Dark-induced enhanced luminescence expression vector as well as construction method and application thereof

Abstract

The invention discloses a darkness-induced enhanced luminescence expression vector as well as a construction method and application thereof, and the enhanced luminescence expression vector is constructed by taking a vector pDES as a skeleton vector. A core element formed by sequentially connecting a promoter PsDIN6, a mutated nnLuz gene mnnLuz, a HisspS gene of neon lamp bacteria, an H3H gene, a CPH gene and an NPGA gene of aspergillus nidulans is inserted between an attR1 element and an attR2 element of a vector pDES from the 5'end to the 3 'end, and the vector is obtained. A luciferase Luz gene of luminous fungus neon lamp bacteria is subjected to random mutation by using a directed evolution technology, a luciferase mutant gene mLuz of which the luminous efficiency is 5.7 times higher than the original luminous efficiency is obtained through screening, and an expression vector constructed by the luciferase mutant gene mLuz is instantaneously expressed on tobacco leaves, so that the tobacco leaves do not emit light in daytime and emit bright fluorescence in darkness.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a dark-induced enhanced luminescence expression vector and a construction method and application thereof. Background Art

[0002] Bioluminescence is a cold light ("coldlight") produced by the biochemical reaction of luciferin and luciferase in organisms. It is a natural phenomenon that has fascinated people for centuries. Bioluminescence is widely present in various organisms, from lower prokaryotes to higher eukaryotes. Currently, there are about 800 genera and about 10,000 species of luminescent groups reported in the world. Known lineages that do not emit light include terrestrial plants and vertebrates such as birds, amphibians and mammals. In order to utilize the bioluminescence phenomenon in nature, scientists have analyzed the bioluminescent genes and luminescence principles from luminescent organisms, and applied them as tools in scientific research.

[0003] One of its important applications is to use bioluminescence systems to achieve plant self-luminescence. There are at least 40 different bioluminescence systems in nature. At present, only the luciferase and luciferin required for the luminescence of 7 bioluminescence systems have been analyzed. Among them, only the complete biochemical process of 2 bioluminescence systems has been analyzed, namely the bioluminescence systems of bacteria and fungi. The discovery of the bacterial bioluminescence system has lasted for more than 40 years. Due to its low cytotoxicity and luminescence efficiency, it is still impossible to use this luminescence system to create self-luminescent plants. Since the fungal luminescence system was analyzed in 2018, because its luminescent substrate caffeic acid is widely present in various organisms, it only needs to transfer genes related to the luminescence reaction without adding additional exogenous luminescent substrates to achieve biological self-luminescence, which opens a new door for the creation of self-luminescent plants. Using this luminescence system, self-luminescence visible to the naked eye has been achieved in plants such as tobacco and morning glory. However, the luminescent plants created using the fungal bioluminescence system have a single luminescent color, uncontrollable luminescence time, and insufficient luminescence brightness. Summary of the invention

[0004] The purpose of the present invention is to provide a dark-induced enhanced luminescence expression vector and a construction method and application thereof in order to solve the above problems.

[0005] In order to achieve its purpose, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides a dark-induced enhanced luminescence expression vector, which is constructed with vector pDES as a backbone vector, and is inserted between the specific recombination sites attR1 and attR2 elements recognized by the LR Clonase recombinase of the vector pDES in the direction from 5' to 3' end by the promoter P connected in sequence sDIN6, the core elements consisting of the mutant nnLuz gene mnnLuz, the HispS gene, H3H gene, CPH gene of Neonothopanus nambi, and the NPGA gene of Aspergillus nidulans were obtained;

[0007] The promoter P sDIN6 The sequence of is shown in SEQ ID NO.1, and the sequence of the mutant nnLuz gene mnnLuz is shown in SEQ ID NO.4;

[0008] The vector pDES is obtained by homologous recombination of the sequence shown in SEQ ID NO.12 and the pYLTAC7 vector linearized with AscI.

[0009] The core element is the expression cassette P shown in SEQ ID NO.5 sDIN6 -mnnLuz-T NOS , the expression cassette P as shown in SEQ ID NO.6 35S -HispS-T 35S , the expression cassette P as shown in SEQ ID NO.7 35S -H3H-CPH-NPGA are obtained by serial connection.

