Application of digoxin in preparation of medicine for treating malignant myeloid leukocyte proliferation related diseases

Abstract

The invention relates to application of digoxin in preparation of a medicine for treating malignant myeloid leukocyte proliferation related diseases, the digoxin can be specifically combined with GATA2 protein, and degradation of the GATA2 protein is promoted through an autophagy-lysosome way. The digoxin disclosed by the invention has an effect of promoting the degradation of GATA2 protein in acute myelogenous leukemia cells, and can be used for promoting the apoptosis of a plurality of acute myelogenous leukemia cell lines (Molm13, KG-1a, MV411, OCIAML3, THP1 and Kasumi-1) at the same time. The digoxin provided by the invention has a good effect of promoting the degradation of the GATA2 protein, and can specifically inhibit the GATA2 protein in AML (acute myelogenous leukemia).

Description

Technical Field

[0001] The invention belongs to the field of medicine, and particularly relates to the use of digoxin in preparing a GATA2 inhibitor, and more particularly to the use of digoxin in preparing a drug for treating acute myeloid leukemia. Background Art

[0002] Acute myeloid leukemia (AML) is a malignant blood disease with an annual incidence of 4.3 / 100,000 people. The median survival time of AML is 8.5 months, and the 5-year OS is only 24%. The long-term survival rate of elderly AML patients over 60 years old is even lower. Currently, traditional chemotherapy, immunotherapy, targeted therapy, and hematopoietic stem cell transplantation continue to improve the complete remission rate and long-term survival rate of AML. However, refractory relapsed AML and elderly AML are still challenges. Therefore, new strategies, such as small molecule drugs and the addition of a third drug to improve the remission rate, are needed, which is of great significance.

[0003] GATA2 is one of the most important transcription factors involved in hematopoietic differentiation and plays a key role in maintaining the proliferation and survival of hematopoietic stem and progenitor cells. Compared with normal hematopoietic cells, GATA2 expression in AML cells is significantly increased, and its high expression is closely related to poor prognosis. Studies have shown that GATA-2 levels can affect the response to chemotherapy by regulating the quiescent state and apoptosis of hematopoietic stem cells. High expression of GATA2 can lead to poor prognosis in AML. Therefore, exploring GATA2 inhibitors and effectively reducing GATA2 levels in AML cells have potential value for the treatment of AML.

[0004] Digoxin belongs to the class of cardiac glycosides. It is the only digitalis preparation approved by the FDA after rigorous placebo-controlled clinical trials (DIG) and has a long history of use in the treatment of heart disease. Its molecular formula is C 41 H 64 O 14 , molecular weight is 780.95. Current research has found that in addition to treating heart disease, digoxin has a wide range of anti-tumor effects, but the specific mechanism of action is still under in-depth exploration. We found that digoxin can directly bind to the GATA2 protein of AML cells and rapidly degrade GATA2, thereby achieving the effect of anti-acute leukemia. This result has not been reported at home and abroad. It has good application prospects. Summary of the invention

[0005] The present invention aims to provide an application of digoxin in the preparation of a drug for treating acute myeloid leukemia, wherein the digoxin can directly bind to GATA2 protein at an extremely low concentration, promote the degradation of GATA2 protein through the autophagy lysosome pathway, and induce AML cell apoptosis. In addition, digoxin can also penetrate the blood-brain barrier, and has important value for high-risk refractory AML (prone to central infiltration). The digoxin of the present invention is convenient to source, low in cost, and has good application prospects.

[0006] The present invention provides the use of digoxin in preparing a GATA2 inhibitor.

[0007] In one embodiment according to the present invention, the GATA2 inhibitor promotes GATA2 degradation in cells.

[0008] In one embodiment according to the present invention, the half inhibitory concentration of digoxin in the Molm-13 cell line for GATA2 is 207.9±12.26 nM, and the half inhibitory concentration of digoxin in the THP1 cell line for GATA2 is 113.1±7.32 nM.

[0009] The present invention also provides the use of digoxin in preparing medicines for treating diseases related to malignant proliferation of myeloid leukocytes.

