SiRNA (small interfering Ribonucleic Acid) for enabling bivolcanic variety silkworms to lay non-diapause eggs as well as preparation method and application of siRNA

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) for enabling bivolcanic variety silkworms to lay non-diapause eggs as well as a preparation method and application of the siRNA. The method comprises the following steps: extracting total RNA (Ribonucleic Acid) from fat bodies of five-year-old silkworms on the third day, performing reverse transcription to obtain first-chain cDNA (Complementary Deoxyribonucleic Acid), performing amplification by taking the first-chain cDNA as a template to obtain BmKurtz cDNA, performing PCR (Polymerase Chain Reaction) amplification and enzyme digestion by taking the first-chain cDNA as a template, connecting an obtained fragment into a carrier to obtain pFLAG-BmKurtz, performing PCR amplification by taking the obtained fragment as a template to obtain a reaction template, mixing the reaction template with a reaction solution, reacting, and further treating to obtain BmKurtz siRNA; the BmKurtz siRNA liquid is injected into the belly of a female silkworm chrysalis of a bigelous variety bombyx mori producing diapause eggs, normal mating is carried out after moth formation, and non-diapause eggs are produced. The method plays a positive role in researching the silkworm embryo diapause mechanism, further utilizing silkworm embryo diapause to carry out technical innovation and economic benefit improvement of the traditional sericulture industry and the like.

Description

Technical Field

[0001] The invention relates to the technical field of silkworm diapause, and in particular to a siRNA capable of allowing a bivoltine variety of silkworm to produce non-diapause eggs, a preparation method and application thereof. Background Art

[0002] Diapause is a phenomenon in which insects actively stop developing at a certain stage of individual development. As a genetic trait, it plays an important role in the survival, evolution, and prosperity of insects. The silkworm (Bombyx mori) is an egg diapause type, and the univoltine silkworm breed lays diapause eggs under normal conditions. Diapause eggs need to be treated with low temperature for a long time to be released, which brings inconvenience to raising silkworms many times a year. Therefore, the study of the diapause phenomenon of silkworms has always been a concern of people.

[0003] Whether silkworm eggs go into diapause mainly depends on the action of diapause hormone (DH) synthesized and secreted by the subpharyngeal ganglion (SG) during the pupal stage. When the synthesized and secreted DH acts on the ovaries and developing silkworm eggs, it causes the upregulation of multiple gene expressions, thereby changing the material metabolism in the silkworm eggs and turning them into diapause eggs. The action of silkworm DH (BmDH) is transduced by the silkworm diapause hormone receptor (BmDHR), and the signaling pathway of BmDHR transducing BmDH signals requires the mediation of silkworm Kurtz (BmKurtz) protein. However, there is a lack of research on the regulation of silkworm egg diapause by BmKurtz protein mediated by BmDHR signaling pathway. Summary of the invention

[0004] In order to solve the problems existing in the background technology, the purpose of the present invention is to provide a method for allowing bivoltine varieties of silkworms to produce non-diapause eggs, which adopts RT-PCR cloning, PCR amplification, agarose gel electrophoresis recovery, connection with mammalian expression vector pFlag-CMV-3, mixed reaction with T7 reaction buffer, ATP solution, CTP solution, GTP solution, UTP solution, and T7 enzyme solution, and then injected into the abdomen of female silkworm pupae, so as to allow bivoltine varieties of silkworms to produce non-diapause eggs by regulating the BmDHR signaling pathway.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] 1. A method for preparing siRNA that allows bivoltine silkworms to lay non-diapause eggs

[0007] (1) The fat bodies of fifth-instar silkworms were dissected and collected, total RNA was extracted, and then reverse transcribed to obtain first-strand cDNA;

[0008] (2) using the first-strand cDNA as a template, amplifying by reverse transcription polymerase chain reaction (RT-PCR) to clone and obtain the silkworm Kurtz cDNA;

[0009] (3) using the silkworm Kurtz cDNA as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a BmKurtz DNA fragment, digesting the BmKurtz DNA fragment with HindIII / BamHI, and then ligating it with a mammalian expression vector pFlag-CMV-3 to obtain pFLAG-BmKurtz;

[0010] (4) using the pFLAG-BmKurtz as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a purified target pFLAG-BmKurtz DNA fragment as a reaction template;

[0011] (5) The reaction template is mixed with 10×T7 reaction buffer, ATP solution, CTP solution, GTP solution, UTP solution and T7 enzyme solution to react, and then subjected to subsequent treatment to obtain BmKurtz siRNA as the siRNA.

