Fl4InDel1 molecular marker related to flour4 genotype of corn and application thereof

Abstract

The invention relates to a fl4InDel1 molecular marker related to a corn flour4 genotype and application of the fl4InDel1 molecular marker related to the corn flour4 genotype, the 6574138: 6575047bp position of a corn chromosome 4 serves as the fl4InDel1 molecular marker related to the corn flour4 genotype, and a specific primer group of the fl4InDel1 molecular marker can be used for performing fl4 genotype identification on corn DNA in any period and any tissue. And detecting whether the fl4 genotype exists in each single plant of the crossbreeding filial generation or not and a heterozygous or homozygous state according to the size of a PCR amplification fragment. The fl4InDel1 molecular marker and the specific primer pair provided by the invention can be used for corn breeding and breeding of corn varieties with high amino acid content.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a fl4InDel1 molecular marker related to a maize floury4 genotype and an application thereof. Background Art

[0002] Corn (Zea mays) is an important crop for food, feed and industrial raw materials. Its scientific name is Zea mays L. Its English name is maize or corn. It has many Chinese names, such as maize, corn, etc. Corn is an annual monoecious plant that originated in Mexico about 8,700 years ago.

[0003] In order to improve the quality and nutritional value of corn, more and more domestic and foreign researchers have begun to use biological methods to transform the quality of corn since the last century. Quality Protein Maize (QPM) was born under such circumstances. Its basic principle is: using some mutants of corn kernels as materials, transforming them with the help of genetic research methods to improve their nutritional value. In corn, there is a type of mutant related to protein quality, called Opaque or Floury mutants. In terms of phenotype, the starch granules and protein bodies, the main storage organelles in the endosperm cells of this type of mutants, are not tightly packed, resulting in a loose endosperm structure of the kernels, which is easier to crush. Therefore, compared with the transparent kernels of the wild type, they are easier to digest and have good palatability, making them more suitable for the processing of high-quality feed. In terms of biochemistry, this type of mutant can significantly increase the content of essential amino acids such as lysine in corn kernels, thereby improving the nutritional value of corn. The most famous of these is the Opaque2 (o2) mutant. Many countries in the world have used the opaque 2 gene (o2) to improve the research and breeding of corn protein, and have achieved remarkable results. The o2 gene is a recessive mutant gene that was first discovered by Mertz et al. in 1964. It can reduce the proportion of alcohol-soluble proteins in endosperm proteins and significantly increase the lysine content in endosperm proteins of corn kernels. The o2 mutant gene increases the lysine content in corn endosperm by inhibiting the synthesis of zein alcohol-soluble proteins and increasing the levels of lysine-rich proteins such as glutenin.

[0004] The floury4 (fl4) gene is caused by the mutant z1A19-kDα-zein. Its signal peptide cleavage defect leads to deformed and aggregated protein bodies, causing the opaque endosperm phenotype. Genetic analysis of the fl4 mutant showed that fl4 is a recessive mutation controlled by a single gene, which can cause the opaque trait of corn kernels. Figure 1 .

[0005] Biochemical analysis of the fl4 mutant showed that compared with the wild-type kernel W22, the total protein content in the fl4 mutant kernel did not change significantly, the alcohol-soluble protein content decreased significantly, and the non-alcohol-soluble protein content increased significantly, see Figure 2 And some important amino acids have increased significantly, such as lysine increased by 45.7%, aspartic acid increased by 37.2%, glycine increased by 12.5%, arginine increased by 9.8%, see Figure 3 (Wang G et al., Identification and Characterization of Maize Floury4 as a Novel Semidominant Opaque Mutant That Disrupts Protein Body Assembly. Plant Physiol. 2014). Lysine is an essential amino acid for humans.

[0006] The advantage of the fl4 gene is that it can significantly improve the quality of corn without changing the corn yield. However, the fl4 gene has not yet been well utilized through hybrid breeding, mainly because fl4 is caused by a recessive gene mutation and hybrid breeding requires a long time.

[0007] DNA molecular marker-assisted breeding is a new breeding technology. It is a modern breeding technology that indirectly selects genes that control target traits by using DNA molecular markers that are closely linked to target trait genes. The transfer of target genes by this technology can not only make accurate and stable selections in the early stage, but also overcome the problem of difficulty in identifying recessive genes in the reuse of them, thereby accelerating the breeding process and improving breeding efficiency. Compared with conventional breeding, this technology can increase breeding efficiency by 2-3 times.

