Molecular marker linked with corn leaf epidermis wax layer development gene and application thereof
By developing the molecular marker YMInDel130, a gene-linked development gene of the corn leaf epidermal wax layer, the problem of corn line improvement and slow breeding progress was solved, and the rapid prediction and screening of the wax layer of the leaves of corn plants and offspring were achieved, and the improvement of the seedling stage was improved. Corn breeding efficiency and strain improvement speed.
Patent Information
- Application Number
- CN202410935962.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-12
- Publication Date
- 2024-12-13
AI Technical Summary
In the prior art, there is a lack of research on the development of the waxy layer of the corn leaf epidermis, resulting in slower corn line improvement and breeding progress, and the lack of effective molecular markers to predict the waxy layer of the leaves of corn plants and offspring.
The molecular marker YMInDel130, which is linked to the development gene of the waxy layer of corn leaves, was developed by PCR amplification and primer sequences TGCCCAGAATGGTTTGGAT and TGGTCTGGTTATGGTAGTCTG, was used to identify the genotype of corn plants, locate the new gene glossy27(t) and develop molecular markers linked to it. , used to quickly screen and predict the development of waxy layer of corn material or variety.
Through the detection of this molecular marker, it is possible to predict whether the waxy layer of the seedling leaf of corn material or variety can be normal before planting, saving production costs, improving selection efficiency, shortening the corn planting cycle, and achieving rapid screening and assisted breeding.
Smart Images
Figure CN119120752A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular markers, and in particular to a molecular marker tightly linked to a new gene regulating the development of corn leaf epidermal wax layer and its application. Background Art
[0002] The wax layer of plant leaf epidermis is a specialized structure on the leaf surface. It has the functions of protecting the underlying tissues and regulating the information exchange between plants and external substances. It can reduce the heat load of the epidermis, regulate water loss, reduce ultraviolet radiation, resist the invasion of pests and diseases, and store metabolites. In recent years, the important role of specialized structures and wax layers of plant epidermal cells has received extensive attention. The most research has been done in Arabidopsis, followed by rice, while in-depth research on the formation and development of epidermal cell structures in crops such as corn, sorghum, cotton and wheat is relatively lacking. Therefore, it is necessary to design molecular markers linked to the development of corn leaf epidermal wax layer genes and their application to further accelerate the improvement and breeding progress of corn lines. Summary of the invention
[0003] The purpose of the present invention is to provide a molecular marker linked to the development gene of the wax layer of corn leaf epidermis and its application. By detecting the molecular marker, the wax layer of the leaves of corn plants and hybrid or self-pollinated offspring at the seedling stage can be predicted in the early stage, thereby accelerating the improvement and breeding progress of corn varieties.
[0004] In order to achieve the above object, the technical solution adopted by the present invention is as follows:
[0005] Molecular markers linked to the gene for the development of the wax layer in the corn leaf epidermis and their application were obtained by PCR amplification using the following primer pairs:
[0006] Molecular marker name: YMInDel130;
[0007] Left primer sequence: TGCCCAGAATGGTTTGGGAT;
[0008] Right primer sequence: TGGGTCTGGTTATGGTAGTCTG.
[0009] 2. The use of the molecular marker linked to the gene for development of the corn leaf epidermal wax layer according to claim 1, characterized in that it is used to identify the wax layer of the leaves of hybrid or self-pollinated offspring of corn plants at the seedling stage.
[0010] 3. The use of the molecular marker linked to the corn leaf epidermal wax layer development gene according to claim 1, characterized in that it is used for the improvement and breeding of corn varieties.
[0011] 4. A method for identifying molecular markers linked to genes for the development of the wax layer in corn leaf epidermis, characterized in that: the genomic DNA of the corn seeds or plants to be tested is amplified using the primer pair of claim 1. If a 146 bp fragment can be amplified using the molecular marker YMInDel130, it indicates that the corn material or variety to be tested contains a mutant of the gene. If the amplification cannot be performed or a fragment of another length is amplified, it indicates that the mutant is not present.
[0012] 5. The molecular marker linked to the corn leaf epidermal wax layer development gene according to claim 1, characterized in that the process of screening the molecular marker primers is:
[0013] (1) Identification of agronomic traits of materials: After collecting materials with abnormal development of the wax layer on the leaf epidermis at the seedling stage, several generations of self-pollination and agronomic trait identification were first carried out. The growth period was about 125 days, the plant height was about 1.9 m, and there were 15-16 leaves. From the time the first leaf grew out of the seedling, the leaf surface was smooth, highly reflective, and easy to adhere to water droplets. Electron microscopic observation results showed that the wax layer on the leaf epidermis developed slowly during this period, the accumulated wax layer was thin, and the cell structure of other tissues was intact. From the trumpet stage to the jointing stage, the epidermis morphology of the grown leaves and new leaves gradually returned to normal as the plant grew.
