Method for detecting complete adenovirus particles

Abstract

The invention relates to the technical field of biology, and discloses a complete adenovirus particle detection method which comprises the following steps: S1, coupling activated magnetic beads with an adenovirus antibody to obtain a carboxyl magnetic bead-antibody compound; s2, capturing complete adenovirus particles by adopting the carboxyl magnetic bead-antibody compound obtained in the step S1; s3, separating virus supernatant and magnetic beads; s4, extracting adenovirus nucleic acid; and S5, carrying out adenovirus nucleic acid detection by using qPCR. According to the novel immune molecule method, protein antibodies with high specificity and high affinity and real-time quantitative PCR are utilized, different virus particles are captured through magnetic beads coupled with the antibodies, the DNA level is measured, and the content of the complete adenovirus particles is accurately and rapidly detected. The technical problem that the detection method in the prior art cannot complete adenovirus particles is solved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for detecting complete adenovirus particles. Background Art

[0002] In the more than 60 years since the discovery of adenovirus, adenovirus infection is ubiquitous around the world, with occasional local outbreaks. Adenovirus infection seriously endangers human health, and rapid and accurate detection of intact adenovirus particles from clinical samples and the environment is crucial to assessing infection risks and curbing adenovirus infection.

[0003] Adenovirus (Ad) is a spherical, non-enveloped virus with an icosahedral three-dimensional symmetric structure, with a diameter of about 70-90nm. Its genome is a linear, non-segmented double-stranded DNA, about 25-45kb in length, which can encode multiple proteins. There are inverted terminal repeats (ITR) at both ends of each genome. The adenovirus capsid is composed of 252 capsomeres, of which 240 are hexons and 12 are pentons. Each hexon is a homotrimer of hexon protein, and the trimer hexon molecule has a triangular spire and a pentahedral base. A fiber can be extended from the penton protein as the base, and there is a bulge at the top of the fiber as the head region (Knob), which can bind to cell surface receptors and play an important role in the process of viral infection. After the adenovirus infects the host cell, its genome enters the cell nucleus for transcription and replication. The life cycle of adenovirus is divided into two stages: early and late. Early genes are mainly involved in regulating the host cell environment to facilitate viral replication, while late genes mainly encode viral structural proteins. After replication is completed, newly synthesized virus particles are released by cell lysis or blebbing, and then infect other cells. Adenovirus is secreted in a variety of forms, containing only viral capsid proteins without nucleic acids, or only viral DNA fragments, which do not have viral infection activity. Among them, complete adenovirus particles are the only infectious virus particles.

[0004] So far, there are many methods for adenovirus detection in various fields, such as detecting viral antigens and antibodies through immunological methods, detecting viral nucleic acids using quantitative polymerase chain reaction (qPCR) and loop-mediated isothermal amplification (LAMP), etc. However, these methods cannot truly reflect the virus's infection and replication capabilities. Therefore, a new method is urgently needed to detect complete adenovirus particles.

[0005] To this end, the present invention has developed a new immune molecular method using highly specific and affinity protein antibodies and real-time quantitative PCR, using magnetic beads coupled with antibodies to capture different virus particles, and then measuring the DNA level to accurately and quickly detect the content of complete adenovirus particles, thereby facilitating adenoviruses to play a great role in the fields of tumors, gene therapy, and vaccine vectors, and providing a new solution for mankind to defeat disease. Summary of the invention

[0006] The purpose of the present invention is to provide a new immune molecular method that can utilize highly specific and high affinity protein antibodies and real-time quantitative PCR to capture different virus particles by magnetic beads coupled with antibodies and measure the DNA level to accurately and quickly detect the content of complete adenovirus particles, thereby solving the technical problem that the detection methods in the prior art cannot detect complete adenovirus particles.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows:

[0008] The present invention provides a method for detecting intact adenovirus particles, comprising the following steps:

[0009] S1, coupling carboxyl magnetic beads and adenovirus antibodies to obtain carboxyl magnetic beads-antibody complexes;

[0010] S2, using the carboxyl magnetic beads-antibody complex obtained in step S1 to capture the complete adenovirus particles;

[0011] S3, separation of viral supernatant and magnetic beads;

[0012] S4, extracting adenovirus nucleic acid;

[0013] S5. Use qPCR to detect adenovirus nucleic acid.

[0014] Preferably, in step S1, the preparation method of the activated magnetic beads is: after washing the carboxyl magnetic beads with 0.015M MES buffer at pH 5.5, the EDC / NHS coupling agent solution is added, vortexed and mixed, and reacted at 10-30°C.

[0015] Preferably, the mass ratio of the EDC / NHS coupling agent to the carboxyl magnetic beads is 20 ug / mg.

[0016] Preferably, the specific operation of the coupling is: after the activated magnetic beads are washed with 0.015M pH5.5MES buffer, PIX antibody diluted with 0.015M pH5.5MES buffer is added, and the mixture is rotated and incubated at 10-30°C for more than 4 hours; the supernatant is separated and discarded, 200 μL of magnetic bead blocking solution is added, and the mixture is rotated and incubated at 10-30°C for 1 hour, the supernatant is separated and discarded, the magnetic beads are washed with a preservation solution (PBST buffer), and the complex is resuspended to 10 g / L to obtain a carboxyl magnetic bead-antibody complex, which is stored at 4°C for future use; the mass ratio of the adenovirus antibody to the carboxyl magnetic beads is not less than 75 ug / mg.

[0017] Preferably, in step S2, the complete adenovirus is TGF-TGFβ1 or FGF2 adenovirus particles.

[0018] Preferably, in step S2, the method for capturing the adenovirus is as follows: take a certain amount of the carboxyl magnetic bead-antibody complex prepared in step S1 into an EP tube, add 5 μL of complete adenovirus particles, and then add 400 μL of PBS buffer, and rotate and incubate at a certain temperature.