[0010] The expression cassette is constructed into the vector pDES by Gateway cloning technology;

[0011] The sequence of attR1 is (SEQ ID NO.13):

[0012] 5'-ACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCATATTG-3', the sequence of attR2 is (SEQ ID NO.14):

[0013] 5'-CATAGTGACTGGATATGTTGTGTTTTACAGCATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTCTTGTACAAAGTGGT-3'.

[0014] The second aspect of the present invention provides a method for constructing the dark-induced enhanced luminescence expression vector described in any one of the above items, comprising the following steps:

[0015] S1. Construction of plasmid pDonor1-P sDIN6 -mnnLuz-T NOS :P shown in SEQ ID NO.5 sDIN6 -mnnLuz-T NOS The expression cassette was subcloned into the vector pDonor1 through the restriction sites AsiSI and AscI to obtain the plasmid pDonor1-P sDIN6 -mnnLuz-T NOS ;

[0016] S2. Construction of plant expression vector pDES-P sDIN6 -mnnLuz-T NOS : Plasmid pDonor1-P sDIN6 -mnnLuz-T NOS Mix with vector pDES and obtain pDES-P by homologous recombination sDIN6 -mnnLuz-T NOS ;

[0017] S3. Construction of plasmid pDonor2-P 35S -HispS-T 35S 、pDonor1-P 35S -H3H-CPH-NPGA

[0018] The P shown in SEQ ID NO.6 35S -HispS-T 35S The expression cassette was subcloned into the vector pDonor2 through the restriction sites AsiSI and AscI to obtain the plasmid pDonor2-P 35S -HispS-T 35S ;

[0019] The P shown in SEQ ID NO.7 35S The H3H-CPH-NPGA expression cassette was subcloned into the vector pDonor1 through the restriction sites AsiSI and AscI to obtain the plasmid pDonor1-P 35S -H3H-CPH-NPGA;

[0020] S4. Construction of vector pDES-P sDIN6 -mnnLu-HispS: plasmid pDonor2-P 35S -HispS-T 35S With plasmid pDES-P sDIN6 -mnnLuz-TNOS Mix and obtain plasmid pDES-P through homologous recombination sDIN6 -mnnLu-HispS;

[0021] S5. Construction of vector pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA: plasmid pDonor1-P 35S -H3H-CPH-NPGA and pDES-P sDIN6 -mnnLu-HispS mixed, and expression vector was obtained by homologous recombination

[0022] pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA.

[0023] Before homologous recombination in steps S2, S4, and S5, the plasmid was linearized with I-SceI.

[0024] The vector pDonor1 is a hybrid of synthetic sequence I and pCR linearized with EcoR I. TM 8 / GW / TOPO TM The nucleotide sequence of the synthetic sequence I is obtained by adding the sequence shown in SEQ ID NO.9 to the 5' end of the sequence shown in SEQ ID NO.8 and adding the sequence shown in SEQ ID NO.10 to the 3' end;

[0025] The vector pDonor2 is obtained by homologous recombination of synthetic sequence II and pUC19 vector linearized with Sal I. The nucleotide sequence of the synthetic sequence II is a sequence obtained by adding the sequence shown in SEQ ID NO.9 to the 5' end of the sequence shown in SEQ ID NO.11 and adding the sequence shown in SEQ ID NO.10 to the 3' end.

[0026] The third aspect of the present invention provides the use of any of the above-mentioned dark-induced enhanced luminescence expression vectors in cultivating transgenic plants.

[0027] The transgenic plants fluoresce in dark conditions.

[0028] The application is to introduce the above expression vector into a recipient plant to obtain a transgenic plant; compared with the recipient plant, the transgenic plant emits bright fluorescence at night but no light during the day.

[0029] The recipient plant is selected from tobacco, Arabidopsis, and petunia; and Agrobacterium-mediated culture is adopted, preferably Agrobacterium GV3101.