[0010] In one embodiment according to the present invention, the disease is acute myeloid leukemia.

[0011] The present invention further provides a GATA2 inhibitor, which comprises digoxin; in one embodiment according to the present invention, the GATA2 inhibitor can promote the degradation of GATA2 in cells.

[0012] The present invention also provides a pharmaceutical composition for treating diseases related to malignant proliferation of myeloid leukocytes, comprising digoxin and a pharmaceutically acceptable excipient.

[0013] In one embodiment of the present invention, the disease related to malignant proliferation of myeloid leukocytes is acute myeloid leukemia.

[0014] The digoxin of the present invention can specifically and directly bind to GATA2 protein, and promote GATA2 protein degradation through the autophagy-lysosome pathway. The applicant's experiment verified that digoxin has the effect of promoting GATA2 protein degradation in acute myeloid leukemia cell lines Molm-13 and THP1, and confirmed that digoxin has the effect of promoting apoptosis of multiple acute myeloid leukemia cell lines (Molm13, KG-1a, MV411, OCIAML3, THP1, Kasumi-1). The digoxin of the present invention is used to promote GATA2 protein degradation. The effect is good, and GATA2 protein can be specifically inhibited in AML.

[0015] Digoxin is an FDA-approved drug that is easily available and has low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The effect of digoxin on the proliferation and apoptosis of AML cells;

[0017] Figure 2 Digoxin promotes the decrease of GATA2 protein in AML cells;

[0018] Figure 3 Digoxin promotes GATA2 degradation through the autophagy-lysosome pathway;

[0019] Figure 4 Digoxin directly binds to GATA2 to promote degradation. DETAILED DESCRIPTION

[0020] Reagents:

[0021] Digoxin, MG132, CQ, 3MA, MLN4924, and MLN7243 were purchased from MCE;

[0022] Human AML cell lines Molm13, KG-1a, MV411, OCIAML3, THP1, and Kasumi-1 were purchased from ATCC;

[0023] GATA2, Tubulin, and PI antibodies were purchased from Bio-Tech;

[0024] IMDM medium, 1640 medium, and newborn calf serum were purchased from Gibco;

[0025] The qPCR kit was purchased from BD;

[0026] The proteome sequencing was commissioned to Lianchuan Biotechnology Co., Ltd.

[0027] Other reagents in this example were of commercially available analytical grade.

[0028] Example 1: Effects of digoxin on proliferation and apoptosis of AML cells

[0029] 1.1 Experimental methods

[0030] Molm13, MV411, OCIAML3, THP1, Kasumi-1 cells were cultured in the following system: 1640 medium + 20% fetal bovine serum + 1% double antibody; KG-1a cells were cultured in the following system: IMDM medium + 20% fetal bovine serum + 1% double antibody; human bone marrow cell culture system: after lysing red blood cells, 1640 medium + 20% human AB serum + 1% double antibody. Cell proliferation level determination: The initial concentration of each cell line was 1×106 / ml, and the digoxin treatment concentrations were 0nm, 2nm, 10nm, 20nm, 50nm, and 100nm. Cells were counted 48h after treatment and IC50 was calculated. Cell death flow cytometry level determination: The initial concentration of each cell line and human bone marrow cells was 1×10 6 / ml, the digoxin treatment concentration was 0nm, 20nm, 50nm, and 100nm. After 48h, the cells were collected, the supernatant was discarded, and PI staining solution was prepared, that is, 1μL PI was added to 100μL Binding buffer system, 100μL staining solution was added to each sample, and the samples were stained at room temperature for 30min before analysis and detection by flow cytometry.

[0031] 1.2 Experimental Results

[0032] The cell proliferation curve results showed that digoxin could significantly limit and inhibit the proliferation of various AML cell lines, and the IC50 of each cell line fluctuated between 15-30nM ( Figure 1 A in the middle). The results of flow cytometry cell death analysis showed that digoxin 100nM could significantly increase the cell death rate of each cell line from 4.69% to 10.5% to 51.4% to 82.9% ( Figure 1 Middle B). Digoxin 200nM can also increase the cell death rate of human AML bone marrow cells by 127.44% ( Figure 1 Middle C).