[0014] (2) Gene localization and molecular marker development: hybridize it with non-curly leaf common corn materials, then self-pollinate and construct F 2:3 The F1 group had no curled leaves, while the F2 group had segregation. The ratio of light leaves to normal leaves was 1:3. 2:3 The light leaf group and the normal group were mixed into two pools of DNA. The DNA was sequenced with the two parents using SNP chips. Continuous differences were found in the 165-240Mb region of chromosome 4. Then, based on the sequence information of materials such as maize genome database B73, InDel markers were developed in this region. 2:3 The target interval was further shortened to 206211146bp-212485791bp (206.2Mb-212.5Mb) for family individual plants, and a molecular marker YMInDel130 linked to it was developed.
[0015] (3) Comparison of homology with reported genes of the same type: The leaf epidermal wax layer development genes gl3 and gl4 were reported to be located on chromosome 4, with physical positions of 185831259 bp and 171920871 bp (171.9 Mb-185.9 Mb), respectively, which are more than 14 Mb away from the positioning interval of this study (206.2 Mb-212.5 Mb). At the same time, two molecular markers were designed near the positions of the fragments where genes gl3 and gl4 are located (173 Mb and 186 Mb), and the F2 plants of the study population were tested. The linkage between their phenotypes and molecular markers was much lower than that of marker YMInDel130, indicating that the interval where the mutated gene is located does not overlap with gl3 and gl4.
[0016] (4) Naming of the new mutation: The located gene is a new recessive gene that regulates the development of the wax layer in the leaf epidermis of maize seedlings. Based on the names of similar mutants or genes recorded in the maize genome database, the mutant was preliminarily named glossy27(t).
[0017] The present invention has the following beneficial effects due to the adoption of the above technical solution:
[0018] The present invention locates a new gene that regulates the development of the wax layer of corn leaf epidermis and develops a molecular marker linked to it. The gene position located by the molecular marker of the present invention is clear and easy to identify. By detecting the molecular marker linked to the gene, it is used for genotype detection of corn materials or varieties, and whether the wax layer of the leaves of the corresponding corn materials or varieties and their self-pollinated or hybridized offspring are normal in the seedling stage can be predicted and analyzed before planting. The detection is convenient and fast, and is not affected by the environment. It not only saves production costs but also greatly improves the selection efficiency of corn materials, greatly shortens the corn planting cycle, and realizes rapid screening of strains or is used to assist corn breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 It is a spectrum of the molecular marker YMInDel130 of the present invention after PCR amplification and PAGE electrophoresis; DETAILED DESCRIPTION
[0020] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and preferred embodiments. However, it should be noted that many details listed in the specification are only for the purpose of enabling the reader to have a thorough understanding of one or more aspects of the present invention, and these aspects of the present invention can be implemented even without these specific details.
[0021] During the breeding and improvement of Guangxi corn breeding population, a corn material with smooth leaves, strong reflectiveness and easy attachment of water droplets in the seedling stage was collected. Through cytological observation and analysis, it was determined that the epidermal wax layer was slowly developed and the accumulated wax layer was thin. After growing to the trumpet stage, the leaf surface characteristics gradually returned to normal as the plant grew. The material has excellent comprehensive agronomic traits, without other obvious adverse traits. It is an important material for studying the growth and development of the cell tissue structure of the plant leaf epidermis and the genetic development regulation mechanism. It is also an ideal material for analyzing and identifying gene functions and understanding gene expression regulation.
[0022] The gene was located by molecular biology methods, and the regulatory gene was located in the interval of 6274645bp (6.3Mb) between 206211146bp-212485791bp on chromosome 4. Currently, there is no similar gene reported in this interval, indicating that the mutant phenotype found in this study is caused by a new gene mutation. According to the names of similar mutants or genes recorded in the Maize Genome Database (MaizeGDB), the mutant was initially named glossy27(t). Mining its regulatory genes and combining molecular technology for germplasm innovation will help the development of basic theories related to maize leaf growth and development and the breeding of new maize varieties with wide adaptability, high resistance and tolerance to adversity.
[0023] The purpose of the present invention is to provide a molecular marker linked to a regulatory gene of a corn leaf epidermal wax layer development mutant glossy27(t). By detecting the molecular marker, the wax layer conditions of the leaves of corn plants and hybrid or self-pollinated offspring at the seedling stage can be predicted in the early stage, thereby accelerating the improvement and breeding progress of corn lines.