[0030] The beneficial effects of the present invention are:

[0031] In order to solve the problem that the self-luminous plants currently created have uncontrollable luminescence time and insufficient luminescence brightness, we designed and constructed a dark-induced enhanced luminescence vector. After the vector is transferred into plants, the plants can emit bright fluorescence at night but not during the day. Through high-throughput screening of dark-induced promoters from Arabidopsis thaliana, we obtained the DARK INDUCIBLE 6 (DIN6) promoter (P DIN6 In order to reduce the length of the promoter and improve the efficiency and stability of the vector construction, the promoter P DIN6 The optimized promoter P sDIN6 The fragment size is much smaller than P DIN6 , the activity is related to P DIN6 Using a small fragment of P sDIN6 Reducing the promoter length is more conducive to the assembly of the expression vector, improving the success rate of vector construction, and avoiding the failure to successfully construct the recombinant vector or the failure of the recombinant vector to perform the expected function due to the recombinant fragment being too long; at the same time, it can also avoid the problem of the recombinant vector being easily mutated or lacking fragments when it is propagated in bacteria or Agrobacterium due to the recombinant fragment being too long, thereby improving the stability of the vector.

[0032] Directed evolution technology was used to randomly mutate the luciferase Luz gene of the luminous fungus Neonothopanus nambi, and a luciferase mutant gene mLuz with a luminescence efficiency 5.7 times higher than the original one was screened.

[0033] Using the optimized dark-inducible promoter P sDIN6 The expression of mLuz gene is driven. Meanwhile, the vector is inserted with the HispS gene, H3H gene, CPH gene of neon fungi necessary for plant luminescence, and NPGA gene of Aspergillus nidulans, and a dark-induced enhanced luminescence vector is successfully constructed. The expression vector constructed by the present invention is transiently expressed on tobacco leaves, so that the tobacco leaves do not emit light during the day but emit bright fluorescence in the dark, providing a new path for luminous plants to accumulate energy during the day and release light at night. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 is the relative fluorescence intensity of the dark-inducible promoter after dark treatment.

[0035] Figure 2 P of different lengths DIN6 Relative fluorescence intensity of the promoter after dark treatment.

[0036] Figure 3The luciferase activities of the top 10 mutant clones with significantly enhanced fluorescence brightness are shown in Figure 1. nnLuz is the non-mutated luciferase gene.

[0037] Figure 4 The constructed pDonor1-P sDIN6 -mnnLuz-T NOS Vector map.

[0038] Figure 5 The constructed pDES-P sDIN6 -mnnLuz-T NOS Vector map.

[0039] Figure 6 pDES-P sDIN6 -Schematic diagram of the main components of the mnnLu-HispS-H3H-CPH-NPGA vector.

[0040] Figure 7 is the fluorescence intensity of tobacco leaves transiently expressing luminescent plasmid under white light and dark treatments.

[0041] Figure 8 It is a comparison of the relative fluorescence intensity of the luminescent expression vector of the present invention and the control luminescent vector in tobacco leaves. DETAILED DESCRIPTION

[0042] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0043] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0044] Main reagents / sources:

[0045] pGreenII 0800-LUC: a plasmid vector for plant transient gene expression, purchased from Addgene.

[0046] LB+Kana+Rif liquid medium: contains 50 μg / mL kanamycin (Kana) and 25 μg / mL rifampicin (Rif).

[0047] All the endonucleases in the examples were purchased from New England BioLabs, including I-SceI endonuclease catalog number: R0694S; EcoRI endonuclease catalog number: R0101V; SalI endonuclease catalog number: R0138V; AscI endonuclease catalog number: R0558S; and AsiSI endonuclease catalog number: R0630S.

[0048] 5×Gateway LR Clonase II Enzyme mix: brand: Invitrogen.

[0049] The donor vector pDonor1 is composed of pCR TM 8 / GW / TOPO TM Vector transformation, pCR TM 8 / GW / TOPO TM The vector is included in the pCR8 / GW / TOPO TA Cloning Kit, which is produced by Invitrogen and has a catalog number of K250020.

[0050] The donor vector pDonor2 was modified from the pUC19 vector (produced by Thermo Scientific, catalog number SD0061).

[0051] The receiving vector pDES was transformed from the pYLTAC7 vector (the pYLTAC7 vector was purchased from the BioVector NTCC Collection Center).

