Plant endophytic cladosporium HNU21 and application thereof

Abstract

The invention discloses a plant endophytic cladosporium HNU21 and application thereof. The plant is taxus cuspidata. The Cladosporidium sp. HNU21 is named as Cladosporidium sp. HNU21 in taxonomy, the preservation number is CCTCC NO: M2024232, the preservation date is January 26, 2024, the preservation unit is China Center for Type Culture Collection, and the preservation address is No. 299 on eight road in Wuchang District, Wuhan, Hubei Province. The plant endophytic cladosporium sp. HNU21 can be used for promoting biosynthesis of taxol components in taxus cuspidata and expression of synthetic related genes, the content of taxol is increased, and the plant endophytic cladosporium sp. HNU21 has high application value; meanwhile, the invention further provides a method for preparing spore liquid containing the plant endophytic cladosporium HNU21, and taxus cuspidata seedling branchlets are sprayed with the filtered spore liquid, so that taxol synthesis can be effectively promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a plant endophytic Cladosporium HNU21 and an application thereof. Background Art

[0002] Endophytes are fungi or bacteria that live inside the tissues and organs of plants at certain stages or all stages. They are commonly found in higher plants, including woody plants, herbaceous plants, monocotyledons and dicotyledons. They have become potential microbial pesticides, yield-increasing bacteria or potential biocontrol vectors for biological control.

[0003] Among them, endophytic fungi play an important role in the growth and development of medicinal plants. They can produce regulator substances required for plant growth, enhance the plant's absorption of trace elements, and promote plant growth and development. In addition, endophytic fungi can also improve the physiological activity indicators and stress resistance of host plants, including resistance to biotic and abiotic stresses. In terms of the regulation of secondary metabolites and active substances in medicinal plants, endophytic fungi directly or indirectly affect the distribution and content of active substances in medicinal plants by affecting and regulating the synthesis, content and accumulation of secondary metabolites of medicinal plants.

[0004] Extracting endophytic fungi from plants is of great significance for understanding the interaction between endophytic fungi and plants and discovering new drug ingredients. For example, paclitaxel is a precious anticancer drug extracted from Taxus plants, which has significant therapeutic effects; however, Taxus grows slowly and is an endangered species, and traditional extraction methods are unsustainable. The growth of market demand has made it urgent to find alternative production methods. Therefore, scientists have begun to explore the production of paclitaxel by fermentation of endophytic fungi to solve the problem of insufficient drug sources. Summary of the invention

[0005] The purpose of the present invention is to provide a plant endophytic Cladosporium HNU21 and an application thereof in view of the deficiencies in the prior art.

[0006] In a first aspect, the present invention provides an endophytic fungus isolated and purified from Taxus cuspidata, a plant of the genus Taxus, taxonomically named Cladosporium Cladosporium sp. HNU21, the strain preservation number is CCTCC NO: M2024232, the preservation date is January 26, 2024, the preservation unit is China Center for Type Culture Collection (CCTCC), the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province; its ITS sequence is shown in SEQ ID NO.1.

[0007] In a second aspect, the present invention provides a cell culture, a cell metabolite, a cell culture supernatant or a cell lysate of the plant endophytic Cladosporium HNU21.

[0008] In a third aspect, the present invention provides a composition for increasing the paclitaxel content in leaves of Taxus cuspidata, comprising a component selected from the following group: the above-mentioned plant endophytic Cladosporium HNU21; or the above-mentioned cell culture, cell metabolite, cell culture supernatant or cell lysate.

[0009] In a fourth aspect, the present invention provides an application of the plant endophytic Cladosporium HNU21, which can increase the paclitaxel content in leaves of Taxus cuspidata and the expression levels of key genes in the paclitaxel biosynthesis pathway.

[0010] Furthermore, the application is specifically as follows: spraying the spore liquid of plant endophytic Cladosporium HNU21 on the seedlings of Taxus cuspidata, thereby increasing the content of paclitaxel in the needles of Taxus cuspidata;

[0011] The spore liquid is prepared by the following steps: inoculating plant endophytic Cladosporium HNU21 into PDA solid culture medium (Potato Dextrose Broth), culturing in an incubator at a temperature of 25-30° C. for 5-7 days, and filtering under reduced pressure to obtain a spore-containing solution, namely the spore liquid, after spores are generated.

