Soluble expression and purification method of recombinant human bone morphogenetic protein in prokaryotic system

Abstract

The invention discloses a soluble expression and purification method of recombinant human bone morphogenetic protein in a prokaryotic system. A gene sequence of a recombinant human bone morphogenetic protein (rhBMP) is spliced at the 3'terminal of a His-Linker-GB1 gene sequence, inserted into a prokaryotic expression system expression vector and transferred into a prokaryotic competent cell to be highly expressed in the cell in a soluble form, and finally, the expressed His-Linker-GB1-BMP fusion protein does not need to be subjected to inclusion body renaturation, so that the recombinant human bone morphogenetic protein (rhBMP) is obtained. The high-purity fusion protein can be obtained through one-step metal chelating chromatography (adsorption-elution mode), and the GB1 tag has small molecular weight and hardly affects the spatial structure and biological activity of rhBMP, so that the situation that an inclusion body is formed by expression of rhBMP in a traditional escherichia coli system and expression is performed in a structure-free and activity-free inclusion body form is avoided, and the expression efficiency is greatly improved. The method is simple and convenient to operate, is suitable for large-scale amplification, and has the characteristics of short period, high purity, stable process and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of preparation of human bone morphogenetic protein, and specifically relates to a soluble expression and purification method of recombinant human bone morphogenetic protein in a prokaryotic system. Background Art

[0002] In 1965, American doctor Urist discovered that decalcified bone matrix can induce ectopic osteogenesis. He believed that decalcified bone matrix contains a substance that can induce new bone formation, and named it bone morphogenetic protein (BMP). With the deepening of research, researchers analyzed that BMP is a member of the transforming growth factor β superfamily, an acidic protein widely distributed in animal bone tissue, and plays an important role in repairing bone defects and promoting fracture healing, hematopoietic system differentiation, neural development and repair. Among them, BMP-2, BMP-4, BMP-7, etc., as members of the BMPs family with strong induction activity, have a significant role in the field of bone tissue engineering research, and have therefore been widely used in clinical practice. The U.S. Food and Drug Administration (FDA) has approved the first product containing rhBMP-2 (recombinant human bone morphogenetic protein 2) to promote the treatment of certain types of spinal degenerative disc disease.

[0003] In the early days, hBMP was extracted from natural fresh bone tissue. The extraction method was relatively complicated, costly, low in yield, and poor in purity, which could not meet the needs of experimental research and clinical application. The method of producing recombinant human BMP using genetic engineering technology is significantly better than extracting from tissues, so the use of this technology to produce BMP has become a popular research direction. However, there are many problems in the preparation of BMP-2 using genetic engineering technology. Taking Pichia pastoris and Escherichia coli as examples, both have the ability to synthesize rhBMP after genetic engineering modification, but the existing problems make their commercial production cost too high. When using Pichia pastoris to express rhBMP, there are shortcomings such as long cycle, low yield, and high cost, so it is difficult to prepare on a large scale, which restricts its commercial production; and the high reduction environment in the cytoplasm of Escherichia coli is not conducive to the formation of disulfide bonds, and the prokaryotic cells lack the function of glycosylation modification, which leads to a decrease in solubility during the formation of protein intermediates and the formation of a large number of inclusion bodies. The subsequent renaturation of the target protein is lengthy, cumbersome, and inefficient. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions: comprising:

[0008] The 3' end of the GB1 tag gene was spliced ​​with the recombinant human bone morphogenetic protein gene, and the 5' end was spliced ​​with the 6×His tag gene through Linker to obtain the gene sequence of His-Linker-GB1-BMP;

[0009] The gene sequence of His-Linker-GB1-BMP is inserted into the prokaryotic expression plasmid vector and transferred into prokaryotic competent cells to achieve soluble expression;

[0010] The protein sequence of the GB1 tag is the Streptococcus G protein B1 domain, and the gene sequence is shown in SEQ ID NO:3.

[0011] As a preferred embodiment of the method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system of the present invention, the recombinant human bone morphogenetic protein includes recombinant human bone morphogenetic proteins 1-16.