[0052] Vectors pDonor1, pDonor2, and pDES: pDonor1, pDonor2, and pDES disclosed in Chinese patent application CN202211090106.6 (publication number CN116064626A, invention name: An efficient multi-gene assembly vector system capable of assembling ultra-large fragments, its construction method, and multi-gene assembly method), and the construction method is as disclosed in CN116064626A.

[0053] Example 1. Screening and optimization of dark-inducible promoters

[0054] 1. Promoter Screening

[0055] The reported Arabidopsis dark-inducible promoters were analyzed and the top 10 promoters with the highest dark-induction efficiency were selected (P XTR7 , P PIL1 , P RD20 , P DIN11 , P DIN2 , P DIN6 , P TPX2 , P DIN1 , P SLC1 , P DIN9 ), and commissioned Nanjing GenScript Biotechnology Co., Ltd. to synthesize the above promoter sequences into the promoter analysis vector pGreenII0800-LUC. The above vector plasmids were respectively transferred into GV3101 Agrobacterium, and positive clones were screened. The positive clones were cultured in LB+Kana+Rif liquid medium at 28°C and 200rpm until OD 600= 0.8. Then, the cells were collected by centrifugation at 4000 rpm for 10 min, and the Agrobacterium cells were suspended in infection solution (10 mM MgCl2, 10 mM MES, 200 μM As) and allowed to stand at room temperature for 3 h.

[0056] 2. Screening of the Promoter with the Highest Dark Induction Efficiency by Transient Expression in Tobacco Leaves

[0057] Use a sterilized 1mL syringe needle to pierce 2 to 3 holes on the back of the tobacco plant leaf, use a needleless syringe to absorb the static bacterial solution, and inject 100μL of bacterial solution from the leaf wound. After the injection, place it in a 22℃ artificial culture room for normal culture for two days. Divide it into two groups for treatment, treatment 1-light treatment: continue to light for 6 hours after 12 hours of light; treatment 2-dark treatment: dark for 6 hours after 12 hours of light. Then collect the infected leaf samples for liquid nitrogen grinding, take 0.2g of the ground sample and add 100μL of lysis buffer, stand at room temperature or shake for lysis for 5 minutes, blow and absorb the cell lysis product into a 1.5mL centrifuge tube, centrifuge at 12000g for 2 minutes at room temperature, and take the supernatant for subsequent detection. Add 100 μL of luciferase substrate equilibrated to room temperature to the test tube or ELISA plate, carefully pipette 20 μL of cell lysis supernatant into the test tube or ELISA plate well, quickly mix and immediately detect the luciferase reporter gene activity in an ELISA instrument to compare the relative fluorescence intensity of different dark-inducible promoters after dark treatment. There is no significant difference in the activity of the above promoters under light treatment. The results of dark treatment are shown in Figure 2. Figure 1 As shown, Arabidopsis P DIN6 It is the promoter with the highest darkness-inducible efficiency.

[0058] 3. P DIN6 Promoter optimization

[0059] Analysis of the conserved promoter elements revealed that P DIN6 The promoter G-box element (nucleotide sequence: CACGTG) is the core region of darkness induction. There are multiple G-box elements in the promoter region, and they are mainly concentrated at the 3' end of the promoter. Therefore, we truncated the promoter and analyzed its activity by transient expression in tobacco leaves (the operation method is the same as before). DIN6 The promoter was truncated into the following parts: ①1-1497bp (full length); ②1-743bp; ③1-1076bp; ④1-557bp. Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize the above promoter sequences into the promoter analysis vector pGreenII 0800-LUC and transfer them into GV3101 Agrobacterium. The activity was analyzed by transient expression in tobacco leaves and it was found that the fluorescence intensity of the ①②③ fragments in the dark was not significantly different, while the fluorescence intensity of ④ was significantly reduced ( Figure 2), indicating that the shortened promoter ② can be used for dark-induced gene expression, and the fragment ② was named P sDIN6 , whose nucleotide sequence is shown in SEQ ID NO.1:

[0060] .

