Method for creating pseudo male trachinotus ovatus

Abstract

The invention belongs to the technical field of modern agriculture, and particularly relates to a method for creating pseudo male trachinotus ovatus. According to the method for creating the pseudo male trachinotus ovatus, alpha-naphthoflavone and 17 alpha-methyltestosterone are used in a combined mode, feeding induction is started from the 2-month-old period, and finally sperms can be observed in sexual glands of the genetic female trachinotus ovatus in the 8-month-old period. According to the method, the sexual gland of the genetic female trachinotus ovatus (the sexual gland normally develops into an ovary) can be reversed into the testis, in the 8-month-old period, the observed reversal efficiency is 63.6%, compared with single use of alpha-naphthoflavone, the sexual reversal proportion is increased by more than one time, the number and maturity of sperms of the pseudo male trachinotus ovatus are remarkably increased, and the sexual efficiency of the trachinotus ovatus is improved. And the success rate of subsequent all-female golden pomfret creation is greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of modern agriculture, and in particular relates to a method for creating golden pomfret pseudo-male fish. Background Art

[0002] Sex-controlled breeding technology is a key research and application area in genetic breeding of aquatic animals. In nature and under breeding conditions, there are significant differences between the sexes of many aquatic animals, mainly reflected in differences in growth and body shape, differences in sexual maturity time, body color and pattern, etc. Therefore, sex-controlled breeding of fish has important theoretical significance and application value. The sex of fish includes two aspects. One is the genetic basis that determines the sex of animals, which is called genetic sex; the other is the sex expressed by its physiological composition, which is called physiological sex. Physiological sex is the external manifestation of fish sex and is the result of the interaction between genetic sex and environment. In addition, because fish sex has strong plasticity, the physiological sex of fish can be affected by changing environmental factors.

[0003] Golden Pomfret, scientific name: Golden Pomfret Trachinotus ovatus ), the aquaculture output has increased significantly in the past decade. In 2023, the national total output has reached 292,000 tons, making it the largest fish in marine aquaculture. Hainan's golden pomfret eggs and fry account for more than 70% of the national market, so Hainan is the most important golden pomfret breeding center in my country. Golden pomfret has significant growth differences between males and females, and one-year-old females grow more than 20% faster than males. Therefore, cultivating single-sex breeding groups can not only shorten the breeding cycle, but also reduce the screening links in the breeding process, greatly reduce the breeding management costs, and significantly improve production efficiency. To obtain an all-female golden pomfret breeding population, inducing genetically female individuals to reverse to physiologically male individuals is a key link.

[0004] Artificial methods for controlling fish sex include interspecific hybridization, artificial induction of female nucleus (male nucleus) development, environmental regulation, gene manipulation and hormone induction. The advantages and disadvantages of each method are as follows: (1) Interspecific hybridization technology: fish of different species are hybridized and the sex determination mechanism or sex ratio characteristics of different species are used to control the sex of offspring. By utilizing natural biological processes without external chemical or physical intervention, hybrid offspring with specific excellent traits may be produced, but the success rate is low and is limited by kinship and reproductive barriers. The sex ratio and reproductive capacity of offspring may be unstable, affecting the breeding effect; (2) Artificial induction of gynogenetic (androgenetic) development: Using physical or chemical means to induce the haploid development of eggs or sperm into individuals (such as the development of gynogenetics to produce all-female offspring), the production of all-female or all-male populations can be achieved, with significant results, and the breeding process can be accelerated to quickly obtain offspring with specific traits. However, strict experimental conditions and operating techniques are required, the cost is high, and haploid development leads to a decrease in genetic diversity, low individual survival rate and health status, and affects population adaptability; (3) Environmental regulation: Influencing fish sex differentiation by changing environmental conditions (such as temperature, pH value, light, etc.). This method has no chemical residues, is environmentally friendly, and utilizes natural environmental factors without exogenous intervention. However, the effect on sex differentiation is more complex, the effect is unstable, and needs to be optimized for specific fish species, and has poor universality; (4) Gene manipulation technology: Use gene editing technology (such as CRISPR / Cas9) to directly modify sex-determining genes or regulatory genes to change the process of sex differentiation. This has not yet been achieved in marine fish, and its application in food production is subject to ethical controversy and regulatory restrictions. Consumers are less accepting of genetically engineered foods.

