COVID-19 nucleic acid detection primer group and COVID-19 isothermal amplification nucleic acid detection kit

Abstract

The invention discloses a COVID-19 nucleic acid detection primer group and a COVID-19 isothermal amplification nucleic acid detection kit, and relates to the technical field of virus nucleic acid detection methods. The invention provides a detection kit of COVID-19, the detection kit is constructed by using the nucleic acid detection primer group of the COVID-19, nucleic acid extraction is not needed, the COVID-19 virus can be accurately and rapidly detected within one hour under an isothermal condition through a specific chromogenic reaction, the infection condition of the COVID-19 virus can be conveniently and intuitively screened, and the detection kit has the advantages that the detection kit is simple in structure and convenient to operate, and the detection kit has a good application prospect. The method has wide prospects and great social benefits.

Description

Technical Field

[0001] The present invention relates to the technical field of viral nucleic acid detection methods, and in particular to a COVID-19 nucleic acid detection primer set and a COVID-19 isothermal amplification nucleic acid detection kit. Background Art

[0002] The 2019 novel coronavirus is a new strain of coronavirus that has never been found in the human body before. It was named COVID-19 by the World Health Organization (WHO) on February 11, 2020.

[0003] Real-time fluorescence RT-PCR detection of COVID-19 viral nucleic acid has become the standard diagnostic method for COVID-19, but it has limitations and a high false negative rate. Therefore, a kit that can accurately and visually identify a large number of infected people and asymptomatic carriers without nucleic acid extraction, shortening the detection time, and preventing secondary contamination can achieve rapid screening of a large number of COVID-19 infected people and asymptomatic carriers, which is of great significance to preventing the spread of the virus and ensuring that patients receive timely treatment. Summary of the invention

[0004] In order to improve the accuracy and rapid screening of COVID-19 virus, the first purpose of the present invention is to provide a primer set for detecting the N gene nucleic acid of COVID-19 virus to achieve the detection of COVID-19.

[0005] The second purpose of the present invention is to provide a COVID-19 detection kit, which does not require nucleic acid extraction from nasopharyngeal swab samples and uses an N gene nucleic acid detection primer set to achieve visual COVID-19 rapid detection.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions.

[0007] The four COVID-19 virus detection primer sets provided by the present invention have a total length of 29903bp according to the currently published sequence of the new coronavirus (GenBank: MN908947.3). The specific sequence is designed by screening out the loop-mediated isothermal amplification primer after blasting its gene sequence, and the Primer Explorer software is used to design the COVID-19 virus N-terminal specific primer set. The reverse transcription isothermal amplification technology is used to amplify the specific region of the target gene, so as to achieve rapid detection at the molecular level, have low requirements on the instrument, and the detection results can be observed by naked eyes. The method is suitable for rapid detection of COVID-19 virus on-site and at the grassroots level, and is convenient for screening COVID-19 virus infected persons.

[0008] In a first aspect, the present invention provides a COVID-19 nucleic acid detection primer set, comprising a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1;

[0009] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1 and LB-1 are as follows:

[0010] F3-1:TGGACCCCAAAATCAGCG;

[0011] B3-1: GGAACGCCTTGTCCTCGA;

[0012] FIP-1: CCACTGCGTTCTCCATTCTGGT-AAATGCACCCCGCATTACG;

[0013] BIP-1: GCGATCAAAACAACGTCGGCC-TCCTTGCCATGTTGAGTGAG;

[0014] LF-1:CCAGTTGAATCTGAGGGTCCAC;

[0015] LB-1: TGCGTCTTGGTTCACCGC.

[0016] In a second aspect, the present invention provides a COVID-19 nucleic acid detection primer set, comprising a pair of outer primers F3-2 and B3-2, a pair of inner primers FIP-2 and BIP-2, and a pair of loop primers LF-2 and LB-2; the nucleotide sequences of F3-2, B3-2, FIP-2, BIP-2, LF-2, and LB-2 are as follows:

[0017] F3-2:TGGACCCCAAAATCAGCG;

[0018] B3-2: GCCTTGTCCTCGAGGGAAT;

[0019] FIP-2: CCACTGCGTTCTCCATTCTGGT-AATGCACCCCGCATTACG;

[0020] BIP-2: CAACGTCGGCCCCAAGGTTT-GGTCTTCCTTGCCATGTTGA;

[0021] LF-2:ACTGCCAGTTGAATCTGAGGG;

[0022] LB-2: GCGTCTTGGTTCACCGCT.