[0012] The beneficial effects of the present invention are:

[0013] The present invention provides a plant endophytic cladosporium HNU21, wherein the plant is Taxus cuspidatus, and the fungus can be used to promote the biosynthesis of paclitaxel components and the expression of synthesis-related genes in Taxus cuspidatus, thereby increasing the content of paclitaxel, thereby providing an effective solution to the problem of insufficient drug sources, and having high application value; at the same time, the present invention also provides a cell culture, cell metabolites, cell culture supernatants or cell lysates of the plant endophytic cladosporium HNU21, and a method for preparing a spore liquid containing the plant endophytic cladosporium HNU21, and by spraying the filtered spore liquid on the twigs of Taxus cuspidatus seedlings, the synthesis of paclitaxel can be effectively promoted. Compared with the existing fungal inducers, the endophytic cladosporium HNU21 spore liquid of the present invention increases the content of paclitaxel by more than 1.5 times, and has good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :Cladosporium fungus Cladosporium sp. Colony morphology of HNU21 on solid culture medium.

[0015] Figure 2 :Cladosporium fungus Cladosporium sp. Mycelial and spore morphology of HNU21 under light microscope.

[0016] Figure 3 :Cladosporium fungus Cladosporium sp. Agarose gel electrophoresis of the ITS sequence of HNU21.

[0017] Figure 4 :Cladosporium fungus Cladosporium sp. Phylogenetic tree of HNU21.

[0018] Figure 5 :Cladosporium fungus Cladosporium sp. HNU21 infection increases the content of paclitaxel in leaves of Taxus cuspidata.

[0019] Figure 6 :Genes related to taxol synthesis in Taxus cuspidata in Cladosporium Cladosporium sp. Differential expression levels under HNU21 treatment. DETAILED DESCRIPTION

[0020] The specific implementation methods of the present invention are described in detail below with reference to the embodiments.

[0021] Embodiment 1: Cladosporium sp. Isolation, identification and preservation of HNU21:

[0022] Endophytic fungi were obtained as follows:

[0023] (1) Rinse the healthy two-year-old stem segments of freshly picked Taxus cuspidata under running water for 30 minutes to remove the dirt on the surface, dry the surface moisture of the stem segments with filter paper, and place them on a clean workbench. Immerse the stem segments in a 75% alcohol solution for disinfection for 1 minute. During this period, the beaker needs to be shaken continuously to ensure that the Taxus tissue is in full contact with the alcohol. After disinfection, wash the stem segments three times with sterile water to remove the alcohol residue on the surface. Then, place the stem segments in a 0.1% mercuric chloride solution for 5 minutes, and wash the plant material in a clean beaker 4 to 5 times to remove the residual mercuric chloride on the surface of the tissue. To verify whether the disinfection is thorough, take 100 μL of the sterile water from the last wash as a control. If no bacteria grow after culturing at 26°C for 3 to 5 days, the disinfection is considered effective.

[0024] (2) Peel the sterilized stem nodes with a scalpel and cut the stem bark into 5 mm small sections; spread the processed plant materials on PDA medium (Potato Dextrose Agar, containing: 200.0 g / L potato, 50.0 g / L glucose, 6.0 g / L NH4NO3, 0.3 g / L anhydrous MgSO4, 0.5 g / L KH2PO4, 0.05 g / L vitamin B1), place five pieces of materials in each culture dish, and culture at 26℃ in the dark. Mycelium will grow from the tissue block after three to seven days of culture. After inoculation, transfer the edge of the stem bark wound to a new PDA plate with an inoculation needle every 12 hours. Observe the phenotypic characteristics of the transferred fungal colony, pick the hyphae at the edge of a single colony, and streak culture on a new PDA plate. After continuous purification for 3 times, pick a small amount of hyphae and observe under a microscope. If there are no foreign bacteria, it can be considered a single strain. After obtaining a single strain, inoculate it on a PDA slant and store it at 4°C. Figure 1 As shown in Figure 1, the solid culture characteristics of HNU21 are gray fluffy colonies. Under the microscope, the morphological characteristics are gray hyphae with branches, such as Figure 2 shown.

[0025] (3) The DNA of endophytic fungi strains of Taxus cuspidata was extracted using the TIANGEN plant genomic DNA extraction kit, and the ITS sequence was amplified using this as a template. The primers were ITS4 (see SEQ ID NO.2) and ITS5 (see SEQ ID NO.3). The PCR (polymerase chain reaction) reaction system was 2×Taq MasterMix (Dye), 25 μL; ITS5 (10 μM), 2 μL; ITS4 (10 μM), 2 μL; Template DNA, 3 μL; ddH2O, 18 μL. The PCR reaction procedure was 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, denaturation-annealing-extension cycle for 30 times, and final extension at 72℃ for 2 min. 1% agarose gel electrophoresis was used to detect whether the amplification was successful. The successful PCR product was sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The ITS sequence of HNU21 was amplified by PCR, and the gel electrophoresis of its product is shown in the figure below. Figure 3 The sequence obtained by sequencing is shown in SEQ ID NO.1. The sequencing results were compared using the NCBI website and the similarity with the known Cladosporium crousii NR_148192 was 99.44%.