[0061] Example 2. Directed evolution of the luciferase gene nnluz (luciferase) of the luminescent fungus Neonothopanus nambi

[0062] The Diversify PCR random mutagenesis kit (product number: 630703) from Takara (Japan) was purchased to construct the nnLuz gene library. To facilitate the subsequent construction of the vector, restriction sites Nco I (CCATGG) and Hind III (AAGCTT) were added to the front end of the nnLuz gene amplification primers Primer F and Primer R, respectively. The primer sequences are as follows:

[0063] Primer F (SEQ ID NO.2): 5'- CCATGG ATGCGCATTAACATTAGCCTC-3′;

[0064] Primer R (SEQ ID NO.3): 5'- AAGCTT CTTGGCGTTTTCTACAATCTTTC-3'.

[0065] The mutation PCR reaction system (50 μL volume) is as follows:

[0066]

[0067] The PCR amplification product was recovered from the gel, and the amplified PCR product and the bacterial expression vector pET-28a(+) were digested with Nco I and Hind III restriction endonucleases (purchased from NEB, USA). The mutant nnLuz gene library was inserted into the plasmid pET-28a(+) using T4 DNA ligase, and the plasmid was transferred into the Escherichia coli expression strain BL21(DE3), and colony PCR detection was performed. The colonies with the correct band size were identified by high-throughput screening and expanded, and then inoculated into LB liquid culture medium in a 48-well plate and shaken at 37°C until OD 600 At about 0.4-0.6, add 0.2mM isopropylthiamine (IPTG) to the culture, induce expression at 37°C for 16h, and add an appropriate volume of cell lysate. Add 100μM fungal luciferin 3-Hydroxyhispidin (3-hydroxyl milk echinopsine, purchased from Sichuan Weikeqi Biotechnology Co., Ltd.; Product No.: WKQ-0086614) to the cell lysate, and use a microplate reader (TECAN, Model: Spark) to detect the fluorescence intensity. A total of more than 500 bacterial monoclonal clones were detected, among which the luciferase activity of the top 10 mutant clones with significantly enhanced fluorescence brightness was as follows Figure 3As shown, mutant clone 6 with the highest fluorescence brightness (its luminescence intensity is 5.7 times higher than that of the unmutated nnLuz enzyme activity) was selected for nnLuz gene sequencing, and it was found that the nnLuz gene sequence contained the following mutation sites: T8G, C33G, A295C, A574T, T728A. The mutant nnLuz gene was named mnnLuz, and its nucleotide sequence is shown in SEQ ID NO.4 (where the bases marked with underscores and boldface are mutation points):

[0068]

[0069] Example 3. Construction of dark-induced fungal luciferase gene mnnLuz vector

[0070] According to the results of Examples 1 and 2, the truncated Arabidopsis dark-inducible promoter P sDIN6 To drive the expression of the fungal luciferase gene mnnLuz, in Examples 3 and 4, the multi-gene assembly vector system and multi-gene assembly method developed by this research team were used for multi-gene assembly (see Chinese patent application CN202211090106.6, publication number CN116064626A).

[0071] The specific process is as follows:

[0072] 1. Construction of plasmid pDonor1-P sDIN6 -mnnLuz-T NOS

[0073] Construction of the donor vector pDonor1-P sDIN6 -mnnLuz-T NOS , P sDIN6 -mnnLuz-T NOS The combined sequence was synthesized at Nanjing GenScript Biotechnology Co., Ltd. and subcloned into pDonor1 using the AsiSI and AscI restriction sites to obtain the following: Figure 4 The plasmid pDonor1-P sDIN6 -mnnLuz-T NOS .P sDIN6 -mnnLuz-T NOS The nucleotide sequence is shown in SEQ ID NO.5.