[0033] Conclusion: AML cells are very sensitive to digoxin. Extremely low concentrations of digoxin can inhibit the proliferation of AML cells and significantly increase their cell death.

[0034] Example 2: Digoxin promotes the decrease of GATA2 protein in AML cells

[0035] 2.1 Experimental methods

[0036] Using Molm13 cell line, digoxin (1um) intervention and blank control, samples were sent to Lianchuan Company for proteome sequencing 6 hours later, and differentially expressed proteins were analyzed. Among the proteins with expression differences greater than 2 times, proteins closely related to AML were found by consulting literature. Proteins were extracted from cell lines and human AML bone marrow cells, and Western blot verification was performed under different concentrations of digoxin intervention. The specific steps include:

[0037] 1. 6 hours after digoxin treatment, cell samples were lysed using RIPA lysis buffer and boiled in boiling water for 5 minutes. Protein concentration was determined by BCA method.

[0038] 2. Sample electrophoresis: add 5× loading buffer to the sample, apply electrophoresis at 60V for 30 minutes, then at 110V for 90 minutes;

[0039] 3. Transfer the sample in the gel to the PVDF membrane under electric field conditions (200mA, 1 hour);

[0040] 4.5% skim milk powder was used for blocking for 1 hour;

[0041] 5. Incubate with primary antibody at 4°C overnight;

[0042] 6. After washing the membrane, incubate the secondary antibody at room temperature for 1 hour;

[0043] 7. After washing the membrane, add developer, expose and take photos. After 6 hours of intervention with different concentrations of digoxin in Molm13 and THP1 cell lines, qPCR was used to detect the changes in the mRNA levels of gata2 and its downstream target genes evi, scl, and wt1, with gapdh as an internal reference. The specific steps include: 1). Synthesize gata2, evi, scl, and wt1 qPCR primers:

[0044] h-GATA2-qPCR-F: TTCAATCACCTCGACTCGC;

[0045] h-GATA2-qPCR-R:GCTGTGCAACAAGTGTGG;

[0046] h-EVI-qPCR-F: ATGGCGTACAGTCAAGGAGG;

[0047] h-EVI-qPCR-R: TGCGGATTCTATGAGGCTTCA;

[0048] h-SCL-qPCR-F: CCTGGCATTGACCCATAGCC;

[0049] h-SCL-qPCR-R: CTCTTGGTGAAGCCTTGCATA;

[0050] h-WT1-qPCR-F:CAGTTCCCCAACCACTCATT;

[0051] h-WT1-qPCR-R: AAGCTGGGATGTCATTTGGT;

[0052] 2). After 6 hours of digoxin treatment, RNA was extracted from the cell samples; 3). Reverse transcription was performed to construct a cDNA library;

[0053] 4).qPCR reaction.

[0054] 2.2 Experimental Results

[0055] The results of proteomic sequencing and differential protein analysis showed that after digoxin intervention, there were 270 down-regulated proteins in Molm13 cells, of which 87 proteins were down-regulated by ≥2 times. By consulting the literature, 11 proteins closely related to AML were obtained, among which GATA2 had the highest down-regulation fold, 4.44 times, and played an extremely important role in the pathogenesis of AML ( Figure 2 Western blot results of cell lines showed that the half-inhibitory concentration of digoxin in Molm-13 cell line was 207.9±12.26nM, and the half-inhibitory concentration of GATA2 in THP1 cell line was 113.1±7.32nM ( Figure 2 Middle B). Western blot results of human AML bone marrow cells showed that treatment with digoxin (1uM) for 6h could reduce the GATA2 protein level of AML cells by an average of 0.55 times ( Figure 2 Middle C). The qPCR reaction results showed that under the intervention of digoxin, while the GATA2 protein level decreased significantly, the GATA2 mRNA level did not decrease at the same time, and the mRNA level of the downstream target gene decreased significantly ( Figure 2 (middle D).