[0005] (5) Hormone induction method: At a specific stage of fish development, the direction of sex differentiation is changed through feed or injection of hormones (such as methyltestosterone or estrogen). This technology is relatively simple and suitable for large-scale operations. The cost of hormones is relatively low, which is suitable for commercial applications in aquaculture. However, the hormone induction method requires accurate selection of appropriate hormones, as well as precise control of hormone dosage and treatment time, otherwise the effect will be unstable.

[0006] At present, the creation of golden pomfret pseudomale fish and its sex control technology and application have not been reported, and there is no method for sex reversal of golden pomfret in this field. Summary of the invention

[0007] At present, it is still uncertain whether the golden pomfret has an XY or ZW sex determination system. In order to obtain all-female golden pomfret (genetic female) with better growth traits, it is necessary to breed physiologically male golden pomfret (genetic female) with physiologically female golden pomfret (genetic female) to obtain all-genetic female golden pomfret. Therefore, creating pseudo-male golden pomfret has become the key in this field.

[0008] The first aspect of the present invention aims to provide a method for creating golden pomfret pseudomale fish.

[0009] The second aspect of the present invention aims to provide a feed for producing golden pomfret pseudomale fish.

[0010] The third aspect of the present invention is to provide a method for preparing feed for golden pomfret pseudomale fish.

[0011] The fourth aspect of the present invention aims to provide the use of the feed according to the second aspect of the present invention in improving the efficiency of golden pomfret farming.

[0012] The fifth aspect of the present invention aims to provide a method for raising golden pomfret.

[0013] The sixth aspect of the present invention aims to provide a method for identifying the sex determination type of golden pomfret.

[0014] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is: A first aspect of the present invention provides a method for creating a pseudomale fish of golden pomfret, comprising the following steps: Female golden pomfret was induced by α-naphthoflavone and 17α-methyltestosterone.

[0015] In some embodiments of the present invention, the induction refers to: adding α-naphthoflavone and 17α-methyltestosterone to feed and then feeding the feed to female golden pomfret; the physiological sex of the female golden pomfret is reversed to male.

[0016] Among them, the female golden pomfret refers to the golden pomfret with female genetic sex; the genetic sex refers to the sex directly indicated by the sex chromosomes; the physiological sex refers to the sex that exhibits specific physiological structures of both sexes under the combined influence of multiple conditions such as genetics, environment (such as temperature), behavior, and physiological factors.

[0017] The golden pomfret with male biological sex is specifically manifested as: the golden pomfret has testes and can produce mature sperm.

[0018] In the present invention, the golden pomfret, which is genetically female but changes its physiological sex to male after induction, is called pseudo-male fish.

[0019] In some embodiments of the present invention, the content of α-naphthoflavone in the feed is 180-220 mg / kg.

[0020] In some embodiments of the present invention, the content of 17α-methyltestosterone in the feed is 80-120 mg / kg.

[0021] In some embodiments of the present invention, the feeding begins when the female golden pomfret is 55 to 65 days old; preferably, 58 to 62 days old.

[0022] In some embodiments of the present invention, the feeding period is 160 to 200 days; preferably, 170 to 190 days.

[0023] In some embodiments of the present invention, the feeding method is satiation feeding; the satiation feeding is performed 1 to 3 times a day; preferably, 2 times.

[0024] In some embodiments of the present invention, the feed varies according to the growth stage of the golden pomfret, specifically: When golden pomfret is 2 to 6 months old, choose extruded feed with a diameter of 1.0 to 2.0 mm; When the golden pomfret is 6 to 8 months old, choose extruded feed with a diameter of 5.0 to 10.0 mm.

[0025] The second aspect of the present invention provides a feed for producing golden pomfret pseudoandrogen, comprising α-naphthoflavone, 17α-methyltestosterone, and golden pomfret base feed.

[0026] In some embodiments of the present invention, the content of α-naphthoflavone in the feed is 180-220 mg / kg.

[0027] In some embodiments of the present invention, the content of 17α-methyltestosterone in the feed is 80-120 mg / kg.

[0028] In some embodiments of the present invention, the golden pomfret base feed adopts commercial feed, product standard number: Q / ZJHD 01-2023, production license number: Guangdong Feed Certificate (2023) 15082; crude protein ≥41%, crude fat ≥5%, lysine ≥2.1%, crude ash ≤18%, crude fiber ≤3.5%, and moisture ≤10%.