[0019] Preferably, the amount of the carboxyl magnetic beads-antibody complex is 10-40ul.

[0020] Preferably, the incubation time is 15-60 min.

[0021] Preferably, the incubation temperature is 4°C-25°C.

[0022] Preferably, the complete adenoviral particles are complete TGF-TGFβ1 and FGF2 adenoviral particles.

[0023] Preferably, in step S5, the primer pair sequence for detecting TGF-TGFβ1 adenovirus nucleic acid is as follows:

[0024] TGF-TGFβ1F:TCAGGCTGCTGAGACTCAAA;

[0025] TGF-TGFβ1R: CTCACAACACCGGTCACATC.

[0026] The difficulty and significance of the technical problem solved by the present invention are:

[0027] Although there are many existing methods for adenovirus detection, such as immunological methods for viral antigen and antibody detection, quantitative polymerase chain reaction (qPCR) and loop-mediated isothermal amplification (LAMP) for viral nucleic acid detection, etc., the above methods cannot truly reflect the virus's infection and replication capabilities, that is, they cannot detect completed adenovirus particles. Therefore, around the above technical problems, based on the characteristics of adenovirus and specific antibody reactions, the present invention has designed an immune molecular platform for detecting complete adenovirus particles. The design principle of the platform is to utilize the amino group of the antibody and the carboxyl group of the carboxyl magnetic beads to covalently bind to form a peptide bond to couple the adenovirus protein antibody (PIX antibody) with the carboxyl magnetic beads. After the successfully coupled carboxyl magnetic bead-antibody complex (MB-PIX) and the TGF-TGFβ1 complete adenovirus (TGF-TGFβ1 adenovirus) are incubated at room temperature for 60 minutes, adenovirus particles carrying the PIX protein can be specifically captured. Then, the magnetic beads and the supernatant are separated by a magnetic rack to remove free nucleic acids and non-complete virus particles lacking capsid protein. The adenovirus particles collected can then be tested for nucleic acid by real-time fluorescence quantitative PCR, eliminating the influence of empty virus particles and ensuring that the detection of the present invention is only for complete adenovirus particles.

[0028] In summary, compared with the prior art, the solution of the present invention has the following beneficial effects:

[0029] For the detection of complete virus particles, traditional methods such as particle gel assay require a large amount of sample, complicated steps, and long processing time, while the method of the present invention can quickly and accurately detect complete virus particles; and the present invention can separate different virus particles based on antigen-antibody specific binding, and then accurately detect complete virus particles, which will help to understand the infection status of adenovirus, evaluate antiviral efficacy, and provide guidance for rational clinical drug use. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The results of SDS-PAGE detection of antibody purity in Example 1 (M: protein molecular weight; 1: purified antibody No. 6; 2: purified antibody No. 7);

[0031] Figure 2 The expression of PIX protein was identified by SDS-PAGE electrophoresis in Example 1 (1: protein molecular weight; 2: uninduced; 3: broken bacteria; 4: supernatant; 5: precipitate; 6: permeate; 7: wash1; 8: wash2; 9: wash3; 10: wash4; 11: target protein eluate);

[0032] Figure 3For screening antibodies with strong affinity to the PIX protein in Example 1 (A: ITC experiment to detect the interaction between the PIX protein and the PIX6 antibody; B: ITC experiment to detect the interaction between the PIX protein and the PIX7 antibody);

[0033] Figure 4 Schematic diagram of 5 original plasmids in Example 2;

[0034] Figure 5 This is a diagram for verifying the overexpression of 5 original plasmids in Example 2;

[0035] Figure 6 The figure is a screen result diagram of the five recombinant plasmids in Example 2 (A is a screen diagram of the VEGF and PDGF recombinant plasmids, B is a screen diagram of the TGF-TGFβ1 recombinant plasmid, and C is a screen diagram of the FGF2 recombinant plasmid);

[0036] Figure 7 The results of PacI digestion and identification of 5 recombinant plasmids in Example 2 (Marker: DNA molecular weight);

[0037] Figure 8 The adenovirus fluorescence packaging images in Example 3 (A is a fluorescence image of the adenovirus TGF-TGFβ1 packaging process; B is a fluorescence image of the adenovirus FGF2 packaging process);

[0038] Fig. 9 The results of Western Blot and particle gel verification of adenovirus particles in Example 4 (A is a protein blot experiment identification result of FGF2 adenovirus, with BA.4.Psv pseudovirus as a negative control; B is a protein blot experiment identification result of TGF-TGFβ1 adenovirus, with BA.4.Psv pseudovirus as a negative control; C is a particle gel technology to identify whether the packaged FGF2 and TGF-TGFβ1 are complete virus particles, with BA.4.Psv pseudovirus as a negative control);

[0039] Fig.10 This is a detection flow chart of the adenovirus detection platform based on immune capture in Example 5;

[0040] Fig.11The results of SDS-PAGE electrophoresis for detecting and verifying the magnetic bead antibody coupling in Example 5 are shown (A: complex of PIX6 antibody and magnetic beads, lane 1: protein Maker, lane 2: PIX6 antibody, lane 3: complex after 50ug of antibody and magnetic beads are coupled, lane 4: complex after 75ug of antibody and magnetic beads are coupled, lane 5: complex after 100ug of antibody and magnetic beads are coupled, lane 6: control, uncoupled magnetic beads; B: supernatant separated after PIX6 antibody and magnetic beads are coupled, lane 1: protein Maker, lane 2: PIX6 antibody, lane 3: supernatant separated after 50ug of antibody is coupled, lane 4: supernatant separated after 75ug of antibody is coupled, lane 5: supernatant separated after 100ug of antibody is coupled, lane 6: control, uncoupled magnetic beads);

[0041] Fig.12 The results of the magnetic bead antibody coupling verification in Example 5 (A is the protein concentration of carboxyl magnetic beads before and after coupling determined by the BCA method; B is the effective particle size determination of carboxyl magnetic beads before and after coupling; (P<0.001; ***)).