[0012] As a preferred embodiment of the method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system according to the present invention, the recombinant human bone morphogenetic protein includes recombinant human bone morphogenetic protein-2, recombinant human bone morphogenetic protein-4, and recombinant human bone morphogenetic protein-7.

[0013] As a preferred embodiment of the soluble expression method of recombinant human bone morphogenetic protein in a prokaryotic system of the present invention, the prokaryotic system expression plasmid vector includes a pET series plasmid or a pCold series plasmid, and the prokaryotic competent cells include competent cells of Escherichia coli, Bacillus subtilis, and Corynebacterium glutamicum, wherein the Escherichia coli includes E. coli BL21, Shuffle T7, and Origami.

[0014] As a preferred embodiment of the method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system of the present invention, the sequence of the Linker contains Gly, Ser, Glu, and Lys.

[0015] Another object of the present invention is to provide a method for purifying recombinant human bone morphogenetic protein in a prokaryotic system.

[0016] In order to solve the above technical problems, the present invention provides the following technical solutions: comprising:

[0017] After the His-Linker-GB1-BMP gene is transferred into prokaryotic competent cells,

[0018] The dominant growth colonies were selected by resistance plating, expanded and cultured, and the target gene was transcribed and translated by intervening promoter to obtain the fusion protein His-Linker-GB1-BMP.

[0019] The bacteria were disrupted by ultrasound, and the supernatant was obtained by centrifugation. The supernatant was treated by metal chelate chromatography to purify the high-purity fusion protein His-Linker-GB1-BMP.

[0020] As a preferred embodiment of the method for purifying the recombinant human bone morphogenetic protein in the prokaryotic system of the present invention, the method for intervening the promoter is to initiate transcription of the plasmid carrying the target gene, including:

[0021] The inducer of the intervening promoter is added, the culture temperature is adjusted, or the culture medium is self-induced, wherein the inducer includes IPTG or L-arabinose.

[0022] As a preferred embodiment of the method for purifying recombinant human bone morphogenetic protein in a prokaryotic system of the present invention, the metal chelate chromatography is an adsorption-elution mode.

[0023] As a preferred embodiment of the method for purifying recombinant human bone morphogenetic protein in a prokaryotic system of the present invention, the metal chelate chromatography, wherein the solid phase chromatography filler is a chromatography filler having affinity binding adsorption with three or more histidine residues in series fusion tags.

[0024] As a preferred embodiment of the method for purifying the recombinant human bone morphogenetic protein in a prokaryotic system of the present invention, the metal chelate chromatography is performed, wherein the elution is performed by eluting the protein with an imidazole eluent.

[0025] Beneficial effects of the present invention:

[0026] A large number of small molecule peptide tags were screened in the early stage of the present invention, and it was finally determined that the GB1 tag can promote the complete solubility of rhBMP. Since the GB1 tag has a small molecular weight, it will hardly affect the spatial structure and biological activity of rhBMP. In addition, the present invention has the characteristics of simple operation, short cycle, low cost, high expression level, high purity, biological activity of the product, suitability for large-scale amplification, stable process, etc., and is suitable for industrialization. The products produced can be used clinically to accelerate the regeneration of bone tissue. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0028] Figure 1 Schematic diagram of the characteristic structure of the His-linker-GB1-BMP-2 plasmid of Example 1 of the present invention.

[0029] Figure 2 This is an SDS-PAGE identification diagram of the soluble expression of His-linker-GB1-BMP-2 in Example 1 of the present invention.

[0030] Figure 3 This is a schematic diagram of the characteristic structure of the His-linker-GB1-BMP-4 plasmid of Example 2 of the present invention.

[0031] Figure 4 This is an SDS-PAGE identification diagram of the soluble expression of His-linker-GB1-BMP-4 in Example 2 of the present invention.

[0032] Figure 5 (a) is the gradient elution profile of the His-linker-GB1-BMP-2 protein metal chelate chromatography of Example 1 of the present invention, and (b) is the elution profile after optimization.