[0029] In some embodiments of the present invention, the golden pomfret base feed is commercial golden pomfret feed.

[0030] The third aspect of the present invention provides a method for preparing a feed for golden pomfret pseudomale fish according to the second aspect of the present invention, comprising the following steps: Dissolve α-naphthoflavone and 17α-methyltestosterone, spray them into the base feed of golden pomfret, mix them and dry them.

[0031] In some embodiments of the present invention, in order to avoid the degradation of α-naphthoflavone and 17α-methyltestosterone affecting the effect, the feed is placed in a cool, dark, ventilated place to dry, and the dried feed is stored in a 4°C refrigerator.

[0032] The fourth aspect of the present invention provides the use of the feed for inducing sex reversal of golden pomfret according to the second aspect of the present invention in improving the breeding efficiency of golden pomfret.

[0033] The feed can induce female golden pomfret to become physiologically male golden pomfret, which has a faster growth rate, can shorten the breeding cycle, reduce the screening links in the breeding process, greatly reduce the breeding management cost, and significantly improve the production efficiency, thereby improving the benefits of golden pomfret breeding.

[0034] A fifth aspect of the present invention provides a method for raising golden pomfret, comprising the following steps: The golden pomfret is fed with the feed described in the second aspect of the present invention at 55 to 65 days of age and the feeding is continued for 160 to 200 days.

[0035] In some embodiments of the present invention, the feeding begins when the female golden pomfret is 58 to 62 days old.

[0036] In some embodiments of the present invention, the feeding period is 170 to 190 days.

[0037] A sixth aspect of the present invention provides a method for identifying the sex determination type of golden pomfret, comprising the step of creating golden pomfret pseudomale fish.

[0038] If the golden pomfret has an XX-XY sex determination system, then the XX pseudo-male fish is hybridized with the normal XX female fish to obtain all XX female fish; If the golden pomfret has a ZZ-ZW sex determination system, the first step is to create a ZW pseudo-male fish, and then mate the ZW pseudo-male with a normal ZW female fish. At this time, three different types of genotypes will appear, ZZ, ZW, and WW, and the ratio is ZZ: ZW: WW = 1: 2: 1, which is different from the XX-XY system and can be identified. Further screening is performed to obtain WW super female fish, and finally the WW super female fish is hybridized with a normal ZZ male fish to obtain all Zw female offspring.

[0039] The beneficial effects of the present invention are: The present invention provides a method for inducing sex reversal of golden pomfret, wherein α-naphthoflavone and 17α-methyltestosterone are used in combination to induce sex reversal of golden pomfret. The method has the following outstanding advantages: 1. More efficient This method uses a mixture of aromatic α-naphthoflavone and 17α-methyltestosterone as induction hormones, which is more effective in inhibiting the synthesis of estrogen than other hormones or α-naphthoflavone used alone, thereby promoting the masculinization process of the gonads, and can achieve an induction success rate of more than 60% under appropriate conditions.

[0040] 2. More secure Too high or too low a dose of hormone will affect the effect of sex conversion and the health of the fish. This method uses 200 mg / kg of α-naphthoflavone and 100 mg / kg of 17α-methyltestosterone to feed the fish. No significant effect was found on the survival rate of golden pomfret at 8 months of age, and the health of golden pomfret was not inhibited. Only the first generation needs to be treated with hormones, and the pseudo-male fish can be used to reproduce offspring in the future without hormone treatment. The offspring have normal hormone levels, no safety risks, and less pollution to water bodies.

[0041] 3. Promote spermatogenesis In other fish, sex reversal can be achieved by using other hormones such as 17α-methyltestosterone, but this often leads to testicular atrophy and inhibits spermatogenesis. In the present invention, by mixing α-naphthoflavone and 17α-methyltestosterone, selecting a suitable dosage, and accurately controlling the treatment time, not only can sex reversal of golden pomfret be achieved, but also more sperm can be successfully observed in the gonads of genetically female golden pomfret compared to the use of α-naphthoflavone alone.