[0023] In a third aspect, the present invention provides a COVID-19 nucleic acid detection primer set, comprising a pair of external primers F3-3 and

[0024] B3-3, a pair of inner primers FIP-3 and BIP-3, and a pair of loop primers LF-3 and LB-3;

[0025] The nucleotide sequences of F3-3, B3-3, FIP-3, BIP-3, LF-3 and LB-3 are as follows:

[0026] F3-3: CACCCGCAATCCTGCTAAC;

[0027] B3-3: CCAGCCATTCTAGCAGGAGA;

[0028] FIP-3: TGCTCCCTTCTGCGTAGAAGC-GCTGCAATCGTGCTACAACT;

[0029] BIP-3: GGCGGCAGTCAAGCCTCTTC-CCTACTGCTGCCTGGAGTT;

[0030] LF-3: TGGCAATGTTGTCCTTGAGG;

[0031] LB-3:ATCACGTAGTCGCAACAGTTC.

[0032] In a fourth aspect, the present invention provides a COVID-19 nucleic acid detection primer set, comprising a pair of outer primers F3-4 and B3-4, a pair of inner primers FIP-4 and BIP-4, and a pair of loop primers LF-4 and LB-4;

[0033] The nucleotide sequences of F3-4, B3-4, FIP-4, BIP-4, LF-4 and LB-4 are as follows:

[0034] F3-4: AGATCACATTGGCACCCG;

[0035] B3-4: CCATTGCCAGCCATTCTAGC;

[0036] FIP-4: TGCTCCCTTCTGCGTAGAAGC-CAATGCTGCAATCGTGCTAC;

[0037] BIP-4: GCGGCAGTCAAGCCTCTTCTC-CCTACTGCTGCCTGGAGT;

[0038] LF-4: TTGGCAATGTTGTTCCCTTGAGG;

[0039] LB-4: CACGTAGTCGCAACAGTTCAA.

[0040] In a fifth aspect, the present invention provides a COVID-19 isothermal amplification nucleic acid detection kit, comprising a reaction premix A, a reaction premix B, a detection tube, a positive quality control, and a negative control, mainly comprising the following substances: 1) Bst DNA large fragment polymerase; 2) AMV reverse transcriptase; 3) 10X reaction buffer; 4) the COVID-19 nucleic acid detection primer set described in any one of the first to fourth aspects; 5) dNTPs; 6) magnesium sulfate; 7) betaine; 8) formamide; 9) DEPC water.

[0041] A further technical solution is that the reaction premix A includes 2-10U of Bst DNA large fragment polymerase and 2-10U of AMV reverse transcriptase;

[0042] The reaction premix B includes 10X reaction buffer, the COVID-19 nucleic acid detection primer set described in any one of the first to fourth aspects, dNTPs 1-5mM, magnesium sulfate 1-12mM, betaine 0.2-1.2mM, formamide and DEPC water.

[0043] A further technical solution is that the formamide is a formamide solution with a volume fraction of less than 50%.

[0044] Preferably, the formamide is a formamide solution with a volume fraction of 2-30%.

[0045] A further technical solution is that the positive quality control is a COVID-19 genome fragment; and the negative control is DEPC water.

[0046] A further technical solution is that the concentration ratio of the COVID-19 nucleic acid detection primer set in the reaction premix B is as follows: the molar ratio of the outer primer, the inner primer, and the loop primer is 1:4:2.

[0047] The method of using the COVID-19 isothermal amplification nucleic acid detection kit described above includes loop-mediated isothermal amplification and colorimetric result determination:

[0048] (1) The throat swab sample or nucleic acid fragment to be tested can be directly tested for the virus in the throat swab sample without the need for nucleic acid extraction.

[0049] (2) Reaction system and conditions: The reaction system in the test tube contains 3uL of reaction premix A and 17uL of reaction premix B. Positive and negative controls are set up at the same time. The solution in the test tube is mixed and centrifuged, reacted at 50-70°C for 30-60 min, and the reaction is interrupted at 85°C.

[0050] (3) Visualization of test results:

[0051] The test result is judged according to the color of the reaction system in the test tube. The amplification product reaction tube is placed in the colorimetric card. If the test result is blue, the test result is judged to be positive, that is, the test sample contains COVID-19; if the test result is purple, the test result is judged to be negative, that is, the test sample does not contain COVID-19.