[0042] Fig.13 The optimization results of virus particle capture conditions in Example 5 (A is the optimization result of magnetic bead dosage; B is the optimization result of capture time; C is the optimization result of capture temperature; (****, p<0.05));

[0043] Fig.14 The methodological evaluation results in Example 5 (A is the fluorescence quantitative PCR standard curve; B is the specificity test result; C is the anti-interference ability test result). DETAILED DESCRIPTION

[0044] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0045] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0046] A method for detecting intact adenovirus particles comprises the following steps:

[0047] S1, coupling activated magnetic beads and adenovirus antibodies to obtain carboxyl magnetic beads-antibody complexes;

[0048] 1 mg of carboxyl magnetic beads was placed in a 2 mL centrifuge tube, separated by a magnetic stand and the supernatant was discarded. After the magnetic beads were washed with MES buffer, they were resuspended to 10 mg / mL, 20 μL of EDC / NHS coupling agent solution was added, vortexed for 1 min, and rotated and mixed at room temperature for 30 min to obtain activated magnetic beads; the activated magnetic beads were washed three times with MES buffer, resuspended to 10 mg / mL, adenovirus antibodies diluted with MES buffer were added, and rotated and incubated at room temperature for more than 4 h; the supernatant was separated and discarded, 200 μL of magnetic bead blocking solution was added and rotated and incubated at room temperature for 1 h, the supernatant was separated and discarded, the preservation solution (PBST buffer) was washed twice, and the beads were resuspended to 10 g / L to obtain carboxyl magnetic beads-antibody complexes, which were stored at 4°C for later use.

[0049] Room temperature refers to a temperature of 10-30° C., the MES buffer is a 0.015M MES buffer with a pH of 5.5, and the mass ratio of the adenovirus antibody to the carboxyl magnetic beads is not less than 75 ug / mg.

[0050] S2. Use the carboxyl magnetic beads-antibody complex obtained in step S1 to capture the complete adenovirus particles. The method is as follows: take 10-40ul of the carboxyl magnetic beads-antibody complex prepared in step S1 and put it into an EP tube, add 5μL of complete adenovirus particles (TGF-TGFβ1 or FGF2 adenovirus particles), and then add 400μL PBS buffer, and incubate with rotation at 4℃-25℃ for 15-60min.

[0051] S3. Separate the viral supernatant and magnetic beads.

[0052] S4. Extract adenovirus nucleic acid.

[0053] S5. Detect adenovirus nucleic acid using qPCR;

[0054] The primer pair sequences used to detect TGF-TGFβ1 adenovirus nucleic acid are as follows:

[0055] TGF-TGFβ1F:TCAGGCTGCTGAGACTCAAA;

[0056] TGF-TGFβ1R: CTCACAACACCGGTCACATC.

[0057] Example 1 Monoclonal Antibody Preparation

[0058] 1. Obtaining shock-immunized mice

[0059] First, mice were immunized, and the peptide CTTRLPGWAGVRQNVMGSTVDGRPVLPA NSST was used as an immunogen. Four SPF-grade BALB / c female mice were subcutaneously immunized at a dose of 60ug protein / mouse, numbered: 1, 2, 3, and 4. Subcutaneous booster immunization was performed every two weeks, with an immunization dose of 30ug protein / mouse, and booster immunization was performed four times. One week after the end of immunization, the mice were bled from their eye sockets and the serum titer was measured. Finally, mouse No. 4 was selected for the cell fusion experiment, and 50ug of immunogen was used to impact mouse No. 4 intraperitoneally.

[0060] 2 Cell fusion experiment

[0061] Mouse spleen cells and SP2 / 0 cells were fused by PEG method. After fusion, the cells were screened and cultured in semi-solid culture medium (containing HAT).

[0062] The specific process is as follows: blow down the sp2 / 0 cells in good condition and suck them into a 50ml centrifuge tube. Remove the eyeballs of the mice to collect blood, and after killing, remove the thymus of the mice, crush it and put it in a 15ml centrifuge tube, then add 2ml of HAT and 1ml of HT and put it in the incubator for use; remove the spleen of the mice and put it on the cell sieve to fully crush it. Suck the crushed cells into the centrifuge tube containing sp2 / 0, centrifuge at 1500rad for 5min, discard the supernatant, resuspend with serum-free IMDM, centrifuge and discard the supernatant, fully suspend and put it in 37℃ warm water, slowly add 1ml of PEG, and let it stand in warm water for 1min. Then slowly add 2 ml of serum-free IMDM within 2 minutes, and then slowly add 8 ml of serum-free IMDM within 2 minutes; centrifuge at 1000 rad for 5 minutes, discard the supernatant, add 10 ml of serum, blow the cells evenly, and pour in thymocytes; then add semi-solid culture medium to make the volume 50 ml, mix thoroughly; then pour evenly into 30 cell culture dishes; put the cell culture dishes in a wet box, and then put them in an incubator for culture. Then pick 10 plates × 93 cell clones and culture them in 96-well cell culture plates (previously plated with thymocytes, 100 μL / well).

[0063] 3 Monoclonal cell screening

[0064] 3.1 Monoclonal cell screening

[0065] All the supernatants of monoclonal cells in the 96-well culture plate were discarded, and 200 μL / well of 20% newborn calf IMDM culture medium (containing HT) was added for the first screening.

[0066] 3.2 Monoclonal Cell Screening

[0067] The selected monoclonal cells were screened a second time using the ELISA method, and 16 positive hybridoma cell lines were obtained.

