increased with time until 48 hours. However, the capped-P12V-17 ribozyme did not show any visible degradation within the tested time range, which more intuitively reflects that the ribozyme has higher in vitro stability after capping.
[0062] Example 5: Comparison of in vitro simulated serum stability of ribozyme molecules before and after capping
[0063] Add 10% FBS to the wild-type P12V-17 or capped-P12V-17 with a final concentration of 3μM, incubate the samples in a 37℃ metal bath, take out the samples at appropriate time points, add loading buffer to terminate the reaction, and analyze the bands by 10% polyacrylamide gel electrophoresis. The order of adding samples at zero time is to first mix the ribozyme with 3×DNA / RNA loading buffer, then add 10% FBS and immediately load the samples for electrophoresis. The results are shown in Figure 2. Figure 5 As shown in the figure, although capped-P12V-17 was also decomposed into multiple bands at 0h, the remaining amount of band 1 was significantly increased compared with the ribozyme P12V-17, and although the grayscale values of bands 1 and 3 decreased with time, a part of them was still retained until 2.5h, indicating that the serum stability of the ribozyme was significantly improved after Cap 0 capping modification.
[0064] Example 6: Exploration of ribozyme molecules targeting target genes at the cellular level before and after capping
[0065] Taking KRAS as an example, wild-type P12V-17 or capped-P12V-17 was transfected into SW620 cells with KRAS G12V mutant gene, and the cells were treated with a final concentration of 100 nM for 2 h, 6 h, 12 h, and 24 h, respectively. Cell RNA was extracted, and reverse transcription and qPCR experiments were performed; Figure 6 In the RT-QPCR results shown in A, compared with the wild-type ribozyme, the inhibitory level of the capped ribozyme on gene expression was higher at the corresponding time point, and the inhibition rate was stably maintained at more than 70%. Similarly, the ribozymes before and after capping were transfected into the SW620 cell line and treated for 18 hours, and the cell proteins were extracted for Western blot experiments, as shown in Figure 2. Figure 6As shown in B, the ribozyme capped-P12V-17 can produce a better expression inhibitory effect on KRAS protein than the wild-type ribozyme, indicating that the capping of the ribozyme is beneficial to improving its inhibitory effect on the expression of the target protein, showing that the capping of the ribozyme improves its stability and enzymatic activity, thereby being able to more sustainably and efficiently inhibit gene expression at the cellular level.
[0066] Corresponding active ribozyme P473 (SEQ ID NO.5: CGUGGUUAGGGCCACGUUAAAUAGGAUAUUAAGCCCUAAGCGCCUCGGCCUGACAUAU) and capped ribozyme capped-P473 (SEQ ID NO.6: capped-CGUGGUUAGGGCCACGUUAAAUAGGAUAUUAAGCCCUAAGCGCCUCGGCCUGACAUAU) were designed for gene PDL1. The ribozymes were transfected into B16F10 cells at final concentrations of 400 nM, 200 nM, 100 nM, and 50 nM, respectively, and after acting for 24 h, cellular RNA was extracted, and reverse transcription and qPCR experiments were performed, as shown in FIG. Figure 6 As shown in C, at the same concentration, the inhibitory effect of capped-P473 on the gene is more obvious.
[0067] Corresponding active ribozyme P749 (SEQ ID NO.7: CGUGGUUAGGGCCACGUUAAAUAGCAUUUUAAGCCCUAAGCGUGCACCAGACUGACACUUGC) and capped ribozyme capped-P749 (SEQ ID NO.8: capped-CGUGGUUAGGGCCACGUUAAAUAGCAUUUUAAGCCCUAAGCGUGCACCAGACUGACACUUGC) were designed for gene ALas1. The ribozymes were transfected into HepG2 cells at final concentrations of 50 nM, 25 nM, 12.5 nM, and 6.25 nM, respectively. After 24 h of action, cellular RNA was extracted and reverse transcription and qPCR experiments were performed. Figure 6 The results shown in D show that compared with the wild-type ribozyme, the capped-P749 ribozyme has a higher inhibitory activity against the ALas1 gene and can inhibit gene expression at a lower concentration of 6.25 nM, showing great potential.