[0033] Figure 6 This is the metal chelate chromatography electrophoresis identification diagram of the His-linker-GB1-BMP-2 protein of Example 1 of the present invention (non-reduced).

[0034] Figure 7 This is the metal chelate chromatography electrophoresis identification diagram of His-linker-GB1-BMP-2 protein in Example 1 of the present invention (reduced).

[0035] Figure 8(a) is the gradient elution profile of the His-linker-GB1-BMP-4 protein metal chelation chromatography of Example 2 of the present invention, and (b) is the elution profile after optimization.

[0036] Fig. 9 This is the metal chelate chromatography electrophoresis identification diagram of His-linker-GB1-BMP-4 protein in Example 2 of the present invention (non-reduced).

[0037] Fig.10 This is the metal chelate chromatography electrophoresis identification diagram of His-linker-GB1-BMP-4 protein in Example 2 of the present invention (reduced).

[0038] Fig.11 This is the SDS-PAGE identification diagram of the soluble expression of the product of Comparative Example 1 of the present invention.

[0039] Fig.12 This is the SDS-PAGE identification diagram of the soluble expression of the product of Comparative Example 2 of the present invention.

[0040] Fig.13 This is the SDS-PAGE identification diagram of the soluble expression of the product of Comparative Example 3 of the present invention.

[0041] Fig.14 This is the SDS-PAGE identification diagram of the soluble expression of the product of Comparative Example 4 of the present invention.

[0042] Fig.15 This is the SDS-PAGE identification diagram of the soluble expression of the product of Comparative Example 5 of the present invention.

[0043] Fig.16 This is the SDS-PAGE identification diagram of the soluble expression of the product of Comparative Example 6 of the present invention. DETAILED DESCRIPTION

[0044] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0045] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0046] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0047] Example 1

[0048] This embodiment provides a method for soluble expression of recombinant human bone morphogenetic protein-2 (rhBMP-2) in a prokaryotic system, specifically:

[0049] 1) The GB1 tag gene, rhBMP-2, recombinant human bone morphogenetic protein gene, Linker, and 6×His tag gene were optimized for E. coli preference codons to obtain optimized genes.

[0050] The nucleotide sequence of the rhBMP-2 gene sequence after being optimized for E. coli preferred codons is shown in SEQ ID NO:1; the nucleotide sequence of the GB1 gene sequence after being optimized for E. coli preferred codons is shown in SEQ ID NO:3; the nucleotide sequence of the Linker gene sequence after being optimized for E. coli preferred codons is shown in SEQ ID NO:4; the nucleotide sequence of the 6×His gene sequence after being optimized for E. coli preferred codons is shown in SEQ ID NO:5;

[0051] 2)Reference Figure 1 The GB1-BMP-2 gene was designed to be inserted into the prokaryotic expression system expression vector pCold II, and the pCold II / GB1-BMP-2 recombinant plasmid was constructed and delivered to a biological company for synthesis;

[0052] Then, the 6×His-Linker gene was inserted into the 5′ end of GB1-BMP-2 by PCR technology using specific primers His-Linker-F and His-Linker-R to construct the His-Linker-GB1-BMP-2 gene, whose amino acid sequence is shown in SEQ ID NO: 6 and nucleotide sequence is shown in SEQ ID NO: 7;

[0053] The nucleotide sequence of primer His-Linker-F is: AAGTCTTCTGGCAGCGGCT CTGAAAGCAAGTCTACTGACACCTACAAACTGATCCTGAACG;

[0054] The nucleotide sequence of primer His-Linker-R is: GCCAGAAGACTTACCTTCGTGATG ATGATGATGATGCACTTTGTGATTCATGGTGTATTACCTCTT;

[0055] PCR conditions were:

[0056]

[0057] After nucleic acid electrophoresis verification, the template chain was eliminated using Dpn I digestion enzyme with the following parameters: first react at 37°C for 0.5-1h, then react at 70°C for 15min.

[0058] The obtained pCold II / His-Linker-GB1-BMP-2 recombinant plasmid can be transferred into JM109 competent cells for storage and stored in Amp + Cultured in solid LB medium.