[0068] The specific steps are as follows: dilute "peptide-BSA" with coating solution to a final concentration of 2ug / ml, 100μL per well, incubate at 4℃ overnight, and then wash with PBST 3 times; block with 2% skim milk powder, 200μL per well, incubate at 37℃ for 2h, and then wash with PBST 3 times; add primary antibody (cell culture supernatant), negative control (SP2 / 0 culture supernatant), blank control (PBS), positive control (positive serum PBS diluted 1000 times), 100u per well, incubate at 37℃ for 1h, and then wash 3 times; add goat anti-mouse IgG / HRP secondary antibody, 100μL per well, incubate at 37℃ for 1h, and then wash 3 times; add color development solution for about 10min, then add stop solution to stop, and measure the absorbance value at dual wavelengths (450, 630). 16 positive monoclonal cell lines were screened.

[0069] 3.3 Monoclonal cell screening

[0070] The 16 positive cell lines were plated again and screened for the third time using the ELISA method, and 8 positive hybridoma cell lines were obtained.

[0071] 3.4 Identification of monoclonal cell subtypes

[0072] The 8 positive cell lines screened out were subjected to subclass identification, and finally 6 IgG positive hybridoma cell lines were obtained (the results are shown in Table 1).

[0073] The identification method is as follows: dilute the "subclass coating antibody" with coating solution to a final concentration of 2ug / ml, 100μL per well, incubate at 4℃ overnight, and then wash 3 times with PBST; block with 2% skim milk powder, 200μL per well, incubate at 37℃ for 2h, and then wash 3 times with PBST; add primary antibody (cell culture supernatant) and negative control (SP2 / 0 culture supernatant) at 100μL / well, incubate at 37℃ for 1h, and then wash 3 times; add secondary antibodies of various subclasses, 100μL per well, incubate at 37℃ for 1h, and then wash 3 times; add color developing solution for about 10min, then add stop solution to stop, and measure the absorbance at dual wavelengths (450, 630).

[0074] Table 1 Information of 6 IgG positive monoclonal cell lines

[0075] serial number OD value for immunogen Subtype 1 0.433 G1 3 0.203 G1 4 0.514 G1 6 0.723 G1 7 0.562 G1 12 0.193 G1 Negative control 0.028 Blank control 0.026 Positive Control 0.672

[0076] 3.5 Purification of monoclonal antibodies

[0077] Purification was performed using the two positive monoclonal cell lines No. 6 and No. 7 with the highest OD values ​​to obtain purified PIX6 and PIX7, respectively. Specifically: Use more than 10 volumes of wash buffer (100mM Tris-HCL PH 8.0) to balance the column. Centrifuge the supernatant (9000rpm, 10min) and apply it to the column. Repeat the column 2-3 times to allow full binding. Wash the column with wash buffer for more than 30ml, prepare a centrifuge tube for receiving, add 0.1ml of 100mM Tris to each tube, and when eluting, add 0.9ml of Elution buffer (100mM Glycine PH 3.0) to receive one tube, which is equivalent to 10% wash buffer and 90% Elution buffer in each EP tube. Measure the protein concentration in each tube and combine the ones with high concentration. Concentrate with a centrifuge tube with a filter membrane and wash twice with TBS (pH7.6). Concentrate to 0.5ml and store at -80℃. SDS-PAGE was performed to detect the purity of the antibody. The results are shown in Figure 1 .

[0078] Prokaryotic expression of 4PIX protein

[0079] The plasmid pET28a-PIX-his for prokaryotic expression of PIX protein was constructed, and the expression plasmid was transferred into Escherichia coli BL21 competent cells. A single colony was picked and cultured in LB medium containing Kana antibiotics for 6-7 hours, and then 300 ml was amplified and cultured at 37°C. When OD600 reached about 0.6-0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to induce overexpression of the target protein. After collecting the bacteria, they were ultrasonically broken and purified using a Ni2+-NTA affinity chromatography column. Samples from each step of the protein purification process were retained for protein electrophoresis, and the bands were observed after Coomassie Brilliant Blue staining. ITC was then used to evaluate the binding affinity of purified PIX6 and PIX7 to PIX protein.

[0080] The present invention cloned the DNA fragment expressing PIX protein into the pET-28a(+) expression vector after codon optimization to construct a protein expression plasmid, pET28a-PIX-his. Observe the Coomassie brilliant blue staining results, such as Figure 2 As shown in Figure 1, the target protein was observed at the position of 16KD, and then the protein was dialyzed and concentrated. The protein PIX was subjected to ITC experiments with PIX6 and PIX7 antibodies, respectively. Figure 3 As shown, PIX protein and both antibodies can bind with different affinities, among which PIX6 antibody has the highest binding affinity with PIX protein, and the dissociation constant reaches the nanomolar level, which is KD(M)=31.4±34.1nm. Therefore, the present invention selects PIX6 antibody for subsequent experiments.

[0081] Example 2 Construction of recombinant adenovirus plasmid pAdTrack-TO4-TGF-TGFβ1 and FGF2

[0082] 1. Original plasmid construction

[0083] The coding sequences of human TGF-TGFβ1, FGF2, PDGF, VEGF, and HE-EGF were searched through NCBI, and the original plasmid (vector pAdTrack-TO4) was constructed by Shanghai Sangon Biotechnology Co., Ltd. Figure 4 After sequencing, the sequences were aligned using SnapGene software; the five plasmids were transfected into HEK293 cells and verified by Western Blot 48 hours later, that is, TGF-TGFβ1, FGF2, PDGF, VEGF and HE-EGF plasmids were transfected into HEK293 cells, and then the cell lysate was extracted and analyzed by immunoblotting, as shown in Figure 5 As shown, the results show that the target genes can be expressed, that is, the five original plasmids can be expressed normally.

[0084] 2. Shuttle Plasmid Linearization

[0085] First, linearize the confirmed shuttle vectors pAdTrack-TO4TGF-TGFβ1 and pAdTrack-TO4FGF2 with PmeI restriction endonuclease. Design a 100μl enzyme digestion reaction system: 2μL of PmeⅠ restriction endonuclease, 10μL of Cutsmartbuffer (10×), 6ug of plasmid, and ddH2O to a total volume of 100μl. Incubate the mixture in a 37℃ water bath for 1 hour. The product is detected by 1% agarose gel electrophoresis.