[0074] 2. Construction of plant expression vector pDES-P sDIN6 -mnnLuz-T NOS

[0075] The pDonor1-P linearized with I-SceI was sDIN6 -mnnLuz-T NOSThe plasmid (I-SceI linearization can improve the LR reaction efficiency) was mixed with the receiving vector pDES linearized with I-SceI, and LR reaction was carried out under the action of LR Clonase recombinase (Invitrogen, Catalog No.: 11791020) to obtain pDES-P sDIN6 -mnnLuz-T NOS Plasmid. LR reaction system is as follows (10 μL system):

[0076] 5×GatewayLRClonaseIIEnzymemix 2μL <![CDATA[pDonor1--P linearized by I-SceI sDIN6 -mnnLuz-T NOS plasmid (100 ng / μL)]]> 6μL pDES plasmid (100 ng / μL) 2μL

[0077] After mixing evenly, the reaction system was incubated at 25°C for 1 hour, and then placed on ice to transform E. coli. The transformed E. coli was spread on LB solid medium containing kanamycin (Kan, 50 mg / L) and ampicillin (Amp, 50 mg / L) and cultured overnight. Primers Primer F and Primer R were used to identify positive clones, which were about 800 bp in size. The plasmid extracted from the correct clone was the constructed pDES-P sDIN6 -mnnLuz-T NOS The vector, the vector map is as Figure 5 shown.

[0078] Example 4. Construction of a dark-induced enhanced fungal luminescence gene system

[0079] 1. Construction of plasmid pDonor2-P 35S -HispS-T 35S 、pDonor1-P 35S -H3H-CPH-NPGA

[0080] The fungal Neonothopanus nambi luminescent gene system consists of H3H (hispidin-3-hydroxylase), HispS (Hispidin synthase), CPH (caffeoyl pyruvate hydrolase) and Luz genes. In addition, the NPGA (4'-phosphopantetheinyl transferase) gene from Aspergillus nidulans can significantly enhance the luminescence efficiency. Therefore, the above five genes are tandemly integrated into a plant expression vector to form a fungal luminescent gene system.

[0081] Example 3 The construction of the dark-induced fungal luciferase gene mnnLuz vector has been completed. On this basis, the remaining four gene expression cassettes are further integrated into the plant expression vector pDES-P sDIN6 -mnnLuz-T NOSAmong them, H3H, HispS, CPH and NPGA genes are all driven by the 35S promoter (P 35S ) driven by the 35S terminator (T 35S ) terminated, CPH and NPGA genes were terminated by T NOS The gene expression frames are: P 35S -H3H-T 35S , P 35S -HispS-T 35S , P 35S -CPH-T NOS and P 35S -NPGA-T NOS Since the length of H3H (1269 bp), CPH (870 bp), and NPGA (1035 bp) genes is relatively short, while the length of HispS (5037 bp) gene is relatively long, P 35S -H3H-T 35S , P 35S -CPH-T NOS and P 35S -NPGA-T NOS The three expression frames are combined in series and named P 35S -H3H-CPH-NPGA.

[0082] P 35S -HispS-T 35S and P 35S The H3H-CPH-NPGA expression cassette was commissioned to Nanjing GenScript Biotech Co., Ltd. for synthesis and subcloned into pDonor2 and pDonor1 using the AsiSI and AscI restriction sites, respectively, to obtain the plasmid pDonor2-P 35S -HispS-T 35S (abbreviated as: pDonor2-HispS) and pDonor1-P 35S -H3H-CPH-NPGA (abbreviated as: pDonor1-H3H-CPH-NPGA).

[0083] Expression box P 35S -HispS-T 35S The nucleotide sequence is shown in SEQ ID NO.6. 35S The nucleotide sequence of -H3H-CPH-NPGA is shown in SEQ ID NO.7.

[0084] 2. Construction of vector pDES-P sDIN6 -mnnLu-HispS

[0085] The pDonor2-HispS plasmid linearized with I-SceI was fused with the pDES-P sDIN6 -mnnLuz-T NOS (abbreviated as pDES-P sDIN6 -mnnLu) plasmids were mixed and LR reaction was carried out under the action of LR Clonase recombinase to obtain pDES-P sDIN6 -mnnLu-HispS plasmid. After mixing evenly, the reaction system was incubated at 25°C for 1 hour, and then placed on ice to transform E. coli. The transformed E. coli was spread on LB solid medium containing kanamycin (Kan, 50 mg / L) and chloramphenicol (Cm, 30 mg / L) and cultured overnight. Positive clones were selected and the correct single clones were identified by PCR. The plasmid extracted was the constructed pDES-P sDIN6 -mnnLu-HispS vector.