[0059] The pCold II / His-Linker-GB1-BMP-2 recombinant plasmid was transferred into the recombinant engineering bacteria Shuffle T7 for expression of the target protein. The seed solution of the recombinant engineering bacteria Shuffle T7 containing the pCold II / His-Linker-GB1-BMP-2 recombinant plasmid was inoculated into 5 mL of LB medium containing Amp, and the shake flask was activated overnight at 37°C and 200 rpm (12 hours). The activated bacterial solution was inoculated into 50 mL of LB medium containing 50 ug / mL Amp at a ratio of 10% (v / v), and cultured at 37°C and 200 rpm for about 3.5 hours until the OD600nm reached about 0.8. 1 / 1000 of 0.1M IPTG was added to the sterile operating table, and then the shake flask was transferred to a 16°C, 125 rpm shaker for induction for 12 hours. The culture was terminated, the bacterial cells were harvested by centrifugation, ultrasonically broken, and centrifuged to obtain the broken supernatant.

[0060] The results are as follows Figure 2 (Lane1 Protein Marker; Lane2 precipitate after cell lysis; Lane3 supernatant after cell lysis). 15% SDS-PAGE identification showed that His-Linker-GB1-BMP-2 protein was highly expressed in a soluble form.

[0061] Example 2

[0062] This embodiment provides a method for soluble expression of recombinant human bone morphogenetic protein-4 (rhBMP-4) in a prokaryotic system, specifically:

[0063] 1) Codon Optimization Referring to step 1 of Example 1, an optimized gene was obtained, wherein the nucleotide sequence of the rhBMP-4 gene sequence after Escherichia coli preferred codon optimization is shown in SEQ ID NO: 2

[0064] 2)Reference Figure 3 The GB1-BMP-4 gene was designed to be inserted into the prokaryotic expression system expression vector, and the pCold II / GB1-BMP-4 recombinant plasmid was constructed and delivered to a biological company for synthesis;

[0065] Then, referring to step 2 of Example 1), the 6×His-Linker gene was inserted into the 5′ end of GB1-BMP-4 using specific primers to construct the His-Linker-GB1-BMP-4 gene, whose amino acid sequence is shown in SEQ ID NO: 8 and nucleotide sequence is shown in SEQ ID NO: 9;

[0066] The pCold II / His-Linker-GB1-BMP-4 recombinant plasmid was transformed into JM109 competent cells and then expressed in Amp + Cultured in solid LB medium.

[0067] The recombinant engineering bacteria Shuffle T7 seed solution containing pCold II / His-Linker-GB1-BMP-4 recombinant plasmid was inoculated into 5 mL of LB medium containing Amp, and the shake flask was activated overnight at 37°C and 200 rpm (12 hours). The activated bacterial solution was inoculated into 50 mL of LB medium containing 50 ug / mL Amp at a ratio of 10% (v / v), and cultured at 37°C and 200 rpm for about 3.5 hours until the OD600nm reached about 0.8. 1 / 1000 of 0.1M IPTG was added to the sterile operating table, and then the shake flask was transferred to a 16°C, 125 rpm shaker for induction for 12 hours. The culture was terminated, the bacterial cells were harvested by centrifugation, ultrasonically broken, and centrifuged to obtain the broken supernatant.

[0068] The results are as follows Figure 4 (Lane1 was precipitated after cell lysis; Lane2 was supernatant after cell lysis). 15% SDS-PAGE identification showed that His-Linker-GB1-BMP-4 protein was highly expressed in a soluble form.

[0069] Example 3

[0070] This example provides a method for purifying His-Linker-GB1-BMP-2, specifically:

[0071] The dominant growth colonies were selected by resistance plating, expanded and cultured, and the target gene was transcribed and translated by intervening promoter to obtain the fusion protein His-Linker-GB1-BMP-2.