[0086] Then purify the digestion product by ethanol precipitation. Add 100μLddH20 to the EP tube containing the digestion product to increase the volume to 200μL; add 5μL glycogen, 100μL 7.5M ammonium acetate, and 700μL anhydrous ethanol (frozen) to the EP tube; shake well at room temperature, centrifuge at 14000rpm for 5min, and use an aspirator to absorb the liquid in the EP tube; add 500μL 75% ethanol to the EP tube, shake well, and centrifuge at 14000rpm for 2min; use an aspirator to absorb the liquid until it is completely dry, repeat the previous step, and this time the liquid on the tube wall should be absorbed; place the EP tube at room temperature, air dry until the precipitate at the bottom of the EP tube is transparent, and add 15μLddH2O. It should be noted that: do not gel purify the linearized shuttle vector, because the purification process may reduce the transformation efficiency.

[0087] 3. Electroporation of enzyme digestion products into AdEasy-1BJ5183 competent cells

[0088] Preparation of AdEasy-1BJ5183 electrotransformation competent state, the process is as follows: take 10μLAdEasy-1BJ5183 electrotransformation competent bacterial solution and streak three zones on the plate containing Amp and SM resistance, and incubate overnight at 37℃. On the second day, pick a single clone colony in LB medium containing Amp and SM resistance and shake it for 6-7h, then amplify and culture it in 200ml LB medium containing Amp and SM resistance (without Nacl), wait until the OD value reaches 0.6-0.8, put the bacteria in an ice box and put it in a 4℃ refrigerator overnight. On the third day, centrifuge the bacterial solution at 4℃ 4000rpm for 10min, discard the supernatant, add 10ml of 10% glycerol after high pressure, fully resuspend, gently blow more than 50 times (all on ice), centrifuge at 4℃ 4000rpm for 10min, discard the supernatant, repeat the above washing steps four times, finally discard the supernatant and add 2ml10% glycerol to resuspend, store at -80℃ after aliquoting.

[0089] The linearized enzyme digestion product was electroporated into AdEasy-1BJ5183 competent cells, resuspended with 500 μL of non-antibiotic medium and aspirated into an EP tube. After incubation at 37°C and 220 rpm for 1 hour, 100 μL was centrifuged and evenly spread on a kana-resistant LB plate and incubated overnight at 37°C. The next day, 5 to 10 smallest colonies were selected for plasmid extraction to obtain recombinant adenovirus plasmids.

[0090] 4 Screening and identification of recombinant adenovirus plasmids

[0091] 4.1 Screening of recombinant adenovirus plasmids

[0092] Randomly select 4-6 clones of supercoiled recombinant adenovirus plasmids and detect them by 1% agarose gel electrophoresis. Figure 6 As shown, except Figure 6 Except for clone No. 5 of VEGF in A, all other super-curled clones are potential recombinants because their migration positions are greater than 12 kb and there are no hybrid bands. All super-curled clones are potential recombinants.

[0093] 4.2 Identification of recombinant adenovirus plasmids

[0094] PacI restriction enzyme digestion to identify the recombinant plasmid

[0095] Perform agarose gel electrophoresis on the cloned plasmid selected in 4.1 to check the size of the supercoiled plasmid. At the same time, perform PacI digestion on the candidate clone. Correct recombination usually produces a large fragment (greater than 12kb) and a smaller fragment (3.0 or 4.5kb). Design a 100μl enzyme digestion reaction system: 2μL of PacⅠ restriction endonuclease, 10μL of Cutsmartbuffer (10×), 8ug of plasmid, and ddH2O to a total volume of 100μl. Incubate the mixture in a 37℃ water bath for 1 hour. The product is detected by 1% agarose gel electrophoresis. Then purify the digestion product by ethanol precipitation.

[0096] Re-transform 1-3 μL of the correct recombinant plasmid into DH10B (or other plasmid propagation strain that does not readily recombine). Due to the high frequency of recombination and rearrangement of large plasmids in BJ5183 cells, one should not attempt to re-cultivate BJ5183 for candidate recombinant clones. Perform further restriction analysis on the clone to determine its structure. Prepare for transfection of HEK-293 cells.

[0097] like Figure 7 As shown, the five recombinant adenovirus plasmids all produced a large fragment larger than 15 kb and a smaller fragment of about 4.5 kb in the enzyme digestion results after PacI enzyme digestion, indicating that the adenovirus recombinant plasmid was successfully constructed and can proceed to the next step of virus packaging process.

[0098] Example 3 Recombinant Adenovirus Production

[0099] Produce recombinant adenovirus in HEK-293 packaging cells as follows:

[0100] 6-15h before transfection, re-plate HEK293 cells in a T25 culture flask so that the cell density is about 40%-60% during transfection; take a 1.5ml EP tube, add 250μL OPTI-MEM + 8μL Lipo8000, mix gently, then add 20μL of purified enzyme cleavage product (enzyme cleavage product of TGF-TGFβ1 and FGF2 recombinant adenovirus), place at room temperature, do not centrifuge; at the same time, remove the culture medium and add new 5ml complete culture medium. Add the mixture dropwise to the culture flask and shake gently to mix. Place in a 37℃, 5% CO2 incubator for 8-12h, remove the old culture medium and replace with complete culture medium. Observe fluorescence for 24h; adenovirus packaging takes about 7d (Note: the culture medium cannot be replaced during this period. When the culture medium turns yellow, 1-2ml of culture medium can be added. Observe the packaging status under a fluorescence microscope every 2-3d). Figure 8 As shown, when the fluorescence produces comet-like shapes and when 1 / 3 of the cells are floating, the adenovirus is collected.