[0026] SEQ ID NO.1: gaaaactgcggagggatcattacaagtgaccccggtctaaccaccggggatgttcataaccctttgttgtccgactctgttgcctccggggcgaccctgccttcgggcgggggctccgggtggacacttc aaactcttgcgtaactttgcagtctgagtaaacttaattaataaattaaaacttttaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtg aatcatcgaatctttgaacgcacattgcgccccctggtattccggggggcatgcctgttcgagcgtcatttcaccactcaagcctcgcttggtattgggcaacgcggtccgccgcgtgcctcaaatcgaccggct gggtcttctgtcccctaagcgttgtggaaactattcgctaaaagggtgttcgggaggctacgccgtaaaacaaccccatttctaaggttgacctcggatcaggtagggatacccgctgaacttaagcatatcaataa

[0027] SEQ ID NO.2:

[0028] 5'-TCCTCCGCTTTATTGATATGC-3'

[0029] SEQ ID NO.3:

[0030] 5'-GGAAGTAAAGTCGTAACAAGG-3'

[0031] Example 2: Construction and analysis of homologous evolutionary tree of endophytic fungus HNU21 of Taxus cuspidata

[0032] The ITS sequence of endophytic fungus HNU21 was used as the target sequence, and homologous sequences were searched in the GenBank database of NCBI. The sequence closest to the ITS sequence of endophytic fungus HNU21 was downloaded as the reference sequence. The phylogenetic tree was constructed using the neighbor-joining method (NJ). One sequence was randomly selected and the alignment was repeated 1000 times to determine the phylogenetic position of the endophytic fungus HNU21 strain. The phylogenetic tree is shown in the figure. Figure 4 shown.

[0033] Example 3: Preparation and application of spore solution of endophytic fungus HNU21 of Taxus cuspidata

[0034] (1) Perform the following operations in a clean bench: Use an inoculation needle to pick up a HNU21 fungus block of about 5 mm × 5 mm in size that has been stored on a slant, invert it on a V8 medium (V8 Juice Agar, where V8 juice includes tomatoes, carrots, watercress, lettuce, celery, spinach, beetroot, and celery), and culture it at 26°C in the dark for 5 to 7 days until the fungus produces spores. Add 2 mL of sterile water to the solid plate, use a spreading stick to scrape the HNU21 hyphae and spores to obtain a mixed solution, fold three layers of gauze into a funnel shape, and filter the mixed solution at the ninth layer to obtain a spore solution. Count the spores under an optical microscope, and adjust the concentration of the obtained fungal spore solution to 1×10 6 pcs / mL for future use.

[0035] (2) Place the soaked sterile filter paper on the tray, cut the stems and leaves of Taxus cuspidata of similar age about 20 cm long, wash them with sterile water 2-3 times, and place the leaves with the lower epidermis facing up on the filter paper. Spray 20 mL of fungal spore solution evenly on the leaf surface, and spray the same amount of sterile water on the control group. Wrap the tray with plastic wrap and let it stand for 48 hours, then cut the leaves, wash them with sterile water, and freeze them in liquid nitrogen and place them in a -80℃ refrigerator for later use.

[0036] Example 4: Effect of endophytic fungus HNU21 on the content of paclitaxel in leaves of Taxus cuspidata

[0037] (1) All extraction reagents were precooled at -20°C before use. Weigh 60 mg of leaves into a 1.5 mL centrifuge tube, add an appropriate amount of small steel beads and 600 μL of methanol-water (V:V=7:3, containing mixed internal standard, 4 μg / mL); precool in a -40°C refrigerator for 2 min, put into a grinder, grind at 60 Hz for 2 min; ultrasonic extraction in an ice water bath for 30 min, stand at -40°C overnight; centrifuge at 12000 rpm for 10 min, draw 150 μL of supernatant with a syringe, filter with a 0.22 μm organic phase pinhole filter, transfer to an LC injection vial, and store at -80°C for later use; mix equal volumes of the extracts of all samples to make quality control samples (QC).