[0072] Specifically, the activated bacterial solution was inoculated into 50 mL of LB medium containing 50 ug / mL Amp at a ratio of 10% (v / v), and cultured at 37°C, 200 rpm for about 3.5 hours until OD600nm reached about 0.8, 1 / 1000 of 0.1 M IPTG was added in a sterile operating table, and then the shake flask was transferred to a 16°C, 125 rpm shaker for induction for 12 hours to achieve promoter intervention.

[0073] The bacteria were disrupted by ultrasound, and the supernatant was obtained by centrifugation. The high-purity fusion protein His-Linker-GB1-BMP-2 was purified from the supernatant by metal chelate chromatography;

[0074] Specifically, His-Linker-GB1-BMP-2 was lysed using pH 8.0, 100 mM Tris-Hcl, the lysis solution was centrifuged at 4°C, 8000 rpm for 30 min, the supernatant was collected, passed through a 0.45 um water membrane, and used for loading;

[0075] Affinity chromatography process (adsorption elution mode): Use HisTrip HP (1 mL) column for affinity chromatography purification. Before loading, the column was rinsed with 10 column volumes of ultrapure water, then equilibrated with 10 column volumes of buffer A (pH 8.0, 100 mM Tris-Hcl, 60 mM imidazole), and then loaded;

[0076] After loading, wash with 20-25 column volumes of buffer A, and then use 10%, 20%, 30%, 45%, 55%, 65%, 80%, 90%, 100% buffer B (pH 8.0, 100mM Tris-Hcl, 500mM imidazole) for 25-30 column volumes of gradient elution (imidazole concentrations are approximately 100, 150, 200, 250, 300, 350, 400, 450, 500mM, respectively);

[0077] The eluted product was collected and the purification result was identified by 15% SDS-PAGE. After optimizing the elution conditions, the elution conditions were directly set to be first washed with 150 mM imidazole for 25-30 column volumes and then washed with 500 mM imidazole for 25-30 column volumes.

[0078] Figure 5 (a) is the metal chelate chromatography gradient purification chromatogram of the His-Linker-GB1-BMP-2 protein in this example, and (b) is the optimized purification chromatogram;

[0079] Figure 6 This is the metal chelate chromatography electrophoresis identification diagram of the His-Linker-GB1-BMP-2 protein in this example (non-reducing SDS-PAGE, at this time the monomer and dimer of rhBMP-2 coexist), when the imidazole concentration reaches 250mM, the peak begins to appear, Lane 1: Protein Marker; Lane 2 flow-through sample; Lane 3 250mM imidazole elution sample; Lane 4 300mM imidazole elution sample; Lane 5 350mM imidazole elution sample; Lane 6 400mM imidazole elution sample; Lane 7 450mM imidazole elution sample.

[0080] Figure 7This is the metal chelate chromatography electrophoresis identification diagram of the His-Linker-GB1-BMP-2 protein in this example (reducing SDS-PAGE, at this time only the monomer of rhBMP-2 exists). Lane 1: Protein Marker; Lane 2 250mM imidazole elution sample; Lane 3 300mM imidazole elution sample; Lane 4 350mM imidazole elution sample; Lane 5 400mM imidazole elution sample; Lane 6 450mM imidazole elution sample.

[0081] Based on the above results, it can be seen that when the elution concentration is 100, 150, and 200 mM, the peak is very small (mAU≤15), which is a foreign protein. Figure 5 (a) When the elution concentration is ≥250mM, the target protein begins to appear, but the monomer and dimer appear simultaneously and cannot be separated, and the eluate contains almost only the target protein. Figure 6 and Figure 7 However, under reducing SDS-PAGE, due to the action of reducing agents such as β-thiol, the disulfide bonds between proteins are split, so reducing SDS-PAGE only contains monomeric target proteins, see Figure 7 However, when the elution concentration was 500 mM, almost no peak appeared.

[0082] The final optimized affinity chromatography parameters are:

[0083] 1. Equilibration: Set 10 column volumes of buffer A for equilibration at a flow rate of 1 mL / min.

[0084] 2. Sample Application: The sample loading volume is 10 mL of supernatant. Use "Using outlet valve" to collect the flow-through liquid, and cycle the loading for 3 times with a flow rate of 1 mL / min.