[0012] The step (1) is specifically as follows: dissecting and collecting the fat body of the fifth instar silkworm on the third day, using a Trizol kit to extract total RNA, and then using a reverse transcription first-strand cDNA synthesis reagent to reverse transcribe the total RNA to obtain the first-strand cDNA, wherein the reverse transcription conditions are: denaturation at 65°C for 4 minutes, reaction at 42°C for 55 minutes, and inactivation at 70°C for 13 minutes.

[0013] The step (2) is specifically:

[0014] The first-chain cDNA was used as a template and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using a forward primer such as SEQ ID NO.1 and a reverse primer such as SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtzcDNA). The reverse transcription polymerase chain reaction (RT-PCR) amplification conditions were: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, and extension at 71°C for 2.2min for 32 cycles.

[0015] In the step (3), the BmKurtz DNA fragment is obtained in the following manner:

[0016] The BmKurtz cDNA was used as a template, and PCR amplification was performed using a forward primer such as SEQ ID NO.3 and a reverse primer such as SEQ ID NO.4. The PCR amplification conditions were: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, 32 cycles, and extension with rTaq enzyme for 16min.

[0017] In the step (4), the reaction template is obtained in the following manner:

[0018] Using the pFLAG-BmKurtz as a template, PCR amplification was performed using specific primers such as SEQ ID NO.5 and SEQ ID NO.6, respectively. The PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0019] The step (5) is specifically as follows:

[0020] (5.1) Add 1.5-2.0 μg of the reaction template and 2 μL of 10×T7 reaction buffer, 2 μL of ATP solution, 2 μL of CTP solution, 2 μL of GTP solution, 2 μL of UTP solution and 2 μL of T7 enzyme solution mixture into a test tube in sequence;

[0021] (5.2) Continue to add nuclease-free double distilled water to 20 μL and mix thoroughly, place at 37°C for 18 hours, and then cool to room temperature;

[0022] (5.3) Add 1 μL of TURBO DNA enzyme to the mixture obtained in step 5.2, mix well, and incubate at 37°C for 16 min;

[0023] (5.4) Add 30 μL of nuclease-free double distilled water, 30 μL of 7.5 M lithium chloride and 50 mM EDTA to terminate the reaction;

[0024] (5.5) Centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, and add 1 mL of 70% by mass ethanol solution for washing;

[0025] (5.6) Centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass of the ethanol supernatant, and dissolve the precipitate in nuclease-free double distilled water to obtain BmKurtz siRNA.

[0026] 2. An siRNA that enables a bivoltine silkworm to produce non-diapause eggs

[0027] The preparation method described in step 1 is adopted to prepare the product.

[0028] 3. Application of siRNA to enable bivoltine silkworms to produce non-diapause eggs

[0029] The siRNA obtained in step 2 is used to be injected into the body of the bivoltine silkworm variety so that the silkworm lays non-diapause eggs.

[0030] 4. An application method of siRNA for making bivoltine silkworms produce non-diapause eggs

[0031] The siRNA obtained in step 2 was injected into the abdomen of female silkworm pupae of the bivoltine variety. After the pupae emerged, they mated normally and laid non-diapause eggs.

[0032] 18-22 μg of the siRNA sterilized by filtration membrane is injected into the abdomen of female silkworm pupae of the bivoltine variety that lays diapause eggs on the second day of pupation, and the pupae are placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. After the pupae emerge, the pupae mate normally and lay non-diapause eggs.

