Application of ISG15-(H4)2-IFN-λ3 recombinant protein in the preparation of drugs for preventing and treating PRRSV infection

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to the application of ISG15-(H4)2-IFN-λ3 recombinant protein in the preparation of drugs for preventing and treating PRRSV infection. The present invention selects (H4)2 connecting peptide to connect ISG15 and IFN-λ3 to prepare ISG15-(H4)2-IFN-λ3 recombinant protein, which can achieve stable and large-scale expression of IFN-λ3 protein, solves the technical problem that IFN-λ3 cannot be mass-produced using a prokaryotic expression system, and at the same time, the present invention verifies the anti-PRRSV activity of ISG15-(H4)2-IFN-λ3 recombinant protein in vivo, proving that the recombinantly expressed ISG15-(H4)2-IFN-λ3 recombinant protein has an inhibitory effect on inhibiting the replication of PRRSV in vivo, reduces the secretion of inflammatory factors in the lungs and improves the viremia caused by PRRSV infection.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to ISG15-(H4) 2 -Application of IFN-λ3 recombinant protein in the preparation of drugs for preventing and treating PRRSV infection. Background Art

[0002] Porcine Reproductive and Respiratory Syndrome (PRRS) is a highly contagious disease caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), characterized by dyspnea in pregnant sows, abortion, stillbirth, weak or mummified fetuses, and slow growth of piglets. Because the ears of sick pigs are cyanotic and purple, this disease is also called "blue ear disease". PRRSV has the characteristics of rapid mutation and difficulty in prevention and control. Unlike swine influenza virus infection, PRRSV can regulate the body's natural immune response to cause immunosuppression, and the prevention and control effect of vaccines is not ideal. The clinical symptoms of PRRS are mainly dyspnea and reproductive disorders in sows, and slow growth of piglets. It has a very high mortality rate for newborn piglets and sows, seriously endangering the healthy development of the pig industry. PRRSV has the characteristics of rapid mutation and difficulty in prevention and control. The immune protection of inactivated vaccines is weak, and the attenuated vaccine has the phenomenon of virulence reversion, resulting in the overall protection effect of PRRSV vaccines being not ideal. Therefore, achieving effective prevention and control of PRRSV is still a difficult problem that needs to be solved urgently.

[0003] Interferon (IFN) is a large class of proteins with antiviral activity produced by cells under the action of viruses or other stimulatory factors. It has a broad spectrum of antiviral and immunomodulatory effects and plays an important role in the natural immune response. IFN can be divided into three major families according to its coding gene sequence and receptor type: IFN-Ⅰ, IFN-Ⅱ, and IFN-Ⅲ. IFN-Ⅲ (IFN-λ) is a newly discovered interferon subtype in recent years. Its antiviral function and mechanism are similar to IFN-Ⅰ (IFN-α / β), but unlike IFN-α / β, which can act on systemic tissues, IFN-λ mainly acts on epithelial cells, especially epithelial cells in the lungs, gastrointestinal tract and kidneys, thereby avoiding systemic inflammatory responses like IFN-Ⅰ. Therefore, it is considered to have the potential to be superior to IFN-α / β in the treatment of certain viral infectious diseases (such as respiratory infections), and has become a hot spot in antiviral treatment research in recent years. Among viral infectious diseases of pigs, most viruses infect through the respiratory tract and gastrointestinal tract, and IFN-λ acts on the "front line" of such diseases. Therefore, the development of IFN-III preparations is of great significance for the prevention and treatment of viral diseases of pigs.

[0004] At present, in addition to separation from pig leukocytes, the production of IFN mainly relies on genetic engineering methods for expression and purification. The target gene of IFN is inserted into the host gene to induce the host gene to express IFN, and then purified by a certain method to obtain IFN. Commonly used IFN expression systems include Escherichia coli expression system, yeast expression system, baculovirus expression system, adenovirus expression system, etc. The protein activity produced by baculovirus and yeast expression systems is better than that of Escherichia coli expression system, and can be correctly folded and exert biological activity, but the protein expression level is low, the production cycle and production cost are high, and it is difficult to produce and apply on a large scale. The Escherichia coli expression system has low production cost, short production cycle, and high protein expression level. Therefore, the expression of IFN using the Escherichia coli expression system is more suitable for application in production practice. However, proteins produced by the E. coli expression system are mostly expressed as inclusion bodies, which are difficult to fold correctly and renature successfully. For example, Lian Danhua (“Expression, Purification and Activity Identification of Type III Interferon IFN-λ” [D]) constructed a BL21 / pET26b(+) / IFN-λ3 prokaryotic expression strain and successfully induced soluble IFN-λ3 recombinant protein using 1 μg / mL IPTG inducer, but the overall expression level of the recombinant protein in the periplasm was low.

[0005] Therefore, how to achieve large-scale production of IFN-λ3 is a major technical problem faced in the development of IFN-Ⅲ preparations. Summary of the invention

[0006] In order to solve the problem that the prior art lacks effective prevention and treatment methods for PRRSV infection and the problem that IFN-λ3 is difficult to produce on a large scale, the present invention aims to provide an ISG15-(H4) 2 -IFN-λ3 recombinant protein was used to prepare drugs for the prevention and treatment of PRRSV infection, verifying its specific efficacy.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides ISG15-(H4) 2 -Application of IFN-λ3 recombinant protein in the preparation of drugs for preventing and treating PRRSV infection, by connecting peptide (H4) 2 Linking ISG15 to IFN-λ3, the ISG15-(H4) 2 -The amino acid sequence of the IFN-λ3 recombinant protein is shown in SEQ ID NO.1.

[0009] Furthermore, the drug has the effects of inhibiting the replication of PRRSV and having anti-PRRSV activity.

[0010] Furthermore, the drug has the effect of alleviating lung lesions and has a therapeutic effect on piglets infected with PRRSV.

[0011] Furthermore, the drug can improve the viremia of piglets.

[0012] Furthermore, the drug can reduce the expression and secretion of inflammatory factors in the lungs and has a good anti-inflammatory effect.

[0013] Further, encoding ISG15-(H4) 2 -The nucleotide sequence of the IFN-λ3 recombinant protein is shown in SEQ ID NO.2.