[0008] The key to DNA molecular marker-assisted breeding technology is: (1) The molecular marker obtained should be a co-dominant primer set that can distinguish the hybrid parents (homozygous fl4 type and homozygous wild type) and their hybrid offspring (F1 generation) during the breeding process; (2) The linkage between the obtained co-dominant molecular marker (primer set) and the gene controlling the target trait. The tighter the linkage, the lower the probability of misselection in its offspring. If the marker is derived from the gene controlling the target trait, the probability of misselection in its offspring using the molecular marker is zero; (3) The marker can distinguish mutants from all major breeding parents in the country.

[0009] In previous studies, no co-dominant DNA marker (primer set) located on the fl4 gene and completely linked to it was obtained, so it was impossible to perform DNA marker-assisted selection for the target traits controlled by this gene. At the same time, no analytical markers that can distinguish mutants from all major breeding parents in China were obtained in the past. Therefore, the acquisition and identification of this marker is the basis for DNA marker-assisted breeding of the fl4 gene that controls the high-quality agronomic traits of corn kernels. Summary of the invention

[0010] The purpose of the present invention is to provide a fl4InDel1 molecular marker related to corn floury4 genotype and its application in order to reduce the probability of misselection and distinguish the homozygous fl4 type and the homozygous wild type and their hybrid progeny.

[0011] The purpose of the present invention can be achieved by the following technical solutions:

[0012] One of the technical solutions of the present invention is to provide a use located at 6574138:6575047bp of chromosome 4 of the corn genome as a fl4InDel1 molecular marker related to the floury4 genotype of corn.

[0013] The second technical solution of the present invention is to provide a primer pair for amplifying the fl4InDel1 molecular marker associated with the floury4 genotype of corn, including a forward primer fl4InDel1-F and a reverse primer fl4InDel1-R, whose nucleotide sequences are shown in SEQ ID NO.1 and 2 respectively.

[0014] fl4InDel1-F (SEQ ID NO. 1): AGTTCATCATCAATGTTGGCTGG;

[0015] fl4InDel1-R (SEQ ID NO. 2): CTTAATCTCACTCGCGGTTGC.

[0016] The third technical solution of the present invention is to provide a kit for detecting the floury4 genotype of corn, comprising the primer pair as described in the second technical solution.

[0017] The kit as described in the third technical solution above is applied to the improvement of corn germplasm resources and / or to corn genetic breeding.

[0018] The fourth technical solution of the present invention is to provide an application of the kit as described in the third technical solution in breeding floury4 gene homozygous mutant corn.

[0019] In some specific embodiments, the method for breeding floury4 gene homozygous mutant corn comprises the following steps:

[0020] The genomic DNA of the corn to be tested is extracted, and a PCR amplification reaction is carried out using primers fl4InDel1-F and fl4InDel1-R. The amplification product is detected by electrophoresis. If the amplification product shows a characteristic band of 1076 bp in size, the corn to be tested is a homozygous mutation of the floury4 gene; if the amplification product shows a characteristic band of 910 bp in size, the corn to be tested is a homozygous mutation of the floury4 gene; if the amplification product shows two bands of 1076 bp and 910 bp, the corn to be tested is a heterozygous mutation of the floury4 gene.

[0021] The fifth technical solution of the present invention is to provide a kit for identifying corn phenotypes, comprising the primer pair as described in the second technical solution.

[0022] The kit as described in the fifth technical solution above is applied to the improvement of corn germplasm resources and / or to corn genetic breeding.

[0023] The sixth technical solution of the present invention is to provide an application of the kit as described in the fifth technical solution above in breeding opaque phenotype corn.

[0024] In some embodiments, the method for breeding opaque phenotype corn comprises the following steps:

[0025] The genomic DNA of the corn to be tested was extracted, and a PCR amplification reaction was carried out using primers fl4InDel1-F and fl4InDel1-R. The amplified product was detected by electrophoresis. If the amplified product showed a characteristic band of 1076 bp in size, the corn to be tested showed an opaque phenotype; if the amplified product showed a characteristic band of 910 bp in size, the corn to be tested showed a transparent phenotype; if the amplified product showed two bands of 1076 bp and 910 bp, the corn to be tested showed a translucent phenotype.