[0085] 3. Column Wash: Set 20-25 column volumes of buffer A for washing at a flow rate of 1 mL / min.

[0086] 4. Elution: First, set 20% of buffer B to wash for 25-30 column volumes. This step is to fully elute the non-specific adsorbed impurities. Then set 100% of buffer B to wash for 25-30 column volumes. This step is to fully elute the target protein. The flow rate is still 1mL / min.

[0087] 5. Equilibration: Set 8 column volumes of buffer A for equilibration at a flow rate of 1 mL / min.

[0088] Example 4

[0089] This example provides a purification method of His-Linker-GB1-BMP-4 with reference to the method in Example 3, specifically:

[0090] His-Linker-GB1-BMP-4 was lysed with 100 mM Tris-HCl at pH 8.0, and the lysis solution was centrifuged at 8000 rpm for 30 min at 4°C. The supernatant was collected and passed through a 0.45 μm water membrane for loading;

[0091] Affinity chromatography process (adsorption elution mode): Use HisTrip HP (1 mL) column for affinity chromatography purification. Before loading, the column was rinsed with 10 column volumes of ultrapure water, then equilibrated with 10 column volumes of buffer A (pH 8.0, 100 mM Tris-Hcl, 60 mM imidazole), and then loaded;

[0092] After loading, wash with 20-25 column volumes of buffer A, and then use 10%, 20%, 30%, 45%, 55%, 65%, 80%, 90%, 100% buffer B (pH 8.0, 100mM Tris-HCl, 500mM imidazole) for 25-30 column volumes of gradient elution (imidazole concentrations are approximately 100, 150, 200, 250, 300, 350, 400, 450, 500mM, respectively);

[0093] The eluted products were collected and the purification results were identified by 15% SDS-PAGE. After optimizing the elution conditions, the elution conditions were directly set to be washed with 150 mM for 25-30 column volumes first and then with 500 mM imidazole for 25-30 column volumes.

[0094] Figure 8 (a) is the metal chelate chromatography gradient purification chromatogram of the His-Linker-GB1-BMP-4 protein in this example, and (b) is the optimized purification chromatogram;

[0095] Fig. 9 This is the metal chelate chromatography electrophoresis identification diagram of the His-Linker-GB1-BMP-4 protein in this example (non-reducing SDS-PAGE, at this time the monomer and dimer of rhBMP-4 coexist), when the imidazole concentration reaches 100mM, the peak begins to appear, Lane 1: Protein Marker; Lane 2 flow-through sample; Lane 3 100mM imidazole elution sample; Lane 4 150mM imidazole elution sample; Lane 5 200mM imidazole elution sample; Lane 6 250mM imidazole elution sample; Lane 7 300mM imidazole elution sample; Lane 8 350mM imidazole elution sample.

[0096] Fig.10This is the metal chelate chromatography electrophoresis identification diagram of the His-Linker-GB1-BMP-4 protein in this example (reducing SDS-PAGE, at this time only the monomer of rhBMP-4 exists). Lane 1: Protein Marker; Lane 2 100mM imidazole elution sample; Lane 3 150mM imidazole elution sample; Lane 4 200mM imidazole elution sample; Lane 5 250mM imidazole elution sample; Lane 6 300mM imidazole elution sample; Lane 7 350mM imidazole elution sample.

[0097] Based on the above results, it can be seen that: unlike pCold II / His-Linker-GB1-BMP2, a small amount of target protein was eluted when the elution concentration was 100 and 150 mM, and no dimer was observed in non-reducing SDS-PAGE; when the elution concentration reached 200 mM, dimers began to appear. Fig. 9 ; The elution concentration is 250mM and the peak value is the largest. Figure 8 (a) with Fig.10 ; However, when the elution concentration was 400, 450, and 500 mM, there was almost no peak and all the protein had been washed out (mAU≤20).

[0098] Example 5

[0099] In this example, the method of Example 1 was used to replace recombinant human bone morphogenetic protein-2 with recombinant human bone morphogenetic protein-7 (rhBMP-7). As a result, the constructed fusion protein His-Linker-GB1-BMP-7 was also highly expressed in a soluble form.