[0086] 3. Construction of vector pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA

[0087] The pDonor1-H3H-CPH-NPGA plasmid linearized with I-SceI was fused with the pDES-P sDIN6 -mnnLu-HispS plasmids were mixed and LR reaction was carried out under the action of LR Clonase recombinase to obtain pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA plasmid. After mixing evenly, the reaction system was incubated at 25°C for 1 hour, and then placed on ice to transform E. coli. The transformed E. coli was spread on LB solid medium containing kanamycin (Kan, 50 mg / L) and ampicillin (Amp, 50 mg / L) and cultured overnight. Positive clones were selected and the correct single clones were identified by PCR. The plasmid extracted was the constructed pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA carrier ( Figure 6 ), and entrusted the plasmid to Nanjing GenScript Biotech Co., Ltd. for full-length NGS sequencing of the plasmid. The sequencing results showed that the constructed vector was accurate.

[0088] Example 5. Tobacco transiently expresses dark-inducible luminescent vector

[0089] The constructed pDES-P sDIN6-mnnLu-HispS-H3H-CPH-NPGA plasmid was transferred into GV3101 Agrobacterium, and positive clones were obtained by PCR identification. Positive clones were cultured in LB+Kana+Rif liquid medium at 28°C and 200rpm until OD 600 = 0.8. Then, the cells were collected by centrifugation at 4000 rpm for 10 min, and the Agrobacterium cells were suspended in infection solution (10 mM MgCl2, 10 mM MES, 200 μM As) and allowed to stand at room temperature for 3 h.

[0090] Transient expression of pDES-P in tobacco leaves sDIN6 -mnnLu-HispS-H3H-CPH-NPGA plasmid Agrobacterium: Use a sterilized 1mL syringe needle to pierce 2 to 3 holes on the back of the tobacco plant leaves, use a needleless syringe to absorb the static bacterial solution, and inject 100μL of bacterial solution from the leaf wound. After the injection, place it in a 22℃ artificial culture room for normal culture for two days. Divide into two groups for treatment, treatment 1-light treatment: continue to light for 6 hours after 12 hours of light; treatment 2-dark treatment: dark for 6 hours after 12 hours of light. After the treatment is completed, take the injected leaves and take pictures and analyze them under a fully automatic luminescence detector (Tianneng, model: Tanon 5200). It was found that the luminescence brightness of tobacco leaves transiently expressing the dark-inducible luminescent vector was significantly enhanced after dark induction, but basically no light was emitted under white light ( Figure 7 ). Using the constitutive luminescent vector driven by the 35S promoter (reference Zheng et al.al, 2023.DOI:10.1111 / pbi.14068) as a control, tobacco leaves transiently expressing the constitutive luminescent vector driven by the 35S promoter can emit light both during the day and in the dark, but the luminescent intensity is significantly lower than that of the dark-induced luminescent vector of the present invention ( Figure 8 ).

Claims

1. A dark-induced enhanced luminescence expression vector, characterized in that: It is constructed with the vector pDES as the backbone vector. The promoter P is connected in sequence between the specific recombination sites attR1 and attR2 elements recognized by the LR Clonase recombinase of the vector pDES from 5' to 3'. sDIN6 , the core elements consisting of the mutant nnLuz gene mnnLuz, the HispS gene, H3H gene, CPH gene of Neonothopanus nambi, and the NPGA gene of Aspergillus nidulans were obtained; The promoter P sDIN6 The sequence of is shown in SEQ ID NO.1, and the sequence of the mutant nnLuz gene mnnLuz is shown in SEQ ID NO.4; The vector pDES is obtained by homologous recombination of the sequence shown in SEQ ID NO.12 and the pYLTAC7 vector linearized with Asc I.

2. The dark-induced enhanced luminescence expression vector according to claim 1, characterized in that: The core element is the expression cassette P shown in SEQ ID NO.5 sDIN6 -mnnLuz-T NOS , the expression cassette P shown in SEQ ID NO.6 35S -HispS-T 35S , the expression cassette P shown in SEQ ID NO.7 35S -H3H-CPH-NPGA are obtained by serial connection.