[0101] The specific operation of collecting adenovirus is as follows: blow the cells to collect all the cells into a 15ml centrifuge tube, and centrifuge at 4℃, 4000rpm for 5min; during the centrifugation, prepare a 37℃ water bath and liquid nitrogen; discard the supernatant, reserve about 1ml of culture medium, and oscillate to mix; place in liquid nitrogen for 3min, immediately place in a 37℃ water bath to dissolve, and oscillate to mix after dissolution; repeat 3 to 4 times; centrifuge at 4℃, 4000rpm for 5min, aspirate the supernatant and discard the precipitate to a new EP tube and add virus storage solution, 300μL virus storage solution for every 1ml of virus; mix and place at -80℃, this is the adenovirus stock solution.

[0102] It should be noted that before collecting the virus stock solution, it is necessary to gradually amplify the recombinant adenovirus to a high titer. The specific operation is as follows: 5-16 hours before collecting the virus stock solution, prepare a bottle of HEK293 cells in a T25 culture bottle with a density of 40-60%. When the adenovirus is collected, add 1 / 2 of the virus stock solution dropwise to the culture medium for the first round of amplification, and observe the fluorescence for 24 hours (if there is no fluorescence, the virus can be appropriately added within 24 hours). Within two days of infection, the HEK293 cells in the T25 culture bottle can be transferred to the T75 culture bottle to extend the infection time. The virus is usually collected in 3-5 days. Adenovirus generally needs to be amplified 3-5 times to a high titer.

[0103] Further explanation is that the culture flasks and cell density ranges required for each expansion are as follows:

[0104] Amplification rounds Culture bottle requirements Cell density range First round of amplification T25 culture flask Cell density is about 40-60% Second round of expansion T25 culture flask Cell density is about 40-60% The third round of amplification T75 culture flask Cell density is about 40-60% Fourth round of amplification 10cm Petri dish Cell density is about 90%

[0105] like Figure 8 As shown, after three to four rounds of amplification, the adenovirus infection activity gradually increased. Example 4 Selecting two adenoviruses with high titers for identification

[0106] (1) Verification of the initially packaged adenovirus by Western Blot

[0107] ① Through the protein blotting experiment, the collected adenovirus stock solution was lysed, denatured and then electrophoresed, and then transferred to the PVDF membrane, and then the adenovirus protein was detected using mouse anti-PIX6 monoclonal antibody.

[0108] ② Plate HEK293 cells in a six-well plate at a cell density of 60%. When the cells grow to a density of about 80%, add adenovirus stock solution and 2 mL of fresh culture medium, and culture the cells at 37°C. Discard the supernatant 48 hours after infection and wash twice with pre-cooled PBS. Add an appropriate amount of cell lysis buffer, lyse on a shaker at 4°C for 20 minutes, scrape the cells and collect them in an EP tube, perform denaturing electrophoresis transfer, and then use mouse anti-V5 and AVi monoclonal antibodies to detect the target fragments in the cells.

[0109] (2) Verification of the initially packaged adenovirus using particle gel

[0110] Although protein immunoblotting can detect adenovirus proteins and target proteins through specific antibodies, the proteins after cleavage and denaturation are polypeptide fragments and are not necessarily complete active virus particles. Therefore, the present invention also uses a virus particle gel experiment, which mainly uses natural agarose gel electrophoresis to separate envelope and non-enveloped particles with different physical and chemical properties, and transfers them to a positively charged microporous nylon membrane, and then uses antibodies and nucleic acid hybridization to detect virus particle-related protein components and DNA content, respectively, to further distinguish complete viruses from incomplete viruses.

[0111] First, the adenovirus was concentrated with 35% PEG8000 and run at 100V for 70 minutes by agarose gel electrophoresis (without nucleic acid dye). Then, semi-dry and wet transfer was performed with TNE buffer for 6 to 7 hours. Mouse PIX6 monoclonal antibody was used to detect complete TGF-TGFβ1 and FGF2 adenovirus particles. If the adenovirus particles were complete, specific bands of antigen-antibody reaction would appear after exposure.

[0112] like Fig. 9 As shown, the Western Blot test results showed that mouse anti-PIX6 monoclonal antibody specifically reacted with FGF2 and TGF-TGFβ1 adenovirus, respectively, and the results showed that both had specific bands; mouse anti-V5 and AVi antibodies hybridized with FGF2 and TGF-TGFβ1 adenovirus target genes, and the results showed that both had specific bands; and the particle gel test results showed that the generated FGF2 and TGF-TGFβ1 adenoviruses were complete virus particles. Combining the Western blotting experiment with the virus particle gel experiment can ensure the generation of active complete virus particles.

[0113] Example 5 Design of an immunomolecular platform for detecting intact adenovirus particles

[0114] Based on the characteristics of adenovirus and specific antibody reactions, the present invention designs an immune molecule platform for detecting complete adenovirus particles (taking TGF-TGFβ1 adenovirus as an example). The design principle of the platform is to use the amino group of the antibody and the carboxyl group of the carboxyl magnetic beads to covalently bind to form a peptide bond to couple the adenovirus protein antibody with the carboxyl magnetic beads. After the successfully coupled carboxyl magnetic bead-antibody complex (MB-PIX) is incubated with the TGF-TGFβ1 adenovirus at room temperature for 60 minutes, the adenovirus particles carrying the PIX protein can be specifically captured. Then, the magnetic beads and the supernatant are separated by a magnetic rack to remove free nucleic acids and non-complete virus particles lacking capsid protein. The adenovirus particles collected subsequently can be tested for nucleic acid by real-time fluorescence quantitative PCR, eliminating the influence of empty virus particles, ensuring that the detection of the present invention is only for complete adenovirus particles.