[0100] Comparative Example 1

[0101] The difference between this comparative example and Example 1 is that the protein tag GB1 is adjusted to NT11 tag, and the remaining steps and processes are all referred to Example 1 to obtain the recombinant human bone morphogenetic protein-2 of this comparative example. Fig.11 As shown (Lane 1-2: precipitation after cell lysis; Lane 3: Marker), it can be seen that the protein in this comparative example did not achieve soluble expression and still formed inclusion bodies.

[0102] Comparative Example 2

[0103] The difference between this comparative example and Example 1 is that the protein tag GB1 is adjusted to P17 tag, and the remaining steps and processes are all referred to Example 1 to obtain the recombinant human bone morphogenetic protein-2 of this comparative example. Fig.12 As shown (Lane 1: Marker; Lane 2: precipitate after cell lysis), it can be seen that the protein in this comparative example did not achieve soluble expression and still formed inclusion bodies.

[0104] Comparative Example 3

[0105] The difference between this comparative example and Example 1 is that the protein tag GB1 is adjusted to a pNP tag, and the remaining steps and processes are all referred to Example 1 to obtain the recombinant human bone morphogenetic protein-2 of this comparative example. Fig.13 As shown (the left picture is the supernatant after breaking the package, and the right picture is the precipitate after breaking the package), it can be seen that the protein in this comparative example achieves partial soluble expression.

[0106] Comparative Example 4

[0107] The difference between this comparative example and Example 1 is that rhBMP-2 is co-expressed with the molecular chaperone pG-Tf2, and the culture conditions are adjusted to inoculate the activated bacterial solution into 50 mL of 20 ug / mL Cm culture medium containing 50 ug / mL Amp and 10% (V / V). In addition, a certain amount of tetracycline is added to make the final concentration 0.5 ng / mL, and then cultured at 37°C and 200 rpm for about 3.5 hours until the OD600nm reaches about 0.8. The remaining steps and processes are all referred to Example 1 to obtain the recombinant human bone morphogenetic protein-2 of this comparative example. The results are as follows Fig.14 As shown (the red frame is the target protein in the precipitate after cell lysis), it can be seen that the recombinant human bone morphogenetic protein-2 in this comparative example did not achieve soluble expression and the growth of the strain was seriously affected.

[0108] Comparative Example 5

[0109] The difference between this comparative example and Example 1 is that vesicle expression is used to achieve soluble expression of rhBMP-2, and the N-terminus of rhBMP-2 is fused with vesicle nucleating peptide 15 (VNp15), and the induction temperature is adjusted to 25°C. In this comparative example, recombinant human bone morphogenetic protein-2 is expressed. The results are as follows Fig.15 As shown, the recombinant human bone morphogenetic protein-2 in this comparative example did not achieve soluble expression.

[0110] When rhBMP-2 in this comparative example was replaced by rhBMP-4, expression was still not achieved.

[0111] Comparative Example 6

[0112] The difference between this comparative example and Example 1 is that rhBMP-2 is expressed in the periplasmic space, and the DsbA signal peptide is fused to the N-terminus of rhBMP-2. The remaining steps refer to Example 1 to obtain recombinant human bone morphogenetic protein-2 in this comparative example. The results are as follows Fig.16 As shown in (Lane 1: precipitate after cell lysis; Lane 2: Marker), it can be seen that the recombinant human bone morphogenetic protein-2 in this comparative example did not achieve soluble expression.

[0113] When rhBMP-2 in this comparative example was replaced by rhBMP-4, expression was still not achieved.

[0114] In addition to Comparative Examples 1 to 6, the present application tried a variety of different methods to achieve the expression of rhBMP protein. The results and corresponding methods are shown in Table 1.

[0115] Table 1

[0116]

[0117] Comparative Example 7

[0118] The difference between this comparative example and Example 1 is that the number of selected His tags is adjusted, and the remaining steps and processes are all referred to Example 1.