[0056] Conclusion: Digoxin can reduce the GATA2 protein level in AML cells in a short time; digoxin exerts its anti-AML effect by reducing the GATA2 protein level rather than the mRNA level.

[0057] Example 3: Digoxin promotes GATA2 degradation via the autophagy-lysosome pathway

[0058] 3.1 Experimental methods

[0059] Molm-13 and THP1 cell lines were selected, and digoxin 1uM and 500nM were used for intervention for 6h. At the same time, MG132 (10uM, proteasome inhibitor), CQ (10uM, autophagy-lysosome inhibitor), MLN4924 (5uM, ubiquitination inhibitor), MLN7243 (1uM, ubiquitin inhibitor), and 3MA (5mM, autophagosome inhibitor) were added respectively. Western blot was used to detect changes in GATA2 protein levels, and α-Tubulin was used as an internal reference.

[0060] 3.2 Experimental Results

[0061] like Figure 3As shown, the Western blot results of the two cell lines indicated that CQ and 3MA could significantly restore the degradation effect of digoxin on GATA2 protein.

[0062] Conclusion: Digoxin can promote the degradation of GATA2 through the autophagy-lysosome pathway.

[0063] Example 4: Digoxin can act as a GATA2 inhibitor and directly bind to GATA2 to promote degradation

[0064] 4.1 Experimental methods

[0065] The GATA2 functional domain was found on the PDB website (https: / / www.rcsb.org / structure / 5O9B, https: / / www.rcsb.org / structure / 6ZFV), the digoxin molecular structure was found on the PubChem website (https: / / pubchem.ncbi.nlm.nih.gov / compound / 2724385), and the reported protein sequence sites related to GATA2 protein stability were found in the literature. The molecular docking prediction of digoxin and GATA2 was performed using DOCK software. The THP1 cell line was selected and a cell thermal migration experiment was performed under the intervention of digoxin. The specific steps are as follows: 1. THP1 cells were treated with digoxin at a concentration of 500nM for 30min; 2. The cell suspension was heated at different temperature gradients (room temperature, 52, 55, 58, 61, 64, 67, 70℃) for 3min and then rapidly cooled and solidified with liquid nitrogen; 3. After thawing at room temperature, cell lysis, protein electrophoresis, primary and secondary antibodies were applied and developed. This step was the same as Western blot.

[0066] 4.2 Experimental Results

[0067] The functional domains of GATA2 are 5O9B at the C-terminus and 6ZFV at the N-terminus. Figure 4 A), the molecular formula of digoxin is C41H64O14, the molecular weight is 780.95, and the molecular structure is shown in Figure 4 Middle B. Molecular docking prediction results suggest that there are 13 functional domains between digoxin and GATA2. The results of cell thermal migration experiments indicate that as the temperature rises, the rate of decrease in GATA2 protein expression slows down significantly after the addition of digoxin compared with the control group.

[0068] Conclusion: Digoxin can act as a GATA2 inhibitor, directly bind to GATA2 protein and degrade GATA2.

Claims

1. The use of digoxin in the preparation of drugs for treating diseases related to malignant proliferation of myeloid leukocytes.

2. The use according to claim 1, characterized in that: The disease is acute myeloid leukemia.

3. Application of digoxin in the preparation of GATA2 inhibitors.

4. The use according to claim 3, characterized in that The GATA2 inhibitor promotes GATA2 degradation in cells.

5. The use according to claim 1 or 2, characterized in that: The half-inhibitory concentration of digoxin in the Molm-13 cell line for GATA2 is 207.9±12.26 nM, and the half-inhibitory concentration of digoxin in the THP1 cell line for GATA2 is 113.1±7.32 nM.

6. A GATA2 inhibitor comprising digoxin; preferably, the GATA2 inhibitor can promote the degradation of GATA2 in cells.

7. A pharmaceutical composition for treating diseases related to malignant proliferation of myeloid leukocytes, comprising digoxin and a pharmaceutically acceptable excipient.

8. The pharmaceutical composition according to claim 7, wherein the disease associated with malignant proliferation of myeloid leukocytes is acute myeloid leukemia.

Images