[0115] The flow chart of the immunomolecular platform for detecting intact adenovirus particles is shown in the following figure. Fig.10 As shown, the steps include:

[0116] S1, the first step is to successfully couple carboxyl magnetic beads and adenovirus antibodies;

[0117] S11, Carboxyl magnetic beads coupled to antibodies

[0118] First, disperse and vibrate the magnetic bead mother solution for 2 to 3 minutes, take 1 mg of magnetic beads (10 mg / ml) into a 2 mL centrifuge tube, separate the supernatant with a magnetic stand, wash three times with MES buffer (0.015M PH5.5), resuspend to 10 mg / mL, add 20 μL of EDC / NHS coupling agent solution (10 mg / mL), vortex for 1 minute, and rotate and mix at room temperature for 30 minutes; wash the activated magnetic beads three times with MES, resuspend to 10 mg / mL, add PIX6 antibodies diluted with MES buffer in batches, and rotate and incubate (couple) at room temperature for more than 4 hours; after completion, separate and collect the supernatant, add 200 μL of magnetic bead blocking solution and rotate and incubate at room temperature for 1 hour, separate and discard the supernatant, wash twice with PBST buffer, resuspend to 10 g / L, and store at 4°C for use.

[0119] S12, Magnetic Bead Antibody Coupling Verification

[0120] The supernatant separated after coupling and the magnetic beads coupled with antibodies were subjected to SDS-PAGE gel electrophoresis and BCA method to detect protein concentration to verify whether the carboxyl magnetic beads and antibodies were successfully coupled.

[0121] (1) SDS-PAGE electrophoresis to detect the magnetic bead-antibody complex after coupling

[0122] The magnetic bead-antibody complex and the supernatant separated after coupling were subjected to SDS-PAGE electrophoresis and stained with Coomassie Brilliant Blue. Mouse anti-PIX6 monoclonal antibody was used as a positive control to confirm whether the magnetic bead-antibody coupling was successful and to determine the amount of antibody required to achieve saturation of the magnetic bead-coupled antibody.

[0123] like Fig.11 As shown, protein bands were detected in the magnetic beads after antibody coupling and in the separated supernatant, indicating that the mouse anti-PIX6 monoclonal antibody had been successfully coupled to the magnetic beads and was saturated. The amount of PIX6 antibody required for 1 mg of magnetic beads was 75 μg.

[0124] (2) BCA method to detect the concentration of magnetic bead antibody after coupling

[0125] Take the same amount of uncoupled magnetic beads MB and antibody-coupled magnetic beads MB-PIX, separate the supernatant with a magnetic stand, wash once with PBS, and resuspend to 10 μL with PBS. Take a clean ELISA plate, and load 10 μL per well for detection in the order of PBS, MB, MB-PIX, PIX, and supernatant separated after coupling (each sample is tested in triplicate), add 200 μL of working solution (A solution: B solution = 50:1) to each well, incubate at 37°C for 30 minutes, and use a multifunctional ELISA reader to detect the absorbance value at 562 nm.

[0126] (3) Effective particle size analysis

[0127] First, turn on the NanoBrook 90PLUS PALS particle size analyzer and stabilize it for 20 minutes; prepare the sample, take 4 μL of carboxyl magnetic beads MB and MB-PIX (10 mg / mL) before and after coupling, separate the supernatant with a magnetic stand, and then add 3 mL of ultrapure water (1% Triton-X-100) to resuspend the solution so that the solution is generally clear and transparent when observed with the naked eye, and the magnetic beads show Brownian motion in the solvent (if necessary, ultrasonic waves can be used to disperse the magnetic beads for 15 minutes); fill the sample pool with pure water, then put the sample pool into the sample slot of the instrument, cover the black sample slot cover, set the detection parameters, and load the sample to be tested into the sample pool for measurement.

[0128] like Fig.12 As shown, the absorption peak of the carboxyl magnetic beads (MB-PIX6) at a wavelength of 562nm increased significantly after antibody coupling. The effective particle size of the uncoupled carboxyl magnetic beads was about 1200nm, while the effective particle size of the coupled magnetic beads was about 2300nm, indicating that the effective particle size of the coupled magnetic beads was significantly increased, indicating that the carboxyl magnetic beads and adenovirus antibodies were successfully coupled.

[0129] S2, the second step is to complete the specific capture of adenovirus by carboxyl magnetic beads-antibody complex;

[0130] The TGF-TGFβ1 adenovirus was captured by the coupled magnetic bead antibody complex. A certain amount of the above-mentioned antibody-coupled magnetic beads was put into an EP tube, 5 μL of adenovirus was added, and then 400 μL of PBS buffer was added, and the mixture was rotated and incubated at a certain temperature.

[0131] S3, the third step is to separate the virus supernatant and magnetic beads using a magnetic stand;

[0132] S4, the fourth step is to extract nucleic acid;

[0133] Add 200 μL proteinase K buffer to the magnetic bead-antibody-virus complex, add 10 μL 10% SDS and proteinase K solution, mix well, and place in a water bath at 37°C for 1 hour; add 200 μL phenol-chloroform-isoamyl alcohol, shake and mix well, centrifuge at 12000r at room temperature for 15 minutes, and take the supernatant; add an equal volume of chloroform-isoamyl alcohol, shake and mix well, centrifuge at 12000r at room temperature for 10 minutes, and take the supernatant; add 10 μL 4M Nacl, and then add twice the volume of anhydrous ethanol, place at -80°C for 2 hours, centrifuge at 4°C at 14000r for 20 minutes, and discard the supernatant; add 400 μL 70% ethanol, shake and mix well, centrifuge at 4°C at 14000r for 20 minutes, and discard the supernatant; dry at 37°C for 5 minutes, and add 10 μL EPC water to dissolve.

[0134] S5. The fifth step is to use qPCR for nucleic acid detection.

[0135] Primer pairs for TGF-TFGβ1 were designed, and real-time fluorescence quantitative PCR was performed to detect the nucleic acid of intact adenovirus particles based on the magnetic bead-antibody complex that captured the virus.