[0024] Molecular markers linked to the regulatory gene of the mutant glossy27(t) were obtained by PCR amplification using the following primer pair:
[0025] Molecular marker name: YMInDel130,
[0026] Left primer sequence: TGCCCAGAATGGTTTGGGAT,
[0027] Right primer sequence: TGGGTCTGGTTATGGTAGTCTG.
[0028] The present invention also provides a molecular marker identification method for the developmental gene of the wax layer of corn leaf epidermis at the seedling stage, which uses the above-mentioned primer pair to amplify the genomic DNA of the corn seeds or plants to be tested. If the molecular marker YMInDel130 can amplify a 146bp fragment, it indicates that the corn material or variety to be tested contains a mutant type of the gene. If it cannot be amplified or fragments of other lengths are amplified, it means that the mutant type is not contained.
[0029] The process of screening the above molecular marker primers is as follows:
[0030] (1) Identification of agronomic traits of materials: After collecting materials with abnormal development of the epidermal wax layer of leaves at the seedling stage, multi-generation self-pollination and agronomic trait identification were first carried out. The growth period was about 125 days, the plant height was 1.9m, and there were 15-16 leaves. From the time the first leaf grew out of the seedling, the leaf surface was smooth, highly reflective, and easy to adhere to water droplets. The results of electron microscopy showed that the epidermal wax of the leaves developed slowly during this period, the accumulated wax layer was thin, and the cell structure of other tissues was intact. From the trumpet stage to the jointing stage, the epidermal morphology of the grown leaves and new leaves gradually returned to normal as the plant grew.
[0031] (2) Gene localization and molecular marker development: hybridize it with non-curly leaf common corn materials, then self-pollinate and construct F 2:3 The F1 group had no curled leaves, while the F2 group had segregation. The ratio of light leaves to normal leaves was 1:3. 2:3 The light leaf group and the normal group were mixed into two pools of DNA. The DNA was sequenced with the two parents using SNP chips. Continuous differences were found in the 165-240Mb region of chromosome 4. Then, based on the sequence information of materials such as maize genome database B73, InDel markers were developed in this region. 2:3 The target interval was further shortened to 206211146bp-212485791bp (206.2Mb-212.5Mb) for family individual plants, and a molecular marker YMInDel130 linked to it was developed.
[0032] (3) Comparison of homology with reported genes of the same type: After consulting the literature, the leaf epidermal wax layer development genes gl3 and gl4 were reported to be located on chromosome 4, with physical positions of 185831259 bp and 171920871 bp (171.9 Mb-185.9 Mb), respectively, which are more than 14 Mb away from the positioning interval of this study (206.2 Mb-212.5 Mb). At the same time, two molecular markers were designed near the fragments where genes gl3 and gl4 are located (173 Mb and 186 Mb), and the F2 plants of the study population were tested. The linkage between their phenotypes and molecular markers was much lower than that of marker YMInDel130, indicating that the interval where the mutated gene is located does not overlap with gl3 and gl4.
[0033] (4) Naming of the new mutation: The above shows that the gene located in this study is a new recessive gene that regulates the development of the wax layer in the leaf epidermis of maize seedlings. Based on the names of similar mutants or genes recorded in the Maize Genome Database (MaizeGDB), the mutant was preliminarily named glossy27(t).
[0034] (5) Electrophoresis pattern of molecular marker YMInDel130: Figure 1 , the leftmost 0 of the electrophoresis picture is the marker, and there are 19 samples in total, among which the 18th well is glossy27(t), and the banding type is recorded as B. The plants with this banding type (such as samples 1-8) have the same wax layer phenotype as glossy27(t) in the seedling stage; the 19th well is WT, which has the wild-type gene allele with glossy27(t), and the banding type is recorded as A. The plants with this banding type (such as samples 9-16) have normal leaves in the seedling stage; the 17th well is the F1 hybrid of glossy27(t) and WT, which has a heterozygous allele, and the banding type is recorded as H. The wax layer on the leaves is normal in the seedling stage, and its self-pollinated offspring will separate, and three types of A, B, and H will appear, which can be screened by the same method using the marker YMInDel130.
[0035] Example 1: Transforming normal materials into research materials with leaf surface wax layer development mutation
[0036] Maize material B73 is a public superior maize inbred line whose genome has been sequenced. The wax layer of the leaf epidermis develops normally throughout the entire growth cycle.