[0042] The present invention forms a systematic scheme for creating pseudo-male golden pomfret by selecting α-naphthoflavone and 17α-methyltestosterone as an inducer, determining an optimized dosage, accurately treating the time, and verifying the effect by observing sperm in the gonads. Compared with the prior art, these key technical points not only improve the efficiency and stability of sex conversion, ensure the growth and health of the fish, but also enable normal spermatogenesis. This lays the foundation for the subsequent identification of the golden pomfret chromosome sex determination system and the creation of an all-female golden pomfret variety, and has important scientific significance and significant application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is an agarose gel electrophoresis diagram of the PCR product for genetic sex identification of golden pomfret in Example 3 of the present invention, wherein the first lane is the marker and the second to fourth lanes are samples.

[0044] Figure 2 These are the sequencing maps of the golden pomfret genetic markers in Example 3 of the present invention, wherein A is the sequencing map of the golden pomfret genetic male markers, and B is the sequencing map of the golden pomfret genetic female markers.

[0045] Figure 3 The diagram shows the gonad sections and H&E staining of the golden pomfret in Example 3 of the present invention, wherein A is a control group (genetic male-physiological male); B is a control group (genetic female-physiological female); C is an α-naphthoflavone group (genetic female-physiological female); D is an α-naphthoflavone group (genetic female-physiological male); E is an α-naphthoflavone and 17α-methyltestosterone group (genetic female-physiological female); and F is an α-naphthoflavone and 17α-methyltestosterone mixed group (genetic female-physiological male).

[0046] Figure 4 The following are the survival rate results of golden pomfret in Example 3 of the present invention. DETAILED DESCRIPTION

[0047] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0048] Example 1 Feed preparation The base feed is 1.0~2.0mm diameter golden pomfret extruded feed and 5~10mm diameter golden pomfret extruded feed. The feed is produced by Zhanjiang Haida Feed Co., Ltd., golden pomfret extruded compound feed 6305.

[0049] Weigh 1g of α-naphthoflavone powder (CAS: 604-59-1), add 10mL of dichloromethane, and then use anhydrous ethanol to make up to 250mL, mix well to completely dissolve the α-naphthoflavone powder; weigh 0.5g of 17α-methyltestosterone (CAS: 58-18-4), add 20mL of DMSO, and then use anhydrous ethanol to make up to 250mL, mix well to completely dissolve the 17α-methyltestosterone powder.

[0050] Spray these solutions evenly separately or mix them together and then spray them evenly on 5 kg of the above-mentioned golden pomfret puffed base feed. Finally, place the feed in a cool, dark, ventilated place to dry. The dried feed is placed in a 4°C refrigerator to prevent the degradation of α-naphthoflavone and 17α-methyltestosterone from affecting the effect.

[0051] Example 2 Induction of golden pomfret In this example, a new strain of golden pomfret "Blue Grain No. 1" independently cultivated by Hainan Blue Grain Technology Co., Ltd. and Hainan University was selected as the experimental object. 900 golden pomfret of about 2 months old and similar in size were selected and divided into 3 groups. They were cultured in 4m*4m*1.5m cages, which were placed in standardized seawater ponds. The pond water was changed every 10-15 days, and the water change volume each time was 30%-40% of the total volume.

[0052] The three groups of golden pomfret were fed different feeds. The first group was fed normal feed, the second group was fed feed containing only α-naphthoflavone, and the third group was fed feed containing α-naphthoflavone and 17α-methyltestosterone. The fish were fed when they were full and were fed twice a day at 8:00 a.m. and 15:00 p.m.

[0053] Among them, the puffed feed prepared in Example 1 with a diameter of 1.0-2.0 mm was used for 2-5 months of age, and the puffed feed prepared in Example 1 with a diameter of 5-10 mm was used for 6-8 months of age.

[0054] Example 3 Gonadal development detection When the golden pomfret in the experiment in the above embodiment was raised to 8 months old, 18-21 golden pomfret with a size of 150-250 g were randomly selected from the three groups, the tail fin rays were cut and placed in anhydrous alcohol, and the gonad tissue was fixed in paraformaldehyde.

[0055] 1. Genetic sex identification: After extracting the genome from the tail fin of the golden pomfret, the genetic sex of each fish was identified using sex-related DNA markers. The specific method is as follows.