[0052] The schematic diagram of the COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention for detecting the detection results of nasopharyngeal swab samples is as follows: Figure 1 As shown, P is a positive quality control, a COVID-19 genome fragment; N is a negative control, DEPC water; 1 and 4 are negative samples; 2 and 3 are positive samples, nasopharyngeal swab samples containing COVID-19 (confirmed). Observe the color of the reaction solution against a white paper background. The P positive quality control and 2 and 3 positive samples are blue, indicating that the sample contains COVID-19, and the 1 and 4 negative samples and N negative control are purple, indicating that the sample does not contain COVID-19.

[0053] The beneficial effects of the present invention are:

[0054] 1) According to the N-terminal gene sequence of COVID-19 published in GeneBank, the present invention designs a specific isothermal amplification primer set for specific detection of COVID-19. By constructing a pseudovirus containing the N-terminal gene of COVID-19 as a positive quality control, an accurate and rapid COVID-19 detection method is established. Experiments show that the kit of the present invention can specifically detect COVID-19 and does not cross-react with Epstein-Barr virus, HCMV virus, common respiratory viruses (such as influenza A / B virus, respiratory syncytial virus and human parainfluenza virus, etc.) and enterovirus;

[0055] 2) The COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention does not require nucleic acid extraction for throat swab samples, and can accurately and visually rapidly detect and screen COVID-19 virus infection within 1 hour under isothermal conditions of 65°C.

[0056] 3) The COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention is easy to judge the detection result, and the result can be judged by visually observing the color change of the reaction solution.

[0057] In summary, the COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention has a closed operation, which ensures the safety of operators and the environment. It can be used in hospitals, clinics and testing laboratories to quickly screen COVID-19 carriers. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying any creative work.

[0059] Figure 1 The detection results of COVID-19 by the COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention;

[0060] Figure 2 The specific detection results of COVID-19 by the COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention;

[0061] Figure 3 This is an electrophoresis diagram of the specific detection of COVID-19 by the COVID-19 isothermal amplification nucleic acid detection kit provided by the present invention. DETAILED DESCRIPTION

[0062] The technical solutions in the embodiments will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0063] Example 1

[0064] The embodiment of the present invention provides a COVID-19 nucleic acid detection primer set, including a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1;

[0065] The nucleotide sequences of F3-1, B3-1, FIP-1, BIP-1, LF-1 and LB-1 are as follows:

[0066] F3-1: 5'TGGACCCCAAAATCAGCG3';

[0067] B3-1: 5'GGAACGCCTTGTCCTCGA3';

[0068] FIP-1: 5'CCACTGCGTTCTCCATTCTGGT-AAATGCACCCCGCATTACG3';

[0069] BIP-1: 5'GCGATCAAAACAACGTCGGCC-TCCTTGCCATGTTGAGTGAG3';

[0070] LF-1: 5'CCAGTTGAATCTGAGGGTCCAC3';

[0071] LB-1: 5'TGCGTCTTGGTTCACCGC3'.

[0072] Example 2

[0073] The embodiment of the present invention provides a COVID-19 nucleic acid detection primer set, including a pair of outer primers F3-2 and B3-2, a pair of inner primers FIP-2 and BIP-2, and a pair of loop primers LF-2 and LB-2;

[0074] The nucleotide sequences of F3-2, B3-2, FIP-2, BIP-2, LF-2 and LB-2 are as follows:

[0075] F3-2: 5'TGGACCCCAAAATCAGCG3';

[0076] B3-2: 5'GCCTTGTCCTCGAGGGAAT3';

[0077] FIP-2: 5'CCACTGCGTTCTCCATTCTGGT-AATGCACCCCGCATTACG3';

[0078] BIP-2: 5'CAACGTCGGCCCCAAGGTTT-GGTCTTCCTTGCCATGTTGA3';

[0079] LF-2: 5'ACTGCCAGTTGAATCTGAGGG3';

[0080] LB-2: 5'GCGTCTTGGTTCACCGCT3'.