[0136] Table 2 Sequences of TGF-TFGβ1 primer pairs

[0137]

[0138] Furthermore, since the antibody-magnetic bead complex has limited ability to capture virus particles, in order to capture all virus particles in the sample, the present invention optimizes the capture conditions of virus particles by the antibody-magnetic bead complex:

[0139] ① Use different amounts of antibody-magnetic bead complexes (10 μL, 20 μL, 30 μL, 40 μL, 50 μL, 60 μL) to capture viral particles;

[0140] ② The incubation and capture time of virus particles were 15min, 30min, 45min, 60min, and 75min respectively;

[0141] ③Ten TGF-TGFβ1 adenovirus samples were randomly selected and virus particles were captured at 4°C and 25°C for 60 minutes respectively;

[0142] After capture, DNA is extracted for qPCR detection, such as Fig.13 As shown in the figure, when the amount of magnetic beads exceeds 40μL, the detected DNA level no longer increases, indicating that 40μL antibody-magnetic bead complex can completely capture the virus particles in the serum; when the capture time is greater than 60min, the captured DNA level no longer increases with time, and finally the capture time for virus particles is determined to be 60 minutes; when captured at 25℃, the DNA detection level is higher than 4℃, indicating that the antibody-magnetic bead complex captures virus particles faster at 25℃ than at 4℃, and finally the capture temperature is determined to be 25℃.

[0143] Furthermore, a methodological evaluation was performed on the method of using the above-mentioned immune molecular platform to detect intact adenovirus particles.

[0144] Specifically, the pAdTrack-TO4-TGF-TGFβ1 plasmid was used as a standard in the detection method, and the plasmid standard with a known concentration was diluted 10 times, and quantitative detection was performed according to the method. Fig.12 The results of A showed that when the concentration of plasmid standard was 1×10 4 to 1×10 12 When the CT value measured by this experimental method is between 10 and 10, there is a linear relationship between the CT value and its concentration (taking the logarithm of 10). The linear regression equation of the standard curve is y=-3.683x+54.44, and the regression coefficient R 2 =0.9976.

[0145] In order to verify the specificity of this method, we selected 16 negative samples and 16 positive samples for testing to evaluate the specificity of this method, such as Fig.14 shown. Fig.14 The results in B showed that the negative samples were all tested negative, and there was a significant difference between the negative and positive samples (****, p < 0.0001).

[0146] Then, the anti-interference ability of the experimental method was verified. Positive HBV serum samples and AD38 cell culture supernatant with different titers were added to adenovirus (AD) in the present invention, and then adenovirus virus particles were detected. Fig.14 The results in C show that the influence of irrelevant viruses on the test results is negligible, and the coefficients of variation are 2.5% and 3.4% respectively. The above experimental results show that the detection method has good anti-interference ability.

[0147] The above-described embodiments only express the preferred implementation modes of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the present invention. It should be pointed out that, for those of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the attached claims.

Claims

1. A method for detecting intact adenovirus particles, characterized in that: The steps include: S1, coupling the activated magnetic beads and adenovirus antibodies to obtain carboxyl magnetic beads-antibody complexes; S2, using the carboxyl magnetic beads-antibody complex obtained in step S1 to capture the complete adenovirus particles; S3, separation of viral supernatant and magnetic beads; S4, extracting adenovirus nucleic acid; S5. Use qPCR to detect adenovirus nucleic acid.

2. A method for detecting complete adenovirus particles as claimed in claim 1, characterized in that: In step S1, the preparation method of the activated magnetic beads is: after washing the carboxyl magnetic beads with 0.015M MES buffer solution with pH 5.5, the EDC / NHS coupling agent solution is added and vortexed to mix, and the mixture is reacted at 10-30°C.

3. The method for detecting intact adenovirus particles according to claim 2, characterized in that: The mass ratio of the EDC / NHS coupling agent to the carboxyl magnetic beads is 20 ug / mg.

4. The method for detecting intact adenovirus particles according to claim 3, characterized in that: The specific operation of the coupling is: after the activated magnetic beads are washed with 0.015M pH5.5MES buffer, PIX antibody diluted with 0.015M pH5.5MES buffer is added, and the mixture is rotated and incubated at 10-30°C for more than 4 hours; the supernatant is separated and discarded, 200μL of magnetic bead blocking solution is added, and the mixture is rotated and incubated at 10-30°C for 1 hour, the supernatant is separated and discarded, the magnetic beads are washed with a preservation solution, resuspended to 10g / L, and stored at 4°C for later use to obtain a carboxyl magnetic bead-antibody complex; the mass ratio of the adenovirus antibody to the carboxyl magnetic beads is not less than 75ug / mg.

5. The method for detecting intact adenovirus particles according to claim 2, characterized in that: In step S2, the complete adenovirus is TGF-TGFβ1 or FGF2 adenovirus particles.

6. The method for detecting a complete adenovirus particle according to claim 1, characterized in that: In step S2, the adenovirus capture method is as follows: take a certain amount of the carboxyl magnetic bead-antibody complex prepared in step S1 into an EP tube, add 5 μL of complete adenovirus particles, then add 400 μL of PBS buffer, and rotate and incubate at a certain temperature.

7. The method for detecting intact adenovirus particles according to claim 4, characterized in that: The dosage of the carboxyl magnetic beads-antibody complex is 10-40ul.

8. The method for detecting intact adenovirus particles according to claim 4, characterized in that: The incubation time is 15-60 min.

9. The method for detecting intact adenovirus particles according to claim 4, characterized in that: The incubation temperature is 4°C-25°C.

10. A method for detecting complete adenovirus particles as claimed in claim 4, characterized in that: In step S5, the primer pair sequence used to detect TGF-TGFβ1 adenovirus nucleic acid is as follows: TGF-TGFβ1F:TCAGGCTGCTGAGACTCAAA; TGF-TGFβ1R: CTCACAACACCGGTCACATC.

Images