[0056] 1.1 Extraction of genomic DNA from the caudal fin of golden pomfret: 1) Place 1cm 2 Add 300 μL Hom buffer (cell lysis buffer, proteinase K) to the fins; Digest in a 65°C constant temperature metal bath for more than 3 hours, shaking every 15 minutes until the fins are completely dissolved; 3) Add 300 μL 4.5 M NaCl solution and 180 μL 24:1 nucleic acid extraction reagent (29.78 g Na 2 EDTA·2H 2 O, 12.11g Tris-base, 5g SDS and 20 mg proteinase K, dissolved in 1 liter ultrapure water), vortex thoroughly to mix; 4) Centrifuge at 10,000 rpm for 5 min, take 700 μL of the supernatant, add an equal volume of isopropanol, mix well, and place at -20°C for precipitation for more than 2 h; Centrifuge at 13000rpm for 10min, discard the supernatant and add 1mL 70% alcohol to rinse. 6) Centrifuge at 13000rpm for 5min, discard the supernatant, dry at room temperature and add 80μL ddH 2 O, after being fully mixed, the concentration of DNA was detected and placed in a 4°C refrigerator for use as the golden pomfret genome.

[0057] 1.2 Sex identification method: Identification using chain polymerase reaction (PCR) experiment: The PCR system is shown in Table 1.

[0058] Table 1 PCR system

[0059] Forword primer: CATGGACAAGAAGGTGGTGC (SEQ ID NO: 1); Reverse primer: TACCCAGTGCAAGCTCTCTC (SEQ ID NO: 2).

[0060] The PCR program is shown in Table 2.

[0061] Table 2 PCR program

[0062] After the PCR program is completed, the PCR product is added to 6× loading buffer for agarose gel electrophoresis detection. The band size is about 165 bp. Figure 1 shown.

[0063] The PCR products were sequenced by Sanger sequencing. The sequencing results were opened with chromas software. Genetic males were A / A and genetic females were A / G, respectively. Figure 2 Middle A and Figure 2 As shown in B.

[0064] The nucleotide sequence of the product is: CATGGACAAGAAGGTGGTGCTGATCACAGGCTGCTCCTCGGGAATCGGTCTCAGCCTGGCTGTCCGGTTAGCATCTGACCCCGACAAAACATTCAAAGATAACAGCCCACATCTACACACAATGATGGACCTTTGTTGTATTTCCGAGAGAGCTTGCACTGGGTA (SEQ ID NO: 3).

[0065] Among them, the 99th position is the sex detection site of golden pomfret, the genetic male is A / A, and the genetic female is A / G.

[0066] This site has been demonstrated and published in https: / / doi.org / 10.1016 / j.aquaculture.2021.737044. 2. Biological sex identification: paraffin section and H&E staining method 2.1 Preparation of tissue wax blocks 1) Tissue fixation: The obtained gonadal tissue was fixed in 4% paraformaldehyde at room temperature for more than 24 h.

[0067] 2) Tissue rinsing: Place the tissue in a sample frame and rinse slowly with running water for 5 minutes to remove the remaining fixative on the tissue.

[0068] 3) Gradient dehydration of tissue: soak in 60% alcohol for 4 h, 70% alcohol for 12 h, 80% alcohol for 2 h, 90% alcohol for 2 h, 95% alcohol I for 1.5 h, 95% alcohol II for 1 h, 100% anhydrous ethanol I for 30 min, 100% anhydrous ethanol II for 30 min, benzene alcohol solution (volume ratio 1:1) for 10 min, xylene I for 7 min, and xylene II for 7 min.

[0069] 4) Tissue wax immersion and embedding: immersion in paraffin I for 1 h; immersion in paraffin II for 1 h; immersion in paraffin III for 1 h.

[0070] Finally, use tweezers to embed the tissue in the mold, place it at room temperature, and take it out after it is completely solidified for later use. 2.2 Tissue sectioning 1) Adjust the water temperature of the sheet spreading machine to 40ºC and set aside.

[0071] 2) Carefully trim the wax block with a scalpel and set aside.

[0072] 3) Fix the wax block on the paraffin slicer and slowly trim it with the slicer (20 μm). After cutting into the tissue, perform formal slicing with a thickness of 5 μm.

[0073] 4) Place the tissue slices in the water tank of a slide spreader to flatten them, remove them with a glass slide, and observe the tissue morphology under a microscope, and select tissue samples with complete morphology.

[0074] 5) Place the slide containing the tissue section in a 65ºC oven for 2 h and store at room temperature for later use.

[0075] 2.3 Hematoxylin & eosin staining (H&E staining) 1) Place the gonadal tissue sections in a 65ºC oven for 10 min, then dewax the tissue and place the sections in xylene I, xylene II, and xylene III for 15 min each.