[0014] Furthermore, the ISG15-(H4) 2 The method for preparing the IFN-λ3 recombinant protein comprises the following steps:

[0015] 1) Clone the nucleotide sequence shown in SEQ ID NO.2 into the vector to construct the recombinant vector - ISG15-(H4) 2 -IFN-λ3;

[0016] 2) Insert the recombinant vector-ISG15-(H4) 2 -IFN-λ3 transformed E. coli to obtain ISG15-(H4) 2 - Recombinant bacteria of IFN-λ3 recombinant protein;

[0017] 3) Induce expression to obtain ISG15-(H4) 2 -IFN-λ3 recombinant protein.

[0018] Furthermore, the ISG15-(H4) 2 The method for preparing the IFN-λ3 recombinant protein comprises the following steps:

[0019] 1) The nucleotide sequence shown in SEQ ID NO.2 was cloned into the pET-28a vector to construct the recombinant vector pET-28a-ISG15-(H4) 2 -IFN-λ3;

[0020] 2) Insert the recombinant vector pET-28a-ISG15-(H4) 2 -IFN-λ3 was transformed into E. coli BL21 (DE3) to obtain ISG15-(H4) 2 - Recombinant bacteria of IFN-λ3 recombinant protein;

[0021] 3) Induce expression to obtain ISG15-(H4) 2 -IFN-λ3 recombinant protein.

[0022] Furthermore, the ISG15-(H4) 2 -IFN-λ3 recombinant protein preparation method comprises the following steps: recombinant vector pET-28a-ISG15-(H4) 2 -IFN-λ3 was transformed into competent cells BL21 (DE3) to obtain recombinant bacteria, and ISG15-(H4) was obtained by induced expression 2 -IFN-λ3 recombinant protein.

[0023] In a second aspect, a drug for preventing and treating PRRSV infection is provided, wherein the drug contains a safe and effective amount of ISG15-(H4) 2 -IFN-λ3 recombinant protein, ISG15-(H4) 2 -The amino acid sequence of the IFN-λ3 recombinant protein is shown in SEQ ID NO.1.

[0024] Further, encoding ISG15-(H4) 2 -The nucleotide sequence of the IFN-λ3 recombinant protein is shown in SEQ ID NO.2.

[0025] Furthermore, the drug has the effect of inhibiting the replication of PRRSV and the anti-PRRSV activity; or the drug has the effect of alleviating lung lesions.

[0026] Compared with the prior art, the beneficial effects of the present invention are:

[0027] The present invention selects different connecting peptides: RL, HL, (H4) 2 , ISG15 was linked to IFN-λ3 to promote the biological activity of ISG15-IFN-λ3. Studies have shown that after ISG15 and IFN-λ3 were linked through RL and HL, although the protein expression level was increased, a large amount of precipitation occurred in PBS and it was difficult to successfully renature. (H4) 2 ISG15-(H4) linked to peptide 2 -IFN-λ3 recombinant protein was successfully renatured and dialyzed into PBS, and the expression level and stability were significantly improved. Under the same conditions, the present invention selected (H4) 2 The connecting peptide connects ISG15 and IFN-λ3, which can achieve stable and large-scale expression of IFN-λ3 protein, solving the technical problem of not being able to mass-produce IFN-λ3 using a prokaryotic expression system. The yield after purification is more than 4 times that when RL and HL are used as connecting peptides, achieving unexpected technical effects and laying the foundation for large-scale, low-cost mass production of IFN-λ3.

[0028] The present invention is to ISG15-(H4) 2 -IFN-λ3 recombinant protein was validated against PRRSV in vivo, demonstrating that recombinantly expressed ISG15-(H4) 2 -IFN-λ3 recombinant protein has an inhibitory effect on inhibiting the replication of PRRSV in the body, reducing lung lesions, reducing the secretion of inflammatory factors in the lungs and improving viremia caused by PRRSV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solution of the present invention, the drawings involved in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the description are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1a ISG15-(H4) 2 - Expression of IFN-λ3 recombinant protein; A: SDS-PAGE identification; B: Western Blot identification; M: protein marker; 1: without IPTG induction; 2: IPTG induction; 3: induced supernatant; 4: induced precipitate;

[0031] Figure 1bThe expression of ISG15-HL-IFN-λ3 recombinant protein; A: SDS-PAGE identification; B: Western Blot identification; M: protein marker; 1: without IPTG induction; 2: IPTG induction; 3: induced supernatant; 4: induced precipitate;

[0032] Figure 1c The expression of ISG15-RL-IFN-λ3 recombinant protein; A: SDS-PAGE identification; B: Western Blot identification, M: protein marker; 1: without IPTG induction; 2: IPTG induction; 3: induced supernatant; 4: induced precipitate;

[0033] Figure 1d The expression of IFN-λ3 monomer protein.

[0034] Figure 2 Purification of ISG15-IFN-λ3 fusion protein; A: ISG15-(H4) 2 - Nickel column purification conditions of IFN-λ3 recombinant protein; 1: before protein loading; 2: effluent; 3: 10mM elution; 4: 20mM elution; 5: 50mM elution; 6: 100mM elution; 7: 250mM elution; B: Inclusion body purification of ISG15-RL-IFN-λ3 and ISG15-HL-IFN-λ3; 1: ISG15-RL-IFN-λ3; 2: ISG15-HL-IFN-λ3; C: ISG15-(H4) 2 -IFN-λ3 recombinant protein was dialyzed against PBS; D: ISG15-RL-IFN-λ3 and ISG15-HL-IFN-λ3 were dialyzed against PBS; 1: ISG15-RL-IFN-λ3; 2: ISG15-HL-IFN-λ3.

[0035] Figure 3 ISG15-(H4) 2 -IFN-λ3 [ISG15-(H4) 2 -IFN-λ3 recombinant protein] PAMs cells were pretreated and their anti-PRRSV activity was tested; A: Western blot was used to test the replication level of PRRSV; 1: 0.2 MOI JXA1; 2: 250U ISG15-IFN-λ3 + 0.2 MOI JXA1; 3: 500U ISG15-IFN-λ3 + 0.2 MOI JXA1; 4: 1000U ISG15-IFN-λ3 + 0.2 MOI JXA1; B: Fluorescence quantitative PCR was used to test the replication level of PRRSV.