[0038] (2) The samples were detected using a Waters ACQUITY UPLC I-Class plus ultra-high performance liquid phase tandem high-resolution mass spectrometer. Chromatographic conditions: Chromatographic column: ACQUITY UPLC HSS T3 (100 mm×2.1 mm, 1.8 μm); column temperature: 45°C; mobile phase: water (containing 0.1% formic acid), acetonitrile; flow rate: 0.35 mL / min; injection volume: 3 μL; elution gradient: 0 min water: acetonitrile volume ratio of 95:5, 4 min water: acetonitrile volume ratio of 70:30, 8 min water: acetonitrile volume ratio of 50:50, 10 min water: acetonitrile volume ratio of 20:80, 14 min water: acetonitrile volume ratio of 0:100, 15.1 min water: acetonitrile volume ratio of 95:5. The separated samples were subjected to mass spectrometry analysis. Mass spectrometry conditions: The sample mass spectrometry signal was acquired by scanning positive and negative ions separately, and the specific acquisition mode was DDA (data dependent acquisition) data dependent scanning mode.

[0039] (3) The change of the charge-to-mass ratio (m / z) between 876.4→308.1 was used for the quantitative analysis of paclitaxel, and the change of the charge-to-mass ratio (m / z) between 876.4→531.2 and 876.4→591.4 was used for the verification analysis of paclitaxel. Paclitaxel (≥99%; CAS: 33069-62-4) standard was purchased from Aladdin Biochemical Technology (Shanghai, China) Co., Ltd. Figure 5 As shown, CK is the control group and HNU21 is the experimental group.

[0040] Example 5: Effect of endophytic fungus HNU21 on the expression levels of taxol synthesis-related genes in leaves of Taxus chinensis

[0041] (1) Total RNA from the HNU21 experimental and control groups was extracted using the TIANGEN RNAprep Pure Plant Kit. After passing the quality inspection, transcriptome libraries were constructed and sequenced. The integrity of total RNA of the samples was tested using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and the transcriptome library was constructed using the VAHTS Universal V5 RNA-seq Library Prep Kit. The library was sequenced using the Illumina Novaseq 6000 sequencing platform to generate 150 bp paired-end reads; the library was processed using fastp software to obtain clean reads for subsequent data analysis.

[0042] (2) The HISAT2 software was used to align the Taxus genome and calculate the gene expression level (FPKM). The read counts of each gene were obtained by HTSeq-count. PCA analysis and plotting were performed on the samples using R (v 3.2.0) to evaluate the biological replication of the samples. Differentially expressed genes were analyzed using DESeq2 software, and differentially expressed genes (DEGs) were defined as genes that met the thresholds of P value < 0.05 and foldchange > 2 or foldchange < 0.5.

[0043] (3) The taxol biosynthesis-related genes to be detected and their IDs are: TS (ctg5306_gene.4), TS (ctg7747_gene.1), T13OH (ctg593_gene.12), TBT (ctg4165_gene.7), T5OH (ctg11276_gene.1), DBTNBT (ctg195_gene.25) and T7OH (ctg12564_gene.1). The expression levels of taxol biosynthesis-related genes in mairei treated with the endophytic fungus HNU21 are shown in the figure. Figure 6 shown.

Claims

1. A plant endophytic Cladosporium HNU21, characterized in that Its taxonomic name is Cladosporium ( Cladosporium sp. ), the strain name is HNU21, the preservation number is CCTCC NO: M2024232, the preservation date is January 26, 2024, the preservation unit is China Center for Type Culture Collection, and the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. A composition for increasing the paclitaxel content in leaves of Taxus cuspidata, characterized in that: The method comprises: the plant endophytic Cladosporium HNU21 according to claim 1, or a cell culture, a cell metabolite, a cell culture supernatant or a cell lysate thereof.

3. Use of the plant endophytic Cladosporium HNU21 according to claim 1 in increasing the paclitaxel content in leaves of Taxus cuspidata.

4. The use according to claim 3, characterized in that: The spore liquid of the plant endophytic Cladosporium HNU21 was sprayed on the seedlings of Taxus cuspidata; The spore liquid is prepared as follows: plant endophytic Cladosporium HNU21 is inoculated into a PDB solid culture medium, cultured in an incubator at 28° C. for 5 to 7 days, and after spores are generated, the spore liquid is obtained by vacuum filtration.

5. Use of the plant endophytic Cladosporium HNU21 according to claim 1 in increasing the expression level of key genes in the paclitaxel biosynthesis pathway.

6. The use according to claim 5, characterized in that: The spore liquid of the plant endophytic Cladosporium HNU21 was sprayed on the seedlings of Taxus cuspidata; The spore liquid is prepared as follows: plant endophytic Cladosporium HNU21 is inoculated into a PDB solid culture medium, cultured in an incubator at 28° C. for 5 to 7 days, and after spores are generated, the spore liquid is obtained by vacuum filtration.

Images