[0081] Example 3

[0082] The embodiment of the present invention provides a COVID-19 nucleic acid detection primer set, including a pair of outer primers F3-3 and B3-3, a pair of inner primers FIP-3 and BIP-3, and a pair of loop primers LF-3 and LB-3;

[0083] The nucleotide sequences of F3-3, B3-3, FIP-3, BIP-3, LF-3 and LB-3 are as follows:

[0084] F3-3: 5'CACCCGCAATCCTGCTAAC3';

[0085] B3-3: 5'CCAGCCATTCTAGCAGGAGA3';

[0086] FIP-3: 5'TGCTCCCTTCTGCGTAGAAGC-GCTGCAATCGTGCTACAACT3';

[0087] BIP-3: 5'GGCGGCAGTCAAGCCTCTTC-CCTACTGCTGCCTGGAGTT3';

[0088] LF-3: 5'TGGCAATGTTGTTCCTTGAGG3';

[0089] LB-3: 5'ATCACGTAGTCGCAACAGTTC3'.

[0090] Example 4

[0091] The embodiment of the present invention provides a COVID-19 nucleic acid detection primer set, including a pair of outer primers F3-4 and B3-4, a pair of inner primers FIP-4 and BIP-4, and a pair of loop primers LF-4 and LB-4;

[0092] The nucleotide sequences of F3-4, B3-4, FIP-4, BIP-4, LF-4 and LB-4 are as follows:

[0093] F3-4: 5'AGATCACATTGGCACCCG3';

[0094] B3-4: 5'CCATTGCCAGCCATTCTAGC3';

[0095] FIP-4: 5'TGCTCCCTTCTGCGTAGAAGC-CAATGCTGCAATCGTGCTAC3';

[0096] BIP-4: 5'GCGGCAGTCAAGCCTCTTCTC-CCTACTGCTGCCTGGAGT3';

[0097] LF-4: 5'TTGGCAATGTTGTTCCTTGAGG3';

[0098] LB-4: 5'CACGTAGTCGCAACAGTTCAA3'.

[0099] Example 5

[0100] The embodiment of the present invention provides a visualized COVID-19 isothermal amplification nucleic acid detection kit, which consists of a reaction premix A, a reaction premix B, a test tube, a positive quality control, and a negative control group. Specifically, using the kit of this embodiment, a 25μL reaction system contains the following substances: 3uL reaction premix A (BstDNA large fragment polymerase 2U, AMV reverse transcriptase 10U), 17uL reaction premix B (primer set 2.8μL, dNTP 1mM, betaine 1.2mM, magnesium sulfate 12mM, volume fraction 15% formamide, DEPC water supplemented to 17μL), and 5μL of sample to be tested.

[0101] The primer set is the COVID-19 nucleic acid detection primer set described in Example 1, including outer primers F3-1 and B3-1, inner primers FIP-1 and BIP-1, and loop primers LF-1 and LB-1; wherein the molar ratio of the outer primer, the inner primer, and the loop primer is 1:4:2, and the nucleotide sequence of the COVID-19 nucleic acid detection primer set is shown in SEQ ID No1-6.

[0102] It should be noted that, in other embodiments, the reaction premix B may use a formamide solution with a volume fraction of less than 50%, preferably a formamide solution with a volume fraction of less than 30%, and more preferably a formamide solution of 2-15%. In the embodiments of the present invention, the reaction premix B contains a formamide solution with a volume fraction of 15% as an example.

[0103] In other embodiments, the reaction premix A contains 2-10 U of BstDNA large fragment polymerase and 2-10 U of AMV reverse transcriptase. For example, the reaction premix A may contain 3 U, 5 U, 7 U, or 9 U of BstDNA large fragment polymerase; 4 U, 6 U, 8 U, or 10 U of AMV reverse transcriptase.

[0104] The reaction premix B contains a primer set, dNTPs 1-5mM, magnesium sulfate 1-12mM, and betaine 0.2-1.2mM. The reaction premix B may contain dNTPs 2.1mM, 3.1mM, or 4.1mM; betaine 0.4mM, 0.6mM, 0.8mM, 1.0mM; magnesium sulfate 3mM, 5mM, 7mM, 9mM, 11mM; and DEPC water is used to make up to 17μL.

[0105] Example 6

[0106] The embodiment of the present invention provides a visualized COVID-19 isothermal amplification nucleic acid detection kit. The difference between this embodiment and Example 5 is that the primer set in the reaction premix B is the COVID-19 nucleic acid detection primer set described in Example 2, including outer primers F3-2 and B3-2, inner primers FIP-2 and BIP-2, and loop primers LF-2 and LB-2; its nucleotide sequence is shown in SEQ ID No7-12.