[0119] The results showed that when the number of histidine in the His tag was >6, the target protein began to precipitate as the number of repeats increased.

[0120] In summary, the present invention provides a method for soluble expression and purification of recombinant human bone morphogenetic protein in a prokaryotic system, which utilizes rhBMP and GB1 fusion expression to achieve soluble expression of rhBMP. In addition, due to the small molecular weight of the GB1 tag, it has almost no effect on the spatial structure and biological activity of rhBMP, thereby avoiding the formation of inclusion bodies when rhBMP is expressed in the traditional Escherichia coli system, avoiding the expression of rhBMP in the form of structureless and inactive inclusion bodies, and avoiding the downstream process of rhBMP protein renaturation; and through simple chromatography steps, the rhBMP protein is efficiently purified from the bacterial crushing supernatant system with complex components, the operation is simple, suitable for large-scale expansion, and has the characteristics of short cycle, high purity, stable process, etc.

[0121] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system, characterized in that: include, The 3' end of the GB1 tag gene was spliced ​​with the recombinant human bone morphogenetic protein gene, and the 5' end was spliced ​​with the 6×His tag gene through Linker to obtain the gene sequence of His-Linker-GB1-BMP; The gene sequence of His-Linker-GB1-BMP is inserted into the prokaryotic expression plasmid vector and transferred into prokaryotic competent cells to achieve soluble expression; The protein sequence of the GB1 tag is the Streptococcus G protein B1 domain, and the gene sequence is shown in SEQ ID NO:

3.

2. The method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system according to claim 1, characterized in that: The recombinant human bone morphogenetic protein includes recombinant human bone morphogenetic proteins 1-16.

3. The method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system according to claim 2, characterized in that: The recombinant human bone morphogenetic protein includes recombinant human bone morphogenetic protein-2, recombinant human bone morphogenetic protein-4 and recombinant human bone morphogenetic protein-7.

4. The method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system according to claim 1, characterized in that: The prokaryotic expression plasmid vector includes pET series plasmids or pCold series plasmids, and the prokaryotic competent cells include competent cells of Escherichia coli, Bacillus subtilis, and Corynebacterium glutamicum, wherein the Escherichia coli includes E. coli BL21, Shuffle T7, and Origami.

5. The method for soluble expression of recombinant human bone morphogenetic protein in a prokaryotic system according to claim 1, characterized in that: The Linker sequence contains Gly, Ser, Glu, and Lys.

6. The method for purifying the soluble recombinant human bone morphogenetic protein expressed in a prokaryotic system according to any one of claims 1 to 5, characterized in that: After the His-Linker-GB1-BMP gene is transferred into prokaryotic competent cells, The dominant growth colonies were selected by resistance plating, expanded and cultured, and the target gene was transcribed and translated by intervening promoter to obtain the fusion protein His-Linker-GB1-BMP. The bacteria were disrupted by ultrasound, and the supernatant was obtained by centrifugation. The supernatant was treated by metal chelate chromatography to purify the high-purity fusion protein His-Linker-GB1-BMP.

7. The method for purifying recombinant human bone morphogenetic protein in a prokaryotic system according to claim 6, characterized in that: The method of intervening the promoter is to initiate transcription of the plasmid carrying the target gene. include, The inducer of the intervening promoter is added, the culture temperature is adjusted, or the culture medium is self-induced, wherein the inducer includes IPTG or L-arabinose.

8. The method for purifying recombinant human bone morphogenetic protein in a prokaryotic system according to claim 6, characterized in that: The metal chelate chromatography is in adsorption-elution mode.

9. The method for purifying recombinant human bone morphogenetic protein in a prokaryotic system according to claim 8, characterized in that: In the metal chelate chromatography, the solid phase chromatography filler is a chromatography filler having affinity binding adsorption with three or more histidine residues in series fusion tags.

10. The method for purifying recombinant human bone morphogenetic protein in a prokaryotic system according to claim 9, characterized in that: The metal chelate chromatography, wherein the elution is to elute the protein with an imidazole eluent.

Images