[0033] The beneficial effect of the present invention is that the method of the present invention for making bivoltine silkworm varieties produce non-diapause eggs is achieved by regulating the signal pathway of the silkworm diapause hormone receptor (BmDHR) transducing the silkworm diapause hormone (BmDH) with the mediating factor BmKurtz, which has a positive effect on studying the diapause mechanism of silkworm embryos, carrying out technological innovation and improving the economic benefits of traditional sericulture, etc. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below with reference to specific embodiments.

[0035] Embodiments of the present invention are as follows:

[0036] Embodiment 1:

[0037] The fat bodies of fifth instar silkworms on the third day were dissected and collected, and total RNA was extracted using a Trizol kit. The total RNA was then reverse transcribed using a reverse transcription first-strand cDNA synthesis reagent to obtain the first-strand cDNA. The reverse transcription conditions were: denaturation at 65°C for 4 min, reaction at 42°C for 55 min, and inactivation at 70°C for 13 min.

[0038] The first strand cDNA was used as a template, and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using the forward primer 5'-ATGGACGACGCGGGCAGTAACAA-3' of SEQ ID NO.1 and the reverse primer 5'-TCAGGCGTC TGCGTCGGCGCCC-3' of SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA). The RT-PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0039] Using BmKurtz cDNA as a template, PCR amplification was performed using the forward primer 5'-rCrArG rCrGrArGrArCrUrUrArUrCrArGrUrArArArUrCTG-3' (TG is a deoxynucleotide, the same applies below) as SEQ ID NO.3 and the reverse primer 5'-rCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrGrCrUrGrArC-3' as SEQ ID NO.4. The PCR amplification conditions were: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, 32 cycles, and further extension at 71°C for 16min with the addition of rTaq enzyme to obtain the BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis, digested with HindIII / BamHI, and ligated with the mammalian expression vector pFlag-CMV-3 to obtain pFLAG-BmKurtz

[0040] Using pFLAG-BmKurtz as a template, PCR amplification was performed using two specific primers 5′-rArGrArCrUrUrArUrCrArGrUrArArArArUrCrUrGrCrGrUTT-3′ (where TT is a deoxynucleotide, the same applies below) and 5′-rArArArCrGrCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrG-3′ as SEQ ID NO.5 and SEQ ID NO.6, respectively. The PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles to obtain a pFLAG-BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis and used as a reaction template.

[0041] 1.5 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture (the above raw materials are from Promega, USA) were added to a test tube in sequence; then, nuclease-free double distilled water was added to 20 μL, mixed thoroughly, placed at 37°C for reaction for 18 hours, and cooled to room temperature; then, 1 μL TURBO DNase (the above raw materials are from Promega, USA) was added to the above mixture, mixed well, and incubated at 37°C for 16 minutes; then, 30 μL nuclease-free double distilled water, 30 μL 7.5M lithium chloride and 50mM EDTA were added to terminate the reaction; then, centrifuged at 15000rpm at 4°C for 16 minutes, the supernatant was removed, and 1 mL The supernatant was washed with 70% by mass ethanol solution; then centrifuged at 15000 rpm for 16 min at 4°C, the 70% by mass ethanol supernatant was removed, and the precipitate was dissolved with nuclease-free double distilled water to obtain BmKurtz siRNA.

[0042] The obtained 22 μg BmKurtz siRNA solution was sterilized by filtration membrane and injected into the abdomen of female silkworm pupae of the bivoltine variety of silkworms that lay diapause eggs on the second day after pupation. The pupae were placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. After they emerged as moths, they mated normally and laid 95.5% non-diapause eggs.

[0043] Embodiment 2:

[0044] The fat bodies of fifth instar silkworms on the third day were dissected and collected, and total RNA was extracted using a Trizol kit. The total RNA was then reverse transcribed using a reverse transcription first-strand cDNA synthesis reagent to obtain the first-strand cDNA. The reverse transcription conditions were: denaturation at 65°C for 4 min, reaction at 42°C for 55 min, and inactivation at 70°C for 13 min.