3. The dark-induced enhanced luminescence expression vector according to claim 2, characterized in that: The expression cassette is constructed into the vector pDES by Gateway cloning technology; The sequence of attR1 is: 5'-ACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATT AGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCATATTG-3', The sequence of attR2 is: 5'-CATAGTGACTGGATATGTTGTGTTTTACAGCATTATGTAGTCTGTTTTTTATGCAAAATCTAATTT AATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTCTTGTACAAAGTGGT-3'.

4. The method for constructing the dark-induced enhanced luminescence expression vector according to any one of claims 1 to 3, characterized in that: The steps include: S1. Construction of plasmid pDonor1-P sDIN6 -mnnLuz-T NOS :P as shown in SEQ ID NO.5 sDIN6 -mnnLuz-T NOS The expression cassette was subcloned into the vector pDonor1 through the restriction sites AsiSI and AscI to obtain the plasmid pDonor1-P sDIN6 -mnnLuz-T NOS ; S2. Construction of plant expression vector pDES-P sDIN6 -mnnLuz-T NOS : Plasmid pDonor1-P sDIN6 -mnnLuz-T NOS Mix with vector pDES and obtain pDES-P through homologous recombination sDIN6 -mnnLuz-T NOS ; S3. Construction of plasmid pDonor2-P 35S -HispS-T 35S 、pDonor1-P 35S -H3H-CPH-NPGA The P shown in SEQ ID NO.6 35S -HispS-T 35S The expression cassette was subcloned into the vector pDonor2 through the restriction sites AsiSI and AscI to obtain the plasmid pDonor2-P 35S -HispS-T 35S ; The P shown in SEQ ID NO.7 35S The H3H-CPH-NPGA expression cassette was subcloned into the vector pDonor1 through the restriction sites AsiSI and AscI to obtain the plasmid pDonor1-P 35S -H3H-CPH-NPGA; S4. Construction of vector pDES-P sDIN6 -mnnLu-HispS: plasmid pDonor2-P 35S -HispS-T 35S With plasmid pDES-P sDIN6 -mnnLuz-T NOS Mix and obtain plasmid pDES-P through homologous recombination sDIN6 -mnnLu-HispS; S5. Construction of vector pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA: plasmid pDonor1-P 35S -H3H-CPH-NPGA and pDES-P sDIN6 -mnnLu-HispS mixed, and expression vector was obtained by homologous recombination pDES-P sDIN6 -mnnLu-HispS-H3H-CPH-NPGA。 5. The construction method according to claim 4, characterized in that: Before homologous recombination in steps S2, S4, and S5, the plasmid was linearized with I-SceI.

6. The construction method according to claim 4, characterized in that: The vector pDonor1 is a hybrid of synthetic sequence I and pCR linearized with EcoR I. TM 8 / GW / TOPO TM The nucleotide sequence of the synthetic sequence I is obtained by adding the sequence shown in SEQ ID NO.9 to the 5' end of the sequence shown in SEQ ID NO.8 and adding the sequence shown in SEQ ID NO.10 to the 3' end; The vector pDonor2 is obtained by homologous recombination of synthetic sequence II and pUC19 vector linearized with Sal I. The nucleotide sequence of the synthetic sequence II is a sequence obtained by adding the sequence shown in SEQ ID NO.9 to the 5' end of the sequence shown in SEQ ID NO.11 and adding the sequence shown in SEQ ID NO.10 to the 3' end.

7. Use of the dark-induced enhanced luminescence expression vector according to any one of claims 1 to 3 in cultivating transgenic plants.

8. The use according to claim 7, characterized in that: The transgenic plants fluoresce in dark conditions.

9. The use according to claim 8, characterized in that: The expression vector of claim 1 is introduced into a recipient plant to obtain a transgenic plant; compared with the recipient plant, the transgenic plant emits bright fluorescence at night but does not emit light during the day.

10. The use according to claim 9, characterized in that: The recipient plant is selected from tobacco, Arabidopsis, and petunia; and Agrobacterium-mediated culture is adopted, preferably Agrobacterium GV3101.

Images