[0036] Figure 4 ISG15-(H4)2 -IFN-λ3 (ISG15-IFN-λ3) and PRRSV were used to treat PAMs cells simultaneously to test their anti-PRRSV activity; A: Western blot was used to test the replication level of PRRSV; 1: 0.2 MOI JXA1; 2: 250U ISG15-IFN-λ3 + 0.2 MOI JXA1; 3: 500U ISG15-IFN-λ3 + 0.2 MOI JXA1; 4: 1000U ISG15-IFN-λ3 + 0.2 MOI JXA1; B: Fluorescence quantitative PCR was used to test the replication level of PRRSV.

[0037] Figure 5 This is a diagram of the animal experiment plan.

[0038] Figure 6 For body temperature changes.

[0039] Figure 7 is the net weight change.

[0040] Figure 8 These are the observation results of lung lesions.

[0041] Fig. 9 The lung tissues were stained with H&E, and the lesions were observed under a microscope; A: negative control group; B: interferon treatment group; C: challenge control group.

[0042] Fig.10 To detect PRRSV-specific antibodies in pig serum.

[0043] Fig.11 Nasal swab viral load.

[0044] Fig.12 Blood viral load.

[0045] Fig.13 is the viral load of PAMs.

[0046] Fig.14 Changes in gene expression of PAMs. DETAILED DESCRIPTION

[0047] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0048] Example 1

[0049] Recombinant expression and purification

[0050] 1.1 Plasmids and strains

[0051] Plasmid: pET-28a-ISG15-HL-IFN-λ3, pET-28a-ISG15-RL-IFN-λ3, pET-28a-ISG15-(H4) 2 -IFN-λ3 and pET-28a-λ3 recombinant expression plasmids were fully synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0052] The amino acid sequences of the connecting peptides are as follows: the amino acid sequence of the RL connecting peptide is PAPAP, the amino acid sequence of the HL connecting peptide is AEAAAKEAAAKA, (H4) 2 The amino acid sequence of the connecting peptide is LEA(EAAAK) 4 ALEA(EAAAK) 4 ALE.

[0053] Bacteria: Competent cells BL21 (DE3) were purchased from Beijing Transgene Biotechnology Co., Ltd.

[0054] 1.2 Expression of ISG15-IFN-λ3 fusion protein

[0055] 1.2.1 Conversion

[0056] (1) Take out three tubes of competent cells BL21 from -80℃ and place them on ice, waiting for them to thaw naturally;

[0057] (2) Combine pET-28a-ISG15-HL-IFN-λ3, pET-28a-ISG15-RL-IFN-λ3, pET-28a-ISG15-(H4) 2 - Take 1 μL of IFN-λ3 plasmid and add it to three BL21 competent cells respectively, and mark them;

[0058] (3) Ice bath for 30 min, heat shock in 42°C water bath for 90 s, and ice bath for 3 min;

[0059] (4) Add 500 μL of antibiotic-free liquid LB (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, sterilized by high pressure) and incubate at 37°C in a shaking incubator for 20 min;

[0060] (5) Pour the shaken bacterial solution onto the solid LB containing kanamycin, spread it evenly with a spreader, place it upside down in a 37°C constant temperature incubator, and culture it overnight for 12-14 hours.

[0061] 1.2.2 Expression of ISG15-IFN-λ3 fusion protein (recombinant protein)

[0062] (1) Take out the solid LB medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, sterilized by high pressure for later use) and add 10 mL of liquid LB medium to the test tube. 2 -IFN-λ3 colonies on solid LB cultured overnight were picked up with a high-pressure pipette tip and cultured on a shaker at 37°C for 12-14 h;

[0063] (2) Take out the overnight cultured bacterial solution and shake it at a ratio of 1:50, that is, add 200 μL of bacterial solution to 10 mL of liquid LB medium and culture it in a shaking incubator at 37°C; the remaining bacterial solution is preserved in 50% bacterial preserving glycerol at a ratio of 1:1 and stored at -80°C;

[0064] (3) After the bacterial solution is shaken, measure the OD with a spectrometer 600 =0.6-0.8, add IPTG at a ratio of 1:2000 and culture at 37°C in a shaking incubator for 6-8h;

[0065] (4) Place the cultured bacterial solution in a centrifuge tube and centrifuge at 6000 rpm / 5 min / 4°C. Discard the supernatant and resuspend the precipitate in PBS.

[0066] (5) Place the resuspended bacterial solution on an ice-water mixture and crush it with an ultrasonic crusher: power 50W, ultrasonic for 3s, stop for 3s, working time 2min;

[0067] (6) Centrifuge the sonicated bacterial solution at 6000 rpm / 10 min / 4°C, separate the supernatant and inclusion bodies, and dissolve the inclusion bodies with 8 M urea.

[0068] 1.2.3 Expression and identification of ISG15-IFN-λ3 fusion protein

[0069] (1) Prepare three 10% SDS-PAGE gels;

[0070] (2) Sample preparation: ISG15-HL-IFN-λ3, ISG15-RL-IFN-λ3, ISG15-(H4) 2 - Take 40 μL of the IFN-λ3 supernatant and the inclusion bodies dissolved with 8 M urea, place them in a 1.5 mL EP tube, label them, add 10 μL of 5× sample buffer, and boil them in 100°C water for 12 min;

[0071] (3) Electrophoresis: Place the solidified SDS-PAGE gel on the electrode, add 1× running buffer, add 10 μL protein sample and 2 μL protein marker to the gel wells, voltage 100 V, and stop running the gel when the bromophenol blue indicator reaches the lowest end;

[0072] (4) Staining: Add 10 mL of Coomassie Brilliant Blue into the staining box, take out the gel and put it into the box for staining for 10-12 hours;

[0073] (5) Decolorization: discard the Coomassie Brilliant Blue, rinse several times with clean water, boil it with clean water for 2 minutes, boil it 3-4 times; add decolorization solution (formula: 5% ethanol, 10% glacial acetic acid, 85% distilled water), decolorize overnight and observe the results, such as Figure 1a A in Figure 1b A and Figure 1c As shown in A, the experimental results show that ISG15-RL-IFN-λ3, ISG15-HL-IFN-λ3, ISG15-(H4) 2 -IFN-λ3 are all expressed in inclusion bodies. The sizes of ISG15-RL-IFN-λ3 recombinant proteins and ISG15-HL-IFN-λ3 recombinant proteins are about 35kD, and ISG15-(H4) 2 -The size of IFN-λ3 recombinant protein was about 35-45 kD, and the result was consistent with the expectation.