[0026] The seventh technical solution of the present invention is to provide a kit for identifying or assisting in identifying the amino acid content in corn, comprising the primer pair as described in the second technical solution above.

[0027] The kit as described in the seventh technical solution above is used in the improvement of corn germplasm resources and / or in corn genetic breeding.

[0028] The eighth technical solution of the present invention is to provide an application of the kit as described in the seventh technical solution in breeding corn with high amino acid content, wherein the amino acids include lysine, aspartic acid, glycine, and arginine.

[0029] In the above-mentioned application or kit, the primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected without a marker (e.g., directly reading the sequence).

[0030] The above-mentioned kit can also be a combination product including reagents, instruments and analysis software, such as a product consisting of PCR primers, PARMS master mix reagents, an ELISA reader and online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), a combination product consisting of PCR primers, PARMS master mix reagents, online software SNP decoder and a fluorescence quantitative PCR instrument. The kit can also include the above-mentioned substance for detecting the polymorphism or genotype of the fl4InDel1 site in the corn genome.

[0031] In the above application or kit, the amino acid content in the corn variety with high amino acid content is relative to the hybrid parent corn or wild-type corn. If the amino acid content of the two hybrid parent corns is the same, the amino acid content of the corn variety with high amino acid content can be equal to or higher than the amino acid content of the hybrid parent corn; if the amino acid content of the two hybrid parent corns is different, the amino acid content of the corn variety with high amino acid content can be equal to or higher than the hybrid parent corn with higher amino acid content in the two hybrid parent corns. The situation is similar when compared with the amino acid content in wild-type corn.

[0032] In the embodiment of the present invention, through the genetic variation analysis of the fl4 gene in the F2 population established by the maize fl4 homozygous mutant and the W22 inbred line, it was found that a co-dominant molecular marker was strictly linked to the fl4 genotype in the maize genome, located at 6574138:6575047bp of maize chromosome 4, named fl4InDel1, and a specific primer pair for the fl4InDel1 molecular marker was designed. The fl4 genotype of maize DNA in any period and any tissue can be identified by using this specific primer set, and the presence or absence of the fl4 genotype and the heterozygous or homozygous state in each individual plant of the hybrid breeding generation can be detected according to the size of the PCR amplified fragment. The detection method has high accuracy and simple operation, and provides an important technical means for using DNA molecular markers of the fl4 genotype to assist breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The fl4 homozygous mutant (fl4 / fl4) and wild-type grains (fl4 / WT or WT / WT) are shown on light boxes and cross-sections.

[0034] Figure 2 This is a graph showing the changes in total protein, alcohol-soluble protein, and non-alcohol-soluble protein in the grains of the fl4 homozygous mutant compared with the wild type.

[0035] Figure 3 This is a graph showing the changes in amino acid content in the grains of the fl4 homozygous mutant compared with the wild type.

[0036] Figure 4 It is the F2 population construction route used for fl4 gene cloning.

[0037] Figure 5 This is the segregation of the molecular marker fl4InDel1 in the W22 background F2 population. fl4 / fl4 is a homozygous mutant; fl4 / WT is a heterozygous; WT / WT is a homozygous wild type.

[0038] Figure 6 It is a schematic diagram of the position of the molecular marker fl4InDel1 on the short arm of maize chromosome 4 in the present invention, wherein CEN4 represents the centromere of chromosome 4, and TEL represents the telomere.

[0039] Figure 7 It is the polymorphism of molecular marker fl4InDel1 among different inbred lines.

[0040] Figure 8 It is the polymorphism of the molecular marker fl4InDel1 between the wild-type inbred line W22 and the T5 type hybrid progeny. DETAILED DESCRIPTION

[0041] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.

[0042] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art, such as the conditions described in Molecular Cloning: A Laboratory Manual, 3rd ed. or Plant Molecular Biology-A Laboratory Manual (Melody S. Clark, Springer-verlag Berlin Heidelberg, 1997), or the conditions recommended by the manufacturer.