[0037] If the mutant gene is introduced into B73 by the traditional hybridization and backcrossing method, taking five backcrossings as an example: the general steps are: (1) glossy27(t) is hybridized with B73 once to obtain F1, and then the F1 is self-pollinated once to obtain F2, and the F2 is planted and mutant plants are selected from them; (2) the selected mutant plants are backcrossed with B73 to obtain F1, and then the F1 is self-pollinated once to obtain F2, and the F2 is planted and mutant plants are selected from them; (3) the selected mutant plants are backcrossed with B73 again; ..., and this cycle is repeated multiple times, each cycle requires two generations. To obtain a homozygous mutant gene-introduced line after five backcrossings, a total of 12 generations of breeding are required.
[0038] If the molecular marker YMInDel130 linked to the curled leaf trait of the present invention is used to obtain a homozygous curled mutant introgression line after five backcrosses, the specific method is as follows: (1) glossy27(t) (molecular marker is type B, refer to Figure 1) and B73 (A type) once to obtain F1 (H type); (2) F1 is backcrossed with B73 to obtain BC1F1; (3) BC1F1 is planted, and the H type plant is backcrossed with B73 to obtain BC2F1 through molecular marker detection; (4) BC2F1 is planted, and the H type plant is backcrossed with B73 through molecular marker detection to obtain BC3F1; (5) BC3F1 is planted, and the H type plant is backcrossed with B73 through molecular marker detection to obtain BC4F1; (6) BC4F1 is planted, and the H type plant is backcrossed with B73 through molecular marker detection to obtain BC5F1; (7) BC5F1 is planted, and the H type plant is self-pollinated through molecular marker detection to obtain BC5F2; (8) The BC5F2 seeds obtained are subjected to genotype detection, and the B type is the homozygous rolled leaf type BC5F2. In this way, a total of 7 generations of breeding are required.
[0039] It can be seen from this that using the molecular marker YMInDel130 of the present invention to backcross the mutant gene can save a lot of time and reduce the scale of planting and pollination in each generation.
[0040] Example 2: Transforming the leaf surface wax layer development mutant material into a normal material
[0041] Corn material B73 is a public excellent corn inbred line that has undergone genome sequencing. The wax layer on the leaf surface develops normally throughout the growth cycle and contains normal gene alleles. If glossy27(t) or other materials with leaf surface wax layer loss caused by the same gene mutation need to be transformed into normal materials, the following methods can be used:
[0042] The molecular marker YMInDel130 linked to the leaf curling trait of the present invention was used to obtain a homozygous leaf curling gene introduction line after five backcrosses. The specific method is as follows: (1) glossy27(t) (molecular marker is type B, refer to Figure 1 ) and B73 (A type) once to obtain F1 (H type); (2) F1 is backcrossed with glossy27 (t) to obtain BC1F1; (3) A small amount of endosperm of BC1F1 seeds is taken for testing, among which H type seeds are planted and backcrossed with glossy27 (t) to obtain BC2F1; (4) Then H type BC2F1 is planted and backcrossed with glossy27 (t) to obtain BC3F1; (5) H type BC3F1 is planted and backcrossed with glossy27 (t) to obtain BC4F1; (6) H type BC4F1 is planted and backcrossed with glossy27 (t) to obtain BC5F1; (7) H type BC5F1 is planted and self-pollinated to obtain BC5F2; (8) The BC5F2 seeds obtained are tested for genotype, among which type A is the homozygous rolled leaf type BC5F2. In this way, a total of 7 generations of breeding are required.
[0043] It can be seen from this that using the molecular marker YMInDel130 of the present invention to replace the mutant gene with the normal type can save time and reduce the planting and pollination scale of each generation.
[0044] Example 3 Early screening prediction of normal and missing leaf epidermal wax layer materials in a population
[0045] In actual breeding work, if a leaf epidermal wax layer missing mutant appears in a certain two-ring line or similar selection line population, since it is a recessive mutation, many normal materials in the same population may also contain the mutant allele, and abnormal development of the leaf epidermal wax layer at the seedling stage may occur in its self-pollinated offspring. Therefore, for the population with the same gene mutation as glossy27(t) that causes the wax layer missing on the leaf surface at the seedling stage, the molecular marker YMInDel130 can be used to detect all the early-generation normal-type plants in the same population. If the H type appears, it means that the line has a heterozygous recessive mutation. Its self-pollinated offspring can be tested at the seed stage. Excluding the H type, only type A seeds are selected for planting, and the offspring bred by the line are all normal. If type B seeds are selected for planting, the offspring bred by the line are all mutants.
[0046] It can be seen that the use of the molecular marker YMInDel130 of the present invention to screen mutant and normal genes can quickly improve the purity of related leaf traits of offspring of a certain strain, saving time and manpower and material costs.