[0107] Example 7

[0108] The embodiment of the present invention provides a visualized COVID-19 isothermal amplification nucleic acid detection kit. The difference between this embodiment and Example 5 is that the primer set in the reaction premix B is the COVID-19 nucleic acid detection primer set described in Example 3, including outer primers F3-3 and B3-3, inner primers FIP-3 and BIP-3, and loop primers LF-3 and LB-3; its nucleotide sequence is shown in SEQ ID No13-18.

[0109] Example 8

[0110] The embodiment of the present invention provides a visualized COVID-19 isothermal amplification nucleic acid detection kit. The difference between this embodiment and Example 5 is that the primer set in the reaction premix B is the COVID-19 nucleic acid detection primer set described in Example 4, including outer primers F3-4 and B3-4, inner primers FIP-4 and BIP-4, and loop primers LF-4 and LB-4; the nucleotide sequence thereof is shown in SEQ ID No 19-24.

[0111] Specificity Verification:

[0112] This experiment uses the visualized COVID-19 isothermal amplification nucleic acid detection kit provided in Example 5 for specificity verification.

[0113] (a) Samples to be tested: The samples to be tested are different types of pseudoviruses, including: COVID-19 virus (COVID-19 pseudovirus containing the target fragment), Epstein-Barr virus (Epstein-Barr virus clinical isolate), HCMV virus (HCMV AD-169 standard strain), inactivated influenza A virus H1N1 / H3N2; influenza B virus FluB; respiratory syncytial virus RSV; human parainfluenza virus type 1 / 2 / 3; adenovirus B / E genus; Mycoplasma pneumoniae; Chlamydia pneumoniae pathogens, enterovirus (inactivated enterovirus universal type EV-U); enterovirus 71 type EV-71; Coxsackievirus group A type 16 (CA16 pathogen). The samples to be tested can be directly tested without the need to extract nucleic acid.

[0114] (b) Reaction system and conditions (25 μL reaction system, same as Example 5):

[0115] 3uL reaction premix A, 17uL reaction premix B, 5μL pseudovirus, the reaction system was reacted at 65℃ for 60min and the reaction was interrupted at 85℃.

[0116] (c) Test result judgment:

[0117] If the test result is blue, the test result is positive, which means that the test sample contains COVID-19; if the test result is purple, the test result is negative, which means that the test sample does not contain COVID-19.

[0118] Specifically, after the reaction is completed, observe the color of the reaction solution in the detection tube. Figure 2 As shown, P positive quality control is COVID-19 N-terminal gene recombinant clone plasmid, N negative control is DEPC water; 1 EB virus; 2 HCMV virus; 3 inactivated influenza A virus H1N1 / H3N2; 4 influenza B virus FluB; 5 respiratory syncytial virus RSV; 6 human parainfluenza virus type 1 / 2 / 3; 7 adenovirus B / E genus; 8 Mycoplasma pneumoniae; 9 Chlamydia pneumoniae pathogen; 10 enterovirus (inactivated enterovirus universal type EV-U); 11 enterovirus 71 type EV-71; 12 Coxsackievirus group A type 16 (CA16 pathogen).

[0119] Depend on Figure 2 It can be seen that the reaction tube of the P positive quality control is blue, which indicates that the sample contains COVID-19, and the reaction tubes of the N negative sample and 1-12 are purple, which indicates that the sample does not contain COVID-19. The experimental results show that the kit of the present invention can specifically detect COVID-19 and does not cross-react with other viruses to be tested.

[0120] Perform gel electrophoresis imaging on the liquid in the test tube. The electrophoresis diagram is as follows: Figure 3 As shown, the electrophoresis results also show that the kit provided by the present invention can specifically detect COVID-19 without cross-reaction with other viruses.

[0121] It should be noted that the visualized COVID-19 isothermal amplification nucleic acid detection kit provided in Example 5 used in this experiment was specifically verified and replaced with the kit provided in any one of Examples 6-8. The results obtained were the same as above, and all were able to specifically detect COVID-19 without cross-reacting with other viruses.

[0122] Visual verification:

[0123] Application of a COVID-19 isothermal amplification nucleic acid detection kit

[0124] This example uses the visualized COVID-19 isothermal amplification nucleic acid detection kit provided in Example 5 for visual verification.