[0074] In addition, according to the same method as above, the pET-28a-IFN-λ3 recombinant expression plasmid was transformed into competent cells BL21 (DE3) for IFN-λ3 protein recombinant expression and identification. Figure 1d As shown, the IFN-λ3 monomer protein (target protein) is about 19 kD in size and is mainly present in the bacterial precipitate after lysis.

[0075] 1.2.4 Identification of His-tag specificity of ISG15-IFN-λ3 fusion protein

[0076] (1) Gel preparation, sample preparation, and electrophoresis are performed as in 1.2.3;

[0077] (2) Transfer: Activate the PVDF membrane with methanol for 1 min, take it out and place it in transfer solution (glycine 29 g / L, Tris 58 g / L, SDS 3.7 g / L), and soak the filter paper and sponge in the transfer solution in advance to wet it; take out the SDS-PAGE gel, open the transfer electrode, and place it in the order from negative electrode to positive electrode: sponge-filter paper-SDS-PAGE gel-PVDF membrane-filter paper-sponge; clamp the electrodes and place them in the electrophoresis tank, add transfer solution to the electrophoresis tank, and place the electrophoresis tank in an ice-water mixture. Transfer the membrane at 100 V for 1 h;

[0078] (3) Blocking: Prepare 5% skim milk powder in advance, place the transferred PVDF membrane in the skim milk powder in a 37°C constant temperature incubator for 1 hour;

[0079] (4) Incubation with primary antibody: dilute the His-Tag antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HT501-01) with PBST at 1:1000 and place in a 50 mL tube; take out the blocked PVDF membrane, place it flat, and incubate it in a constant temperature incubator at 25°C for 1 h;

[0080] (5) Wash the membrane: wash three times with PBST, 5 min each time;

[0081] (6) Incubation with secondary antibody: Dilute Goat@Mouse-HRP antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HS201-01) with PBST at 1:5000 and place in a 50 mL tube; place the PVDF membrane in it and incubate in a constant temperature incubator at 25°C for 1 h;

[0082] (7) Wash the membrane: wash three times with PBST, 5 min each time;

[0083] (8) Color development: Add 20 μL of 30% hydrogen peroxide into 10 mL of ECL luminescent solution, soak the PVDF membrane for 1 min, and expose it to the gel imager. The results are as follows: Figure 1a B in Figure 1b B and Figure 1c As shown in B, ISG15-RL-IFN-λ3, ISG15-HL-IFN-λ3, ISG15-(H4) 2 -IFN-λ3 showed specific reaction with His tag antibody, and the size was consistent with the size of SDS-PAGE protein gel staining.

[0084] 1.3 Purification of ISG15-IFN-λ3 fusion protein

[0085] After expression identification, ISG15-HL-IFN-λ3, ISG15-RL-IFN-λ3, ISG15-(H4) 2 -IFN-λ3 was expressed in inclusion bodies. Therefore, the protein expressed in inclusion bodies was purified by nickel column affinity chromatography.

[0086] 1.3.1 Protein purification by nickel column affinity chromatography

[0087] (1) Treatment of chromatography column: Clean the gasket inside the chromatography column with ultrapure water;

[0088] (2) Treatment of nickel filler: Pipette 1 mL of Ni-NTA beads 6FF filler, add it to the chromatography column, wash it with ultrapure water, and then equilibrate the nickel filler with 10 mL of 8 M urea;

[0089] (3) Nickel-protein incubation: The protein dissolved in 8 M urea was filtered through a 0.45 μm filter, mixed with the nickel filler and incubated at 4 °C overnight for 8-10 h or at room temperature for 2 h;

[0090] (4) Gradient elution: The incubated protein flows out through the chromatography column and the effluent is retained. Use 8M urea and 4M imidazole to prepare eluents of different concentrations: 10mM, 20mM, 50mM, 100mM, 250mM, and elute from low to high. When the protein indicator does not turn blue, change to the next gradient and retain the eluent of each gradient for subsequent identification;

[0091] (5) Gel analysis: Take 40 μL of the protein stock solution, effluent, and each gradient sample and effluent, add 10 μL of 5×Sample buffer, mix well, and boil in boiling water for 12 min; identify the protein by SDS-PAGE gel according to the method in 1.2.3 and determine the elution conditions;

[0092] (6) Dialysis: Place the target protein in a 3 kD dialysis bag and perform gradient dialysis: 6 M urea, 4 M urea, 2 M urea, 1 M urea, PBS. Dialyze each gradient at 4 °C for 4 h.

[0093] 1.3.2 Determination of protein concentration

[0094] (1) Gel analysis: Take 40 μL of the dialyzed protein into PBS, add 10 μL of 5× sample buffer, mix well, and boil in boiling water for 12 min; identify by SDS-PAGE protein gel;

[0095] (2) Determination of protein concentration by BCA method: According to the instructions of the BCA protein assay kit, the standard was diluted with PBS in a gradient manner, 20 μL of the protein to be tested and the diluted standard were added to the ELISA strip, and 200 μL of the working solution was added. The mixture was reacted at 37°C for 15 min, and the OD was measured on a spectrophotometer. 562 The protein concentration was calculated using the protein standard curve.

[0096] ISG15-(H4) 2 -IFN-λ3 was purified by nickel column affinity chromatography and identified by SDS-PAGE. Figure 2 As shown, ISG15-(H4) 2 -IFN-λ3 was eluted at 250 mM imidazole ( Figure 2 In A), ISG15-RL-IFN-λ3 and ISG15-HL-IFN-λ3 were purified by washing inclusion bodies ( Figure 2 B). The target protein was dialyzed in the gradient, identified by SDS-PAGE and the concentration was determined. ISG15-(H4) was found during dialysis. 2 -IFN-λ3 can be stably dialyzed into PBS and does not precipitate after freeze-thawing at -80°C. The concentration is 1.2 mg / mL. Figure 2 As shown in C. ISG15-RL-IFN-λ3 and ISG15-HL-IFN-λ3 precipitated slightly when dialyzed to 2M urea, precipitated in large quantities in PBS, and had poor stability. They were easily precipitated after freeze-thawing at -80°C, with concentrations of 0.27 mg / mL and 0.26 mg / mL, respectively. Figure 2 As shown in D.

[0097] The IFN-λ3 monomer protein obtained by recombinant expression of pET-28a-IFN-λ3 was purified by the same method as above. The results showed that the IFN-λ3 monomer protein could not enter PBS through dialysis.