[0043] fl4 / fl4, W22, B73, PBPA germplasms can be obtained from the Maize Stock Center in the United States. The Maize Stock Center in the United States is a non-profit service organization that provides corn genetic resources in its germplasm bank to corn researchers around the world free of charge.

[0044] The three inbred lines Chang 7-2, W64A, and Zheng 58 were provided free of charge by Professor Tang Jihua of Henan Agricultural University (Zhengzhou National Maize Improvement Center) for scientific research on maize.

[0045] The Hengbai 522 inbred line and T5 inbred line were provided free of charge by Professor Song Rentao of China Agricultural University (National Maize Improvement Center) for scientific research on maize.

[0046] Example 1: Acquisition of co-dominant molecular markers

[0047] The present invention has known through classical genetic positioning that the fl4 gene is located on the short arm of maize chromosome 4. The F2 population established using the fl4 homozygous mutant and the W22 inbred line (see Figure 4). By extracting genomic DNA from homozygous mutants, wild types, and individual plants in the F2 population for analysis, the fl4 gene was located on the telomeric side of the simple sequence repeat marker umc2280 on the short arm of chromosome 4. In the mapping population of 144 individuals, fl4 was located between the simple sequence repeat markers umc1758 and umc1288. Subsequently, molecular markers such as insertion-deletion InDel2 and single nucleotide polymorphism SNP1 were developed, and the fl4 gene was finally located between SNP1 and InDel2. This region contains the entire 19-kD α-zein z1A-1 gene family cluster (Wang G et al., 2014). However, since SNP1 and InDel2 are located outside the 19-kD α-zein z1A-1 gene family, they are poorly linked to the Fl4 genotype, and the SNP molecular marker is a single nucleotide variation, there are still certain difficulties in practical use.

[0048] Therefore, the present invention designs molecular marker primers based on the known 19-kD α-zein z1A-1 gene family sequence between SNP1 and InDel2. Through sequencing and sequence alignment, the sequence difference between the homozygous mutant and the homozygous wild-type parent is obtained, and the sequence obtained by sequencing is used to develop a molecular marker strictly linked to the fl4 genotype, and finally a co-dominant molecular marker fl4InDel1 that can distinguish hybrid parents (homozygous mutant fl4 type and homozygous wild-type W22 type) and their hybrid offspring (F1 generation) in the breeding process is obtained. The molecular marker fl4InDel1 is located at chr4:6574138:6575047, a total of 910bp, in the intervening sequence of the gene GRMZM2G404459 (19-kDα-zein protein z1A1_2) and the gene GRMZM2G059620 (19-kDα-zein protein z1A1_3) in the 19-kDα-zein z1A-1 gene family. Compared with the homozygous wild type, the fl4 homozygous mutant has a 166bp insertion at this site. The PCR reaction can be used to conveniently and intuitively determine the size of the band to distinguish the fl4 mutant type from the wild type.

[0049] This embodiment provides a PCR reaction system and a PCR reaction process, which are as follows: PCR reaction system

[0050]

[0051] PCR reaction process

[0052]

[0053] The specific primers and base sequences for amplifying DNA fragments are:

[0054] SEQ ID NO.1 (forward primer fl4InDel1-F, 5′ to 3′):

[0055] AGTTCATTCATCAATGTTGGCTGG;

[0056] SEQ ID NO.2 (reverse primer fl4InDel1-R, 5′ to 3′):

[0057] CTTAATCTCTCCCGGTTGC.

[0058] Example 2: Determination of linkage relationship between molecular marker fl4InDel1 and fl4 genotype

[0059] The DNA of the grains in the F2 population obtained by hybridizing fl4 / fl4 with the W22 wild type (WT / WT) was extracted for analysis of the linkage relationship between the molecular marker fl4InDel1 and the fl4 genotype. The genotypes of the wild type phenotype include (homozygous: WT / WT and hybrid: fl4 / WT), and the genotype of the fl4 homozygous mutant is fl4 / fl4. These samples were used to analyze the genetic linkage relationship between the molecular marker fl4InDel1 and the fl4 genotype. The primer pair of the fl4InDel1 molecular marker was used for PCR amplification. The results showed that the size of the fl4 / fl4 amplified fragment was about 1076bp, the size of the WT / WT amplified fragment was about 910bp, and the fl4 / WT amplified fragment had two bands of 910bp and 1076bp (see Figure 5 ).