[0047] (II) Specific molecular marker analysis methods:
[0048] (1) Use the CTAB method or DNA extraction kit commonly used for plant genomic DNA to extract leaf genomic DNA from the corresponding parent and offspring populations.
[0049] (2) Components of the PCR reaction system used:
[0050]
[0051] (3) The PCR reaction program used is:
[0052]
[0053] (4) The amplified products were separated by 7% PAGE gel electrophoresis, and silver staining was used to visualize the amplified DNA bands.
[0054] The present invention develops a molecular marker YMInDel130 linked to a regulatory gene of a corn leaf epidermal wax layer development mutant glossy27(t), providing a theoretical basis and application guidance for further research on gene function and molecular marker-assisted breeding. By associating with the marker, the development of the wax layer of corn and its offspring at the seedling stage can be quickly determined at any growth stage of seeds or plants, shortening the years and planting scale of gene introduction and material screening, saving time and manpower and material costs, and thus realizing rapid assisted breeding and germplasm population improvement.
[0055] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A molecular marker linked to the gene for the development of the wax layer in the corn leaf epidermis, characterized in that: Obtained by PCR amplification using the following molecular marker primer pairs: Molecular marker name: YMInDel130; Left primer sequence: TGCCCAGAATGGTTTGGGAT; Right primer sequence: TGGGTCTGGTTATGGTAGTCTG.
2. The use of a molecular marker linked to a gene for development of a waxy layer in corn leaf epidermis according to claim 1, characterized in that: Used to identify the wax layer on the leaves of hybrid or self-pollinated corn plants at the seedling stage.
3. The use of a molecular marker linked to a gene for development of a waxy layer in corn leaf epidermis according to claim 1, characterized in that: Used for the improvement and breeding of corn varieties.
4. A method for identifying molecular markers linked to genes for the development of the wax layer in corn leaf epidermis, characterized in that: The genomic DNA of the corn seeds or plants to be tested is amplified using the primer pair of claim 1. If a 146 bp fragment can be amplified using the molecular marker YMInDel130, it indicates that the corn material or variety to be tested contains a mutant of the gene. If it cannot be amplified or a fragment of another length is amplified, it indicates that the mutant is not contained.
5. The molecular marker linked to the maize leaf epidermal wax layer development gene according to claim 1, characterized in that: The process of screening molecular marker primers is as follows: (1) Identification of agronomic traits of materials: After collecting materials with abnormal development of the wax layer on the leaf epidermis at the seedling stage, several generations of self-pollination and agronomic trait identification were first carried out. The growth period was about 125 days, the plant height was about 1.9 m, and there were 15-16 leaves. From the time the first leaf grew out of the seedling, the leaf surface was smooth, highly reflective, and easy to adhere to water droplets. Electron microscopic observation results showed that the wax layer on the leaf epidermis developed slowly during this period, the accumulated wax layer was thin, and the cell structure of other tissues was intact. From the trumpet stage to the jointing stage, the epidermis morphology of the grown leaves and new leaves gradually returned to normal as the plant grew. (2) Gene localization and molecular marker development: hybridize it with non-curly leaf common corn materials, then self-pollinate and construct F 2:3 The F1 group had no curled leaves, while the F2 group had segregation. The ratio of light leaves to normal leaves was 1:
3. 2:3 The light leaf group and the normal group were mixed into two pools of DNA. The DNA was sequenced with the two parents using SNP chips. Continuous differences were found in the 165-240Mb region of chromosome 4. Then, based on the sequence information of materials such as maize genome database B73, InDel markers were developed in this region. 2:3 The target interval was further shortened to 206211146bp-212485791bp (206.2Mb-212.5Mb) for family individual plants, and a molecular marker YMInDel130 linked to it was developed. (3) Comparison of homology with reported genes of the same type: The leaf epidermal wax layer development genes gl3 and gl4 were reported to be located on chromosome 4, with physical positions of 185831259 bp and 171920871 bp (171.9 Mb-185.9 Mb), respectively, which are more than 14 Mb away from the positioning interval of this study (206.2 Mb-212.5 Mb). At the same time, two molecular markers were designed near the positions of the fragments where genes gl3 and gl4 are located (173 Mb and 186 Mb), and the F2 plants of the study population were tested. The linkage between their phenotypes and molecular markers was much lower than that of marker YMInDel130, indicating that the interval where the mutated gene is located does not overlap with gl3 and gl4. (4) Naming of the new mutation: The located gene is a new recessive gene that regulates the development of the wax layer in the leaf epidermis of maize seedlings. Based on the names of similar mutants or genes recorded in the maize genome database, the mutant was preliminarily named glossy27(t).