[0098] The present invention selects different connecting peptides: RL, HL, (H4) 2 , ISG15 was connected to IFN-λ3 to promote the biological activity of ISG15-IFN-λ3. Studies have shown that after ISG15 and IFN-λ3 were connected through RL and HL, although the protein expression was improved, a large amount of precipitation was found in PBS and it was difficult to successfully renature. This may be because the length of the two connecting peptides RL and HL was too short, causing the two domains to interfere with each other and fail to fold correctly, thus causing structural instability. Use (H4) 2 ISG15-(H4) linked to peptide 2 -IFN-λ3 was successfully refolded and dialyzed into PBS, and the expression level and stability were significantly improved. Under the same conditions, the present invention selected (H4) 2 The connecting peptide connects ISG15 and IFN-λ3, which can achieve stable and large-scale expression of IFN-λ3 protein, solving the technical problem that IFN-λ3 cannot be mass-produced using a prokaryotic expression system. The yield after purification is more than 4 times (about 4.4 times and 4.6 times) that when RL and HL are used as connecting peptides. This effect is difficult for technicians in this field to predict, and there is no related report in the prior art.

[0099] Therefore, ISG15-(H4) was chosen 2-IFN-λ3 recombinant protein (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence encoding it as shown in SEQ ID NO.2) can realize large-scale production of IFN-λ3, which is the basis for the development of IFN-Ⅲ preparations. The present invention selects ISG15-(H4) 2 -IFN-λ3 recombinant protein for subsequent experiments.

[0100] Example 2

[0101] ISG15-(H4) 2 -IFN-λ3 recombinant protein was pretreated in PAM cells for 12 hours to test its anti-PRRSV activity

[0102] 2.1 Cell treatment

[0103] (1) Plate: 4×10 cells / well of a 24-well cell culture plate 5 PAMs cells were cultured in 1640 medium containing 10% FBS serum in a 37°C incubator for 3-4 hours and used after the cells adhered to the wall.

[0104] (2) Treatment with IFN: Add ISG15-(H4) in a gradient 2 -IFN-λ3 recombinant protein: 1000 units (50 μg), 500 units (25 μg), 250 units (12.5 μg); leave untreated cells as negative control and culture in a 37°C incubator for 12 h;

[0105] (3) Inoculation: PRRSV JXA1 was inoculated at an MOI of 0.2 per well and incubated at 37°C for 24 h.

[0106] 2.2 Western Blot Detection of ISG15-(H4) 2 -IFN-λ3 recombinant protein against PRRSV

[0107] (1) Sample processing: Treat PAMs cells according to step 2.1. After the treatment, pipette the culture medium into a 1.5 mL EP tube and centrifuge at 300 g for 8 min to obtain suspended cells. Add 50 μL 2×sample buffer to the cells in the culture plate and pipette repeatedly. Discard the culture medium after centrifugation and add the cell lysis buffer in the culture plate. Vortex to mix well and boil in boiling water for 12 min.

[0108] (2) Gel preparation and electrophoresis, see 1.2.3;

[0109] (3) Transfer membrane, see 1.2.4;

[0110] (4) Closed, see 1.2.4;

[0111] (5) Primary antibody: 6D10 (monoclonal antibody against PRRSV-N protein, preserved by Northwest Agriculture and Forestry University) was diluted 1:1000 with PBST, and the PVDF membrane was incubated in a constant temperature incubator at 25°C for 1 h.

[0112] (6) Wash the membrane: wash three times with PBST, 5 min each time;

[0113] (7) Secondary antibody: Dilute Goat@Rabbit-HRP antibody (Quanshijin Biotechnology Co., Ltd., catalog number: HS101-01) with PBST at a ratio of 1:5000, and incubate the PVDF membrane in a constant temperature incubator at 25°C for 1 h;

[0114] (8) Washing the membrane: Wash with PBST three times, 5 min each time;

[0115] (9) Color development: Add 20 μL of 30% hydrogen peroxide into 10 mL of ECL luminescent solution, soak the PVDF membrane for 1 min, and expose it to the gel imager for imaging.

[0116] 2.3 Detection of ISG15-(H4) by quantitative PCR 2 -IFN-λ3 recombinant protein against PRRSV

[0117] (1) Sample treatment: Treat PAMs cells according to step 2.1. After treatment, pipette the culture medium into a 1.5 mL EP tube and centrifuge at 300 g for 8 min. After centrifugation, carefully transfer the cell culture supernatant into a new 1.5 mL EP tube and add an equal amount of Trizol.

[0118] (2) Extraction of total viral RNA: Add 1 / 5 Trizol amount of chloroform to the sample, shake and mix, let stand for 5 minutes, centrifuge at 16000g and 4℃ for 15 minutes, carefully aspirate the top layer of the layered liquid after centrifugation, transfer it to a new 1.5mL EP tube, add an equal amount of isopropanol, mix and precipitate at -20℃ overnight; centrifuge at 16000g and 4℃ for 15 minutes, discard the supernatant; add 500μL of anhydrous ethanol to the tube for washing, centrifuge at 16000g and 4℃ for 5 minutes, discard the supernatant, and repeat washing twice; invert the 1.5mL EP tube on absorbent paper to air dry; add 20μL RNase Free H 2 O water, and measure the concentration;

[0119] (3) Reverse transcription: The reverse transcription system is: template (RNA) 8 μL, 5× PrimeScript RT Master Mix 2 μL, RNase Free H 2 O Up to 10μL; reverse program: 37℃ 25 min, 85℃ 5 s, 4℃ insulation;

[0120] (4) PCR: The reverse transcribed cDNA was diluted 10 times and the target gene was detected by fluorescence quantitative PCR. The fluorescence quantitative PCR system was: SYBR Green Master 7.5 μL, upstream primer F 0.5 μL, downstream primer R 0.5 μL, template (cDNA) 2.5 μL, RNase Free H 2 O 4μL. The PCR program was: 95℃ 10 min, (95℃ 15 s→60℃ 30 s→95℃ 15 s) × 40 cycles. The primer sequences of fluorescence quantitative PCR (targeting PRRSV N gene) were as follows: the upstream primer (5'-3') was: CGGCAATTGTGTCTGTCGTC, and the downstream primer (5'-3') was: TCATGCTGAGGGTGATGATGCTGTG.