[0060] The analysis results showed that the fl4InDel1 molecular marker was linked to the fl4 genotype, and the fl4 genotype in corn offspring could be determined by detecting the fl4InDel1 molecular marker.

[0061] The relationship between the fl4InDel1 molecular marker and the physical location of the fl4 gene on the chromosome can be found in Figure 6 .

[0062] Example 3: Identification of polymorphism of molecular marker fl4InDel1 between different parents

[0063] The genomic DNA of eight inbred lines widely used in breeding, namely W22, B73, Chang 7-2, Zheng 58, W64A, PBPA, Hengbai 522, and T5, were extracted, and the polymorphism among different varieties was analyzed by PCR reaction. It is known that the inbred lines W22, B73, Chang 7-2, Zheng 58, W64A, PBPA, and Hengbai 522 are all transparent phenotypes (non-floury endosperm phenotype), and the T5 type is an opaque phenotype (floury endosperm phenotype).

[0064] The molecular marker fl4InDel1 of the present invention can be used to distinguish floury4 from W22, B73, Chang7-2, Zheng58, W64A, PBPA, Hengbai522 inbred lines ( Figure 7 ). This result proves that the molecular marker fl4InDel1 can accurately detect the presence of floury4 genotype in W22, B73, Chang 7-2, Zheng 58, W64A, PBPA, and Hengbai 522 background populations, and the false selection rate during assisted selection is 1.2×10 -5 , which can meet the selection requirements.

[0065] In this embodiment, the molecular marker fl4InDel1 of the present invention can be used to distinguish the T5 type wild-type inbred line from other wild-type inbred lines W22, B73, Chang7-2, Zheng58, W64A, PBPA, Hengbai522 ( Figure 7 ), and the polymorphism between the wild-type inbred line W22 and the T5 type hybrid progeny ( Figure 8 ).

[0066] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A use located at 6574138:6575047bp of chromosome 4 of the maize genome, characterized in that: As a fl4InDel1 molecular marker associated with maize floury4 genotype.

2. A primer pair for amplifying the fl4InDel1 molecular marker associated with the floury4 genotype of maize, characterized in that: It includes a forward primer fl4InDel1-F and a reverse primer fl4InDel1-R, and the nucleotide sequences thereof are shown in SEQ ID NOs. 1 and 2, respectively.

3. A kit for detecting floury4 genotype of corn, characterized in that: Comprising the primer pair as claimed in claim 2.

4. Use of the kit as claimed in claim 3 in breeding floury4 gene homozygous mutant corn.

5. The use according to claim 4, characterized in that: The method for breeding floury4 gene homozygous mutant corn comprises the following steps: The genomic DNA of the corn to be tested is extracted, and a PCR amplification reaction is carried out using primers fl4InDel1-F and fl4InDel1-R. The amplification product is detected by electrophoresis. If the amplification product shows a characteristic band of 1076 bp in size, the corn to be tested is a homozygous mutation of the floury4 gene; if the amplification product shows a characteristic band of 910 bp in size, the corn to be tested is a homozygous mutation of the floury4 gene; if the amplification product shows two bands of 1076 bp and 910 bp, the corn to be tested is a heterozygous mutation of the floury4 gene.

6. A kit for identifying corn phenotypes, characterized in that: Comprising the primer pair as claimed in claim 2.

7. Use of the kit as claimed in claim 6 in breeding opaque phenotype corn.

8. The use according to claim 7, characterized in that: The method for breeding opaque phenotype corn comprises the following steps: The genomic DNA of the corn to be tested was extracted, and a PCR amplification reaction was carried out using primers fl4InDel1-F and fl4InDel1-R. The amplified product was detected by electrophoresis. If the amplified product showed a characteristic band of 1076 bp in size, the corn to be tested showed an opaque phenotype; if the amplified product showed a characteristic band of 910 bp in size, the corn to be tested showed a transparent phenotype; if the amplified product showed two bands of 1076 bp and 910 bp, the corn to be tested showed a translucent phenotype.

9. Use of the kit as claimed in claim 6 in breeding high amino acid phenotype corn.

10. The use according to claim 9, characterized in that: The amino acids include lysine, aspartic acid, glycine and arginine.

Images