[0125] 1) Samples to be tested: Nasopharyngeal swabs confirmed to contain COVID-19. Samples to be tested do not need to be extracted for nucleic acid.

[0126] 2) Amplification: Aseptically operate, take 5ul of the nasopharyngeal swab liquid to be tested and divide it into the detection tube containing the reaction premix A / B, and react at 65℃ for 60min.

[0127] 3) Determination of test results

[0128] Place the test tube against the background of a colorimetric card to observe the color of the reaction solution. Blue means the sample contains COVID-19, and purple means the sample does not contain COVID-19.

[0129] Test results such as Figure 1 As shown, P is a positive quality control, COVID-19 genome fragment; N is a negative control, DEPC water; 1 and 4 are negative samples; 2 and 3 are positive samples, nasopharyngeal swab samples containing COVID-19 (confirmed). P, 2, and 3 are blue, indicating that the sample contains COVID-19; N, 1, and 4 are purple, indicating that the sample does not contain COVID-19.

[0130] It should be noted that the visualized COVID-19 isothermal amplification nucleic acid detection kit provided in Example 5 used in this experiment was visually verified and replaced with the kit provided in any one of Examples 6-8. The results obtained were the same as above, and COVID-19 detection could be performed quickly and easily, and the results were visualized.

[0131] Comparison of LAMP test results with traditional qPCR test

[0132] Table 1: Comparison of LAMP test results with qPCR test results

[0133]

[0134] LAMP positive detection rate of positive samples: 100%.

[0135] LAMP positive detection rate of negative samples: 100%.

[0136] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0137] The above is a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of various equivalent modifications or replacements within the technical scope disclosed by the present invention, and these modifications or replacements should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. A COVID-19 nucleic acid detection primer set, characterized in that: It includes a pair of outer primers F3-3 and B3-3, a pair of inner primers FIP-3 and BIP-3, and a pair of loop primers LF-3 and LB-3; The nucleotide sequences of F3-3, B3-3, FIP-3, BIP-3, LF-3 and LB-3 are as follows: F3-3: CACCCGCAATCCTGCTAAC; B3-3: CCAGCCATTCTAGCAGGAGA; FIP-3: TGCTCCCTTCTGCGTAGAAGC-GCTGCAATCGTGCTACAACT; BIP-3: GGCGGCAGTCAAGCCTCTTC-CCTACTGCTGCCTGGAGTT; LF-3: TGGCAATGTTGTCCTTGAGG; LB-3:ATCACGTAGTCGCAACAGTTC.

2. A COVID-19 isothermal amplification nucleic acid detection kit, comprising a reaction premix A, a reaction premix B, a test tube, a positive quality control, and a negative control, characterized in that: Mainly include the following substances: 1) Bst DNA large fragment polymerase; 2) AMV reverse transcriptase; 3) 10X reaction buffer; 4) the COVID-19 nucleic acid detection primer set according to any one of claim 1; 5) dNTPs; 6) magnesium sulfate; 7) betaine; 8) formamide; 9) DEPC water.

3. The COVID-19 isothermal amplification nucleic acid detection kit according to claim 2, characterized in that: The reaction premix A includes 2-10U of Bst DNA large fragment polymerase and 2-10U of AMV reverse transcriptase; The reaction premix B includes 10X reaction buffer, the COVID-19 nucleic acid detection primer set according to any one of claims 1 to 4, dNTPs 1-5mM, magnesium sulfate 1-12mM, betaine 0.2-1.2mM, formamide and DEPC water.

4. The COVID-19 isothermal amplification nucleic acid detection kit according to claim 3, characterized in that: The formamide is selected from a formamide solution with a volume fraction of less than 50%.

5. The COVID-19 isothermal amplification nucleic acid detection kit according to claim 4, characterized in that: The formamide is selected from a formamide solution with a volume fraction of 2-30%.

6. The COVID-19 isothermal amplification nucleic acid detection kit according to claim 2, characterized in that: The positive quality control is the COVID-19 genome fragment; the negative control is DEPC water.

7. The COVID-19 isothermal amplification nucleic acid detection kit according to claim 2, characterized in that: The concentration ratio of the COVID-19 nucleic acid detection primer set described in the reaction premix B is as follows: the molar ratio of the outer primer, the inner primer, and the loop primer is 1:4:2.

Images