[0121] ISG15-(H4) 2 -IFN-λ3 recombinant protein was added to PAMs cells in different gradients: 1000 units (50 μg), 500 units (25 μg), and 250 units (12.5 μg). After 12 h of treatment, PRRSV-JXA1 strain was infected at an MOI of 0.2. At the same time, ISG15-(H4) was not used. 2 - Negative control group infected with PRRSV treated with IFN-λ3 recombinant protein; Figure 3 As shown, Western Blot and quantitative PCR results showed that ISG15-(H4) 2 -IFN-λ3 recombinant protein inhibited PRRSV replication in increasing doses and with ISG15-(H4) 2 -The PRRSV replication level in the IFN-λ3 recombinant protein-treated group was lower than that in the negative control group, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein can inhibit the replication of PRRSV in PAMs cells and has anti-PRRSV activity.

[0122] Example 3

[0123] ISG15-(H4) 2 -IFN-λ3 recombinant protein and PRRSV were added to PAMs to determine its antiviral activity

[0124] 3.1 Cell treatment

[0125] (1) Plate: 4×10 cells / well of a 24-well cell culture plate 5 PAMs cells were cultured in 1640 medium containing 10% FBS serum in a 37°C incubator for 3-4 hours and used after the cells adhered to the wall.

[0126] (2) Add ISG15-(H4) to a 1.5 mL EP tube according to the gradient. 2 -IFN-λ3 recombinant protein: 1000 units (50 μg), 500 units (25 μg), 250 units (12.5 μg), add 0.2 MOI of PRRSV JXA1 strain to each tube, mix well and add to the cells, and culture in a 37°C incubator for 24 hours.

[0127] 3.2 Western Blot Detection of ISG15-(H4) 2 -IFN-λ3 recombinant protein against PRRSV

[0128] The steps are the same as in 2.2. Detect ISG15-(H4) by Western Blot 2 -The ability of IFN-λ3 recombinant protein to inhibit PRRSV replication.

[0129] 3.3 Detection of ISG15-(H4) by quantitative PCR 2 -IFN-λ3 recombinant protein against PRRSV

[0130] The steps are the same as 2.3. Detect ISG15-(H4) by fluorescence quantitative PCR 2 -The ability of IFN-λ3 recombinant protein to inhibit PRRSV replication.

[0131] To verify ISG15-(H4) 2 - Whether IFN-λ3 recombinant protein can still have antiviral activity in PAMs cells when treated with PRRSV simultaneously, and whether ISG15-(H4) 2 -IFN-λ3 recombinant protein was mixed with PRRSV JXA1 at 0.2 MOI in a gradient of 1000 units (50 μg), 500 units (25 μg), and 250 units (12.5 μg) and infected cells for 24 h. 2 - Negative control group infected with PRRSV treated with IFN-λ3 recombinant protein; Figure 4 As shown, Western Blot and quantitative PCR results showed that ISG15-(H4) 2 -IFN-λ3 recombinant protein inhibits PRRSV replication in increasing doses using ISG15-(H4) 2 -The PRRSV replication level in the IFN-λ3 recombinant protein-treated group was lower than that in the negative control group, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein can inhibit the replication of PRRSV in PAMs cells and has anti-PRRSV activity.

[0132] Example 4

[0133] ISG15-(H4) 2 -Verification of the anti-PRRSV activity of IFN-λ3 recombinant protein in vivo

[0134] 4.1 Animal grouping and virus challenge

[0135] (1) Fifteen 4-week-old piglets were divided into three groups, with 5 pigs in each group, namely the interferon treatment group, the virus challenge control group and the negative control group;

[0136] (2) Each piglet in the interferon treatment group was injected intramuscularly with 2 mg of ISG15-(H4) 2 -IFN-λ3 recombinant protein, the challenge control group and the negative control group were injected with 2 mL of PBS solution. 12 hours after the injection, the piglets in the interferon treatment group and the challenge control group were inoculated with PRRSV-JXA1 at the same time, and the interferon treatment group was injected intramuscularly with 2 mg of ISG15-(H4) at 3d, 7d, and 10d after the infection. 2 -IFN-λ3 recombinant protein;

[0137] (3) Serum and nasal swabs were collected every 7 days after infection, and the body temperature and weight changes of the piglets were recorded;

[0138] (4) 21 days after infection, the pigs were euthanized and lung tissue and PAMs cells were collected. For the specific animal experimental protocol, see Figure 5 .

[0139] 4.2 Observation of clinical symptoms

[0140] (1) On the 3rd, 7th, 10th, 14th and 21st days after infection, record the temperature changes of each pig, observe the clinical symptoms and mental state, and keep records;

[0141] (2) Record the initial body weight of each pig and measure the final body weight on day 21 to calculate the net weight gain.

[0142] like Figure 6 As shown in the figure, the body temperature of the negative control group has been in the normal range, and the rising temperature trends of the interferon-treated group and the challenge control group are basically the same. At 3dpi, the body temperature of the piglets all rose to about 41°C, they were depressed, their limbs were weak, they could not get up from the ground, and their food intake decreased; at 7dpi, two piglets in the challenge control group had severe diarrhea, suspected to be accompanied by bacterial infection, and some piglets had cyanosis on the ear tips and limbs; at 14dpi, the symptoms of piglets in each group were significantly improved, the body temperature dropped to 40°C, and the mental state improved; at 21dpi, the piglets in each group basically returned to normal.

[0143] The initial weight of the piglets before the virus challenge and the weight at 21 dpi were recorded, and the total weight gain was calculated. Figure 7 As shown, each pig in the negative control group gained an average of 7.5 kg, while each pig in the interferon-treated group gained an average of 4 kg, and each pig in the challenge control group gained an average of 3.5 kg.

[0144] 4.3 Observation of pathological changes in pig lungs

[0145] (1) 21 days after infection, all pigs in the groups were euthanized and their lung tissues were collected;

[0146] (2) The collected lung tissue was fixed by immersion in 4% paraformaldehyde;

[0147] (3) Embed the soaked lung tissue in paraffin and prepare sections;

[0148] (4) Staining the prepared sections with hematoxylin and eosin;

[0149] (5) Use a microscope to take photos of the completed slices and save them.