[0045] The first strand cDNA was used as a template, and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using the forward primer 5'-ATGGACGACGCGGGCAGTAACAA-3' of SEQ ID NO.1 and the reverse primer 5'-TCAGGCGTCTGCGTCGGCGCCC-3' of SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA). The RT-PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0046] Using BmKurtz cDNA as a template, PCR amplification was performed using forward primer 5'-rCrArGrCrGrArGrArCrUrUrArUrCrArGrUrArArArUrCTG-3' as SEQ ID NO.3 and reverse primer 5'-rCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrGrCrUrGrArC-3' as SEQ ID NO.4, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, and rTaq enzyme was added to continue extension for 16min to obtain the BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis, digested with HindIII / BamHI, and ligated with the mammalian expression vector pFlag-CMV-3 to obtain pFLAG-BmKurtz

[0047] Using pFLAG-BmKurtz as a template, PCR amplification was performed using two specific primers 5′-rArGrArCrUrUrArUrCrArGrUrArArArUrCrUrGrCrGrUTT-3′ and 5′-rArArArCrGrCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrG-3′, such as SEQ ID NO.5 and SEQ ID NO.6, respectively. The PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles to obtain the pFLAG-BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis and used as a reaction template.

[0048] 2.0 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture (the above raw materials are from Promega, USA) were added to a test tube in sequence; then, nuclease-free double distilled water was added to 20 μL, mixed thoroughly, placed at 37°C for reaction for 18 hours, and cooled to room temperature; then, 1 μL TURBO DNase (the above raw materials are from Promega, USA) was added to the above mixture, mixed well, and incubated at 37°C for 16 minutes; then, 30 μL nuclease-free double distilled water, 30 μL 7.5M lithium chloride and 50mM EDTA were added to terminate the reaction; then, centrifuged at 15000rpm at 4°C for 16 minutes, the supernatant was removed, and 1 mL The supernatant was washed with 70% by mass ethanol solution; then centrifuged at 15000 rpm for 16 min at 4°C, the 70% by mass ethanol supernatant was removed, and the precipitate was dissolved with nuclease-free double distilled water to obtain BmKurtz siRNA.

[0049] The 18 μg BmKurtz siRNA solution was sterilized by filtration membrane and injected into the abdomen of female silkworm pupae of the bivoltine species Bombyx mori that lay diapause eggs on the second day after pupation. The pupae were placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. After they emerged as moths, they mated normally and laid 92.8% non-diapause eggs.

[0050] Embodiment 3:

[0051] The fat bodies of fifth instar silkworms on the third day were dissected and collected, and total RNA was extracted using a Trizol kit. The total RNA was then reverse transcribed using a reverse transcription first-strand cDNA synthesis reagent to obtain the first-strand cDNA. The reverse transcription conditions were: denaturation at 65°C for 4 min, reaction at 42°C for 55 min, and inactivation at 70°C for 13 min.

[0052] The first strand cDNA was used as a template, and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using the forward primer 5'-ATGGACGACGCGGGCAGTAACAA-3' of SEQ ID NO.1 and the reverse primer 5'-TCAGGCGTCTGCGTCGGCGCCC-3' of SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA). The RT-PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0053] Using BmKurtz cDNA as a template, PCR amplification was performed using forward primer 5'-rCrArGrCrGrArGrArCrUrUrArUrCrArGrUrArArArUrCTG-3' as SEQ ID NO.3 and reverse primer 5'-rCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrGrCrUrGrArC-3' as SEQ ID NO.4, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, and rTaq enzyme was added to continue extension for 16min to obtain BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis, digested with HindIII / BamHI, and ligated with mammalian expression vector pFlag-CMV-3 to obtain pFLAG-BmKurtz.

[0054] Using pFLAG-BmKurtz as a template, PCR amplification was performed using two specific primers 5′-rArGrArCrUrUrArUrCrArGrUrArArArUrCrUrGrCrGrUTT-3′ and 5′-rArArArCrGrCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrG-3′, such as SEQ ID NO.5 and SEQ ID NO.6, respectively. The PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles to obtain the pFLAG-BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis and used as a reaction template.