[0068] Example 7: Study on cytotoxicity of ribozyme molecules before and after capping
[0069] Wild P12V-17 or capped-P12V-17 ribozyme modified with a cap structure was transfected into the SW620 cell line at a final concentration of 0nM (control group), 25nM, 50nM, 100nM, and 200nM, and 4 replicate wells were set for each concentration. At the same time, the well plate also included a blank control group. 48 hours after transfection, the old culture medium in the cells was aspirated, and fresh cell culture medium containing 10% CCK-8 was added to each well with a spray gun, and the wells were placed in a 37°C CO2 incubator and incubated in the dark for 1 hour. The 96-well plate was then centrifuged to remove tiny bubbles and placed in a microplate reader to measure the absorbance at 450nm. The cell survival rate was calculated based on the detected absorbance, and the results are shown in the figure. Figure 7 , indicating that similar to the wild-type ribozyme, the ribozyme did not produce significant toxicity to SW620 cells after capping.
[0070] Example 8: Study on the targeted enzymatic cleavage effect of ribozyme molecules before and after capping on tumors at the animal level.
[0071] SW620 cells were implanted in the armpit of the mouse and the tumor was grown to 80 mm. 3 Around 20 minutes later, the tumor mouse model was divided into a transfection reagent group (transfection reagent only) and a ribozyme group (transfection reagent + ribozyme) for treatment. Each mouse was given 15 μg of the drug by intratumoral injection, once every other day, for a total of 7 times. After the last administration, the mice were treated two days later, and the tumor tissues of each group were collected, the in vitro weight was measured and photographed. Half of each tumor was fixed in 4% paraformaldehyde, embedded in paraffin and processed for histological examination, and subsequent sectioning, H&E staining, immunohistochemistry and other studies were performed. Figures 8-9 The results showed that the tumors in the experimental group generally grew slowly. The volume and weight of the tumors in the mice treated with the ribozyme group capped-P12V-17 were significantly reduced. The solid tumor cells were severely damaged by the action of the ribozyme, and the overall treatment results were better than those of the uncapped ribozyme group P12V-17.
[0072] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.
Claims
1. A capped nucleic acid molecule having a catalytic function, characterized in that: The basic combination is formula 1: In the formula, R is X1 and X2 are any of natural, non-natural or modified nucleoside bases A, U, C and G; R1, R2, R3 are O or S; R4 and R5 can be H, OH or O-CH 3。 2. The functional nucleic acid molecule according to claim 1, characterized in that: It is a biological macromolecule with catalytic function composed of nucleotides as basic units. It recognizes nucleic acid targets through base complementary pairing and cleaves the target sequence at a specific site to cause the nucleic acid target sequence to break, thereby achieving degradation of the target and inhibition of its function.
3. The biomacromolecule with catalytic function according to claim 2 is a functional nucleic acid molecule, characterized in that: Including Hammerhead ribozyme, Hairpin ribozyme, HDV ribozyme, Twister ribozyme, Twister Sister ribozyme, Pistol ribozyme, Groμp I intron, Groμp II intron, DNAzyme, XNAzyme, deoxyribozyme, intron, spliceosome and all other nucleic acid molecules that have the ability to target recognition and degradation of targets by themselves or after binding to ligands, and their various chemically modified derivatives.
4. The functional nucleic acid molecule according to claim 2, characterized in that: Its structure is a single-stranded RNA or DNA molecule with a 5'-triphosphate at the 5' end.
5. The functional nucleic acid molecule according to claims 1-4, wherein the nucleic acid sequence comprises one or more chemical modifications, and the modified sites include but are not limited to bases, ribose and phosphate groups.
6. The method for preparing a functional nucleic acid molecule by capping and modification according to claim 1, characterized in that: The preparation method comprises the following steps: Method 1: (1) preparing the nucleotide as claimed in claim 2; (2) Using the cap structure and its analogs described in claim 1 to perform a capping reaction on the prepared nucleotides. Method 2: Using co-transcription technology, the cap structure and its analogs described in claim 1 are co-transcriptionally capped during the nucleotide preparation process described in claim 2.
7. Use of the capped modified functional nucleic acid molecule according to any one of claims 1 to 6 for targeted inhibition of RNA molecules inside and outside cells.