[0150] To determine the lung lesions in each group, all piglets were euthanized and dissected for lung removal at 21 dpi. Figure 8 As shown, the lung lesions in the interferon treatment group were milder, with some congestion spots on the edges and slight edema; the lung lesions in the anti-drug control group were severe, with severe congestion and edema in the lung lobes and large congestion spots.

[0151] The lung tissue was stained with H&E and the lesions were observed under a microscope. Fig. 9 As shown in A, the alveolar structure of the negative control group was intact and no lesions occurred. Fig. 9 As shown in B, the lung tissue of the interferon treatment group was slightly abnormal: as shown by the yellow arrow, the alveolar structure was basically intact, only the alveolar epithelial cells of pig 2442# proliferated, inflammatory cell infiltration and serous exudation were visible in the interstitium; as shown by the blue arrow, there was a small amount of inflammatory cell exudation around the blood vessels; as shown by the red arrow, there was slight cellulose exudation in the bronchi, and a small amount of epithelial cells fell off. Fig. 9 As shown in C, the degree of lung tissue damage in the virus-challenged control group was significantly aggravated compared with that in the interferon-treated group: as shown by the yellow arrows, the alveoli of pigs 2470#, 2422#, 2409#, and 2413# shrank and collapsed, the alveolar walls thickened and solidified, the surrounding alveoli fused and expanded to form larger cysts, the alveolar epithelial cells of pig 2453# swelled and fell off, and a large amount of fibrin exudate was found in the alveolar cavity; as shown by the red arrows, a large number of lymphocytes infiltrated around the blood vessels; as shown by the blue arrows, the bronchial epithelial cells swelled and deformed, and a large amount of purulent exudate was seen in the trachea of ​​pig 2453#.

[0152] Combined with the results of lung lesions and H&E staining, the lung damage in the interferon treatment group was significantly milder than that in the challenge control group, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein can alleviate lung lesions and has a therapeutic effect on piglets infected with PRRSV.

[0153] 4.4 Detection of PRRSV-specific antibody content in pig serum

[0154] (1) Coating: PRRSV N protein was diluted with coating solution, 400 ng per well, and incubated at 4°C overnight;

[0155] (2) Blocking: discard the coating solution, wash three times with PBST, 180 μL per well, gently shake the ELISA plate each time, add 5% skimmed milk powder, 200 μL per well, and place in a 37°C constant temperature incubator for 2 h;

[0156] (3) Primary antibody: discard the blocking solution and wash three times with PBST; dilute the collected serum 1:40 with 5% skim milk powder, add 100 μL to each well of ELISA, and place in a 37°C constant temperature incubator for 1 hour;

[0157] (4) Secondary antibody: discard the primary antibody and wash three times with PBST; dilute Goat@Swine-HRP antibody (abcam, catalog number: ab6915) 1:3500 with 5% skim milk powder, add 100 μL to each well of ELISA well, and place in a 37°C constant temperature incubator for 1 h;

[0158] (5) Color development: discard the secondary antibody, wash three times with PBST; add TMB color development solution, 100 μL per well, and time for 15 min;

[0159] (6) Stop: Add 50 μL of 3 M concentrated sulfuric acid to each well and read the OD on a spectrophotometer. 450 value.

[0160] According to the above experimental scheme, blood was collected every 7 days after the piglets were challenged with the virus and the serum was separated. The PRRSV N protein antibody in the serum was determined by ELISA to determine the difference in PRRSV antibodies between the challenge control group and the interferon treatment group. Fig.10 As shown in the figure, at 14dpi-21dpi, the serum specific antibody levels of the interferon treatment group and the challenge control group gradually increased. At different time points, there was no significant difference in the PRRSV specific antibody levels between the interferon treatment group and the challenge control group, but the antibody levels of the interferon treatment group at 14d and 21d were slightly lower than those of the challenge control group.

[0161] 4.5 RNA extraction and fluorescence quantitative detection from nasal swabs and serum

[0162] The nasal swab was soaked in 1 mL of normal saline for 10 min, and then 500 μL of the nasal swab and 200 μL of serum were aspirated. After RNA was extracted, quantitative detection was performed according to the steps in the IDEXX Real PCR manual.

[0163] Nasal swabs were collected on days 7, 14, and 21 after challenge, and the virus shedding levels of the piglets were tested by qPCR. Fig.11 As shown, at 7 dpi, both the interferon-treated group and the challenge control group showed detoxification, and at 21 dpi, detoxification stopped, with no significant difference.

[0164] During the experiment, according to the experimental plan, serum samples were collected from piglets in the interferon treatment group and the challenge control group on days 7, 14, and 21 after the challenge, and the viremia level of the piglets was detected by qPCR. Fig.12 As shown in the figure, at 7 dpi, the viremia levels of the interferon-treated group and the challenge control group were similar. At 14 dpi, the viremia levels of the four piglets in the interferon-treated group decreased significantly and were lower than those in the challenge control group. At 21 dpi, the viremia level of the interferon-treated group had basically returned to normal, which was significantly different from the challenge control group, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein can improve viremia in piglets.

[0165] 4.6 Viral load detection in PAMs and changes in expression of genes related to macrophage activation

[0166] 4.6.1 Separation of PAMs

[0167] (1) Remove the lung tissue and wash with 100 mL PBS (containing K + ) Lung lavage was performed through the trachea, and the lavage fluid was placed in a 50 mL centrifuge tube and centrifuged at 300 g for 10 min;

[0168] (2) Discard the supernatant, resuspend the cells in 10 mL of PBS, and centrifuge at 300 g for 10 min. Repeat twice.

[0169] (3) Discard the supernatant and resuspend the cells with 1 mL of 1640; aspirate 10 μL of trypan blue for cell staining and counting. Aspirate 1×10 cells per pig. 7 The cells were centrifuged at 300 g for 10 min.

[0170] (4) After centrifugation, discard the supernatant, lyse the cells with 1 mL of Trizol, shake to mix, and freeze at -80°C.

[0171] 4.6.2 Detection of viral load in PAMs

[0172] (1) Extract RNA: Extract PAMs total RNA according to the steps in 2.3;

[0173] (2) Reverse transcription: Perform reverse transcription according to the reverse transcription system and reverse transcription procedure in 2.3;

[0174] (3) qPCR: Perform qPCR according to the PCR procedure and system in 2.3.