[0055] 1.75 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture (the above raw materials are from Promega, USA) were added to a test tube in sequence; then, nuclease-free double distilled water was added to 20 μL, mixed thoroughly, placed at 37°C for reaction for 18 hours, and cooled to room temperature; then, 1 μL TURBO DNase (the above raw materials are from Promega, USA) was added to the above mixture, mixed well, and incubated at 37°C for 16 minutes; then, 30 μL nuclease-free double distilled water, 30 μL 7.5M lithium chloride and 50mM EDTA were added to terminate the reaction; then, centrifuged at 15000 rpm at 4°C for 16 minutes, the supernatant was removed, and 1 mL The supernatant was washed with 70% by mass ethanol solution; then centrifuged at 15000 rpm for 16 min at 4°C, the 70% by mass ethanol supernatant was removed, and the precipitate was dissolved with nuclease-free double distilled water to obtain BmKurtz siRNA.

[0056] The obtained 20 μg BmKurtz siRNA solution was sterilized by filtration membrane and injected into the abdomen of female silkworm pupae of the bivoltine variety of silkworms that lay diapause eggs on the second day after pupation. The pupae were placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. After they emerged as moths, they mated normally and laid 93.7% non-diapause eggs.

[0057] It can be seen from the above embodiments that the present invention uses the mediating factor BmKurtz to regulate the signal pathway of the silkworm diapause hormone receptor (BmDHR) to transduce the silkworm diapause hormone (BmDH), so that the bivoltine silkworm breed produces non-diapause eggs, and the technical effect is remarkable. This has a positive effect on studying the diapause mechanism of silkworm embryos, carrying out technological innovation and improving the economic benefits of traditional sericulture, etc.

[0058] The above specific implementation modes are used to explain the present invention rather than to limit the present invention. Any modification and change made to the present invention within the spirit of the present invention and the protection scope of the claims shall fall within the protection scope of the present invention.

[0059] The genetic sequences involved in the present invention are as follows:

[0060] SEQ ID NO.1:

[0061] Name: Primer 1

[0062] DNA type: other DNA

[0063] Source: Synthetic Construct

[0064] ATGGACGACGCGGGCAGTAACAA

[0065] SEQ ID NO.2:

[0066] Name: Primer 2

[0067] DNA type: other DNA

[0068] Source: Synthetic Construct

[0069] TCAGGCGTCTGCGTCGGCGCCC

[0070] SEQ ID NO.3:

[0071] Name: Primer 3

[0072] RNA type: other RNA

[0073] Source: Synthetic Construct

[0074] CAGCGAGACUUAUCAGUAAAAUCTG

[0075] SEQ ID NO.4:

[0076] Name: Primer 4

[0077] RNA type: other RNA

[0078] Source: Synthetic Construct

[0079] CAGAUUUUACUGAUAAGUCUCGCUGAC

[0080] SEQ ID NO.5:

[0081] Name: Primer 5

[0082] RNA type: other RNA

[0083] Source: Synthetic Construct

[0084] AGACUUAUCAGUAAAAUCUGCGUTT

[0085] SEQ ID NO.6:

[0086] Name: Primer 6

[0087] RNA type: other RNA

[0088] Source: Synthetic ConstructAAACGCAGAUUUUACUGAUAAGUCUCG.

Claims

1. A method for preparing siRNA for allowing a bivoltine silkworm to produce non-diapause eggs, characterized in that: The siRNA was prepared by the following method: (1) The fat bodies of fifth-instar silkworms were dissected and collected, total RNA was extracted, and then reverse transcribed to obtain first-strand cDNA; (2) using the first-strand cDNA as a template, amplifying by reverse transcription polymerase chain reaction (RT-PCR) to clone and obtain the silkworm Kurtz cDNA; (3) using the silkworm Kurtz cDNA as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a BmKurtz DNA fragment, digesting the BmKurtz DNA fragment with HindIII / BamHI, and then ligating it with a mammalian expression vector pFlag-CMV-3 to obtain pFLAG-BmKurtz; (4) using the pFLAG-BmKurtz as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a purified target pFLAG-BmKurtz DNA fragment as a reaction template; (5) The reaction template is mixed with 10×T7 reaction buffer, ATP solution, CTP solution, GTP solution, UTP solution and T7 enzyme solution to react, and then subjected to subsequent treatment to obtain BmKurtz siRNA as the siRNA.