[0076] 2) To remove xylene, place the slides in anhydrous ethanol I, anhydrous ethanol II and 75% ethanol for 5 minutes each.

[0077] 3) Rinse slowly with distilled water for 5 minutes to remove the residual ethanol on the slide; place it in a dye tank containing hematoxylin for 3 minutes to stain the cell nucleus.

[0078] 4) Rinse slowly with tap water for 5-10 minutes to remove the residual hematoxylin on the slide.

[0079] 5) Place in differentiation solution (1% hydrochloric acid, volume ratio of tap water to concentrated hydrochloric acid 1:99) for 5 s.

[0080] 6) After rinsing with tap water for 5 min, place it in bluing solution (1% ammonia water, volume ratio of tap water to concentrated ammonia water 1:99) for 5 s.

[0081] 7) After slowly rinsing with tap water for 5 minutes, place in 90% anhydrous ethanol for 5 minutes and stain with eosin solution for 2 minutes.

[0082] 8) Anhydrous ethanol I, anhydrous ethanol II and n-butanol for 5 min each.

[0083] 9) Place the slides in xylene for 5 min, seal with neutral gum, place in a fume hood for 24 h, and then observe under a microscope and take photos.

[0084] 3. Experimental Results The gonad sections and H&E staining results of the control and experimental groups are shown in Figure 3 shown.

[0085] Among them, 18 were detected in the naphthoflavone treatment group. The genetic sex was detected by sex markers and divided into 2 types, including 9 genetic males and 9 genetic females. Then paraffin sections and HE staining were used to detect their physiological sex; 9 genetic males were all males; 9 genetic females, 6 of which were still female (such as Figure 3 Only 3 of them underwent sex reversal to become males (as shown in C). Figure 3 (shown in D).

[0086] A total of 21 fish were tested in the α-naphthoflavone and 17α-methyltestosterone mixed group. The genetic sex was detected by sex markers and divided into 2 types, including 10 genetic males and 11 genetic females. Then, their physiological sex was detected by paraffin section and HE staining; among the 11 genetic females, only 4 were still physiological females (such as Figure 3 E), but physiological males have 7 (as shown in Figure 3 (as shown in F in the figure).

[0087] It can be seen that the reversal efficiency of α-naphthoflavone alone is 33.33%, while the reversal efficiency of the α-naphthoflavone and 17α-methyltestosterone mixed group is 63.6%. Compared with the use of α-naphthoflavone alone, the sex reversal rate is more than doubled, and the number and maturity of sperm in the testes of pseudomale fish are significantly improved.

[0088] Furthermore, the survival rates of the three groups of golden pomfret were as follows: Figure 4 As shown, there was no significant difference in the survival rate between the α-naphthoflavone group and the mixed group and the normal control group, indicating that the hormone treatment had no obvious effect on the growth status of the golden pomfret and was relatively safe.

Claims

1. A method for creating a pseudo-male golden pomfret, The following steps are involved: Female golden pomfret were induced using α-naphthoflavone and 17α-methyltestosterone; The induction is to add α-naphthoflavone and 17α-methyltestosterone to the feed and then feed the female golden pomfret.

2. The method according to claim 1, Features: The content of α-naphthoflavone in the feed is 180-220 mg / kg.

3. The method according to claim 1, Features: The content of 17α-methyltestosterone in the feed is 80-120 mg / kg.

4. The method according to claim 1, Features: The feeding begins when the female golden pomfret is 55 to 65 days old.

5. The method according to claim 4, Features: The feeding time is 160 to 200 days.

6. The method according to claim 1, Features: The feeding method is feeding after satiation.

7. A feed for producing golden pomfret pseudomale fish, Features: The feed includes α-naphthoflavone and 17α-methyltestosterone; The content of α-naphthoflavone in the feed is 180-220 mg / kg; The content of 17α-methyltestosterone in the feed is 80-120 mg / kg.

8. The method for preparing the feed according to claim 7, The following steps are involved: Dissolve α-naphthoflavone and 17α-methyltestosterone, spray them into the base feed of golden pomfret, mix them and dry them.

9. Use of the feed according to claim 7 in improving the breeding efficiency of golden pomfret.

10. A method for raising golden pomfret, The following steps are involved: The golden pomfret is fed with the feed according to claim 7 at 55 to 65 days of age and the feeding is continued for 160 to 200 days.

Images