[0175] 4.6.3 Detection of gene expression levels in PAMs

[0176] (1) Reverse transcription: Take out the RNA of PAMs frozen at -80℃. Each reverse transcription system is as follows: template 1000ng, 5× PrimeScript RT Master Mix 2 μL, RNase Free H 2 O Up to 10 μL; inversion program: 37℃ 25min, 85℃ 5s, 4℃ insulation (Takara, Catalog No.: RR037A).

[0177] (2) Fluorescence quantitative PCR: Dilute the reverse transcribed cDNA 10 times. The fluorescence quantitative PCR system and procedure are the same as 2.3. The fluorescence quantitative PCR primers are shown in Table 1:

[0178] Table 1 Primer sequences for fluorescence quantitative PCR

[0179]

[0180] On day 21 of infection, all piglets in the groups were euthanized, PAMs in the lungs were collected, and total RNA was extracted. The viral load of PRRSV in the lungs was detected by qPCR. Fig.13 As shown in the figure, although the viremia levels in the nasal swabs and serum of the piglets had improved significantly at 21 dpi, the PRRSV virus in the PAMs still showed a certain level of replication. However, the viral load of the PAMs of the three piglets in the interferon treatment group was significantly lower than that in the challenge control group, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein has a certain inhibitory effect and therapeutic effect on the replication of PRRSV in piglet PAMs.

[0181] To understand ISG15-(H4) 2 -IFN-λ3 recombinant protein treatment, the effects of genes related to immunity and inflammatory response on PAMs in different groups of animals, several genes related to macrophages and immune response were selected for qPCR detection, such as key chemokines that attract macrophages to inflammatory sites: CCL2, CXCL10, pro-inflammatory factors produced by macrophages: TNF-α, IL-1β, and antiviral genes ISG56, ISG15. Fig.14 As shown in the figure, the gene expression levels of CCL2, IL-1β, CXCL10, ISG56, ISG15, and TNF-α in the interferon-treated group were lower than those in the challenge control group, and the levels of CXCL10 and ISG15 in the challenge control group were significantly lower than those in the challenge control group, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein inhibited the secretion of inflammatory factors to a certain extent.

[0182] Based on the above tests, it can be seen that the ISG15-(H4) used 2 -IFN-λ3 recombinant protein dose (2 mg per head) can significantly reduce the lung inflammation caused by PRRSV infection and the level of blood poisoning on day 21 of infection, suggesting that ISG15-(H4) 2 -IFN-λ3 recombinant protein does have a PRRSV therapeutic effect. Studies have shown that PRRSV infection can activate the host's natural immune response, causing the expression of a series of inflammatory factors, and even cause a "cytokine storm", leading to more serious symptoms such as interstitial pneumonia. The present invention detected the gene expression of PAMs isolated from different groups of animals and observed that the levels of CCL2, CXCL10, TNF-α and IL-1β inflammatory factors in the interferon treatment group and the challenge control group were higher than those in the negative control group. Compared with the high level of expression in the challenge control group, the expression levels in the interferon treatment group were relatively low, and the expression levels of some inflammatory factors such as CXCL10 were close to those in the negative control group, revealing that ISG15-(H4) 2 -IFN-λ3 recombinant protein treatment significantly reduced the expression and secretion of inflammatory factors during the virus attack process, and had a good anti-inflammatory effect. This is consistent with the results of lung lesions and H&E staining, which showed that the lung lesions in the interferon treatment group were milder and had a small amount of inflammatory factor infiltration, while the virus attack control group had a large amount of inflammatory factor infiltration. It is also consistent with the results obtained by clinical use of IFN-λ to treat SARS CoV-2 infection.

[0183] The results of the present invention when detecting the viral load in serum showed that although there was no significant difference in the serum viral load between the challenge control group and the interferon treatment group at 7 dpi, the serum viral load of the four piglets in the interferon treatment group decreased significantly at 14 dpi, and the interferon treatment group was significantly lower than the challenge control group at 21 dpi and close to the normal level, indicating that ISG15-(H4) 2 -IFN-λ3 recombinant protein inhibits the replication of PRRSV in vivo, reduces the viremia of PRRSV-infected piglets, and accelerates the recovery of infected piglets. 2 -IFN-λ3 recombinant protein was validated against PRRSV in vivo, demonstrating that recombinantly expressed ISG15-(H4)2 -IFN-λ3 recombinant protein has an inhibitory effect on inhibiting the replication of PRRSV in the body, reducing lung lesions, reducing the secretion of inflammatory factors in the lungs and improving viremia caused by PRRSV infection.

Claims

1. Use of ISG15-(H4)2-IFN-λ3 recombinant protein in the preparation of a drug for preventing and treating PRRSV infection, characterized in that: ISG15 and IFN-λ3 are connected via a connecting peptide (H4)2. The amino acid sequence of the ISG15-(H4)2-IFN-λ3 recombinant protein is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug has the functions of inhibiting the replication of PRRSV and having anti-PRRSV activity.

3. The use according to claim 1, characterized in that: The medicine has the effect of alleviating lung lesions.

4. The use according to claim 1, characterized in that: The drug can improve the viremia of piglets.

5. The use according to claim 1, characterized in that: The drug can reduce the expression and secretion of inflammatory factors in the lungs.

6. The use according to claim 1, characterized in that: The nucleotide sequence encoding the ISG15-(H4)2-IFN-λ3 recombinant protein is shown in SEQ ID NO.

2.

7. The use according to claim 1, characterized in that: The preparation method of the ISG15-(H4)2-IFN-λ3 recombinant protein comprises the following steps: 1) The nucleotide sequence shown in SEQ ID NO.2 was cloned into a vector to construct a recombinant vector - ISG15-(H4)2-IFN-λ3; 2) transforming the recombinant vector-ISG15-(H4)2-IFN-λ3 into Escherichia coli to obtain a recombinant bacterium for preparing the ISG15-(H4)2-IFN-λ3 recombinant protein; 3) Induce expression to obtain ISG15-(H4)2-IFN-λ3 recombinant protein.

8. A drug for preventing or treating PRRSV infection, characterized in that: The drug contains a safe and effective amount of ISG15-(H4)2-IFN-λ3 recombinant protein, and the amino acid sequence of the ISG15-(H4)2-IFN-λ3 recombinant protein is shown in SEQ ID NO.

1.

9. The drug according to claim 8, characterized in that The nucleotide sequence encoding the ISG15-(H4)2-IFN-λ3 recombinant protein is shown in SEQ ID NO.2.

Images