2. The method for preparing siRNA for making bivoltine silkworms lay non-diapause eggs according to claim 1, characterized in that: The step (1) is specifically as follows: dissecting and collecting the fat body of the fifth instar silkworm on the third day, using a Trizol kit to extract total RNA, and then using a reverse transcription first-strand cDNA synthesis reagent to reverse transcribe the total RNA to obtain the first-strand cDNA, wherein the reverse transcription conditions are: denaturation at 65°C for 4 minutes, reaction at 42°C for 55 minutes, and inactivation at 70°C for 13 minutes.

3. The method for preparing siRNA for making bivoltine silkworms lay non-diapause eggs according to claim 1, characterized in that: The step (2) specifically comprises: using the first-chain cDNA as a template, performing reverse transcription polymerase chain reaction amplification using a forward primer such as SEQ ID NO.1 and a reverse primer such as SEQ ID NO.2, respectively, to clone and obtain the Bombyx mori Kurtz cDNA, wherein the reverse transcription polymerase chain reaction amplification conditions are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, and 32 cycles.

4. The method for preparing siRNA for making bivoltine silkworms lay non-diapause eggs according to claim 1, characterized in that: In the step (3), the BmKurtz DNA fragment is obtained in the following manner: using the Bombyx mori Kurtz cDNA as a template, PCR amplification is performed using a forward primer such as SEQ ID NO.3 and a reverse primer such as SEQ ID NO.4, respectively, and the PCR amplification conditions are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, 32 cycles, and extension with rTaq enzyme for further 16min.

5. The method for preparing siRNA for making bivoltine silkworms lay non-diapause eggs according to claim 1, characterized in that: In the step (4), the reaction template is obtained in the following manner: Using the pFLAG-BmKurtz as a template, PCR amplification was performed using specific primers such as SEQ ID NO.5 and SEQ ID NO.6, respectively. The PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

6. The method for preparing siRNA for making bivoltine silkworms lay non-diapause eggs according to claim 1, characterized in that: The step (5) is specifically as follows: (5.1) In a test tube, add 1.5-2.0 μg of the reaction template, 2 μL of 10×T7 reaction buffer, 2 μL of ATP solution, 2 μL of CTP solution, 2 μL of GTP solution, 2 μL of UTP solution and 2 μL of T7 enzyme solution mixture in sequence; (5.2) Continue to add nuclease-free double distilled water to 20 μL and mix thoroughly, place at 37°C for 18 hours, and then cool to room temperature; (5.3) Add 1 μL of TURBO DNA enzyme to the mixture obtained in step 5.2, mix well, and incubate at 37°C for 16 min; (5.4) Add 30 μL of nuclease-free double distilled water, 30 μL of 7.5 M lithium chloride and 50 mM EDTA to terminate the reaction; (5.5) Centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, and add 1 mL of 70% by mass ethanol solution for washing; (5.6) Centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass of the ethanol supernatant, and dissolve the precipitate in nuclease-free double distilled water to obtain BmKurtz siRNA.

7. An siRNA for causing a bivoltine silkworm to produce non-diapause eggs, characterized in that: The invention is prepared by the preparation method according to any one of claims 1 to 6.

8. An application of siRNA for allowing a bivoltine silkworm to produce non-diapause eggs, characterized in that: The siRNA described in claim 7 is used to inject into the body of a bivoltine silkworm variety so that the silkworm lays non-diapause eggs.

9. A method for making a bivoltine silkworm breed lay non-diapause eggs using the siRNA of claim 7, characterized in that: The BmKurtz siRNA described in claim 7 is injected into the abdomen of female silkworm pupae of the bivoltine variety, and the pupae mate normally after becoming moths, and lay non-diapause eggs.

10. The method for using siRNA to make bivoltine silkworms produce non-diapause eggs according to claim 9 is characterized in that: 18-22 μg of the siRNA sterilized by filtration membrane is injected into the abdomen of female silkworm pupae of the bivoltine variety that lays diapause eggs on the second day of pupation, and the pupae are placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. After the pupae emerge, the pupae mate normally and lay non-diapause eggs.