A kind of Inonotus obliquus C2H2 type transcription factor IoZFP2 and its application

Abstract

The present invention discloses a C2H2 transcription factor IoZFP2 of Inonotus obliquus and its application, wherein the nucleotide sequence of the C2H2 transcription factor IoZFP2 is shown in SEQ ID NO: 1. By overexpressing the C2H2 transcription factor IoZFP2, the growth rate of Inonotus obliquus is significantly accelerated, and the alcohol content of Inonotus obliquus is significantly improved. Therefore, IoZFP2 can be introduced into Inonotus obliquus as a target gene to increase the growth rate of Inonotus obliquus and the alcohol content of Inonotus obliquus, and has a high practical application value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an Inonotus obliquus C2H2 type transcription factor IoZFP2 and an application thereof. Background Art

[0002] Inonotus birch generally grows in birch forests and is widely distributed. It is mainly distributed in Russia, South Korea, Eastern Europe, Northern Europe, and the northern part of America. Since the 16th century, there have been examples of Inonotus birch being used as folk medicine and herbal medicine. Inonotus birch contains rich secondary metabolites, including phenolic compounds, melanin, etc. Some of its components have antioxidant, anti-tumor, anti-viral activity, and anti-infection effects. They also have the effect of preventing breast cancer, liver cancer, uterine cancer, gastric cancer, diabetes, and hypertension. However, because it is only distributed in the cold zone and grows slowly, Inonotus birch is not common. In addition, the increasing demand for Inonotus birch in recent years has led to a decrease in its wild resources year by year. At present, due to the slow growth of Inonotus birch, its artificial cultivation technology is not mature, so the problem of slow growth of Inonotus birch needs to be solved urgently.

[0003] Transcription factors are a class of proteins that can bind to gene DNA. They can regulate the transcription process of genes and thus control protein synthesis. They are involved in many aspects such as hyphae growth and branching, the formation of reproductive structures, the regulation of metabolic pathways, and the response to environmental stress. By regulating gene expression, transcription factors can precisely control the growth and development of filamentous fungi. Growth-regulatory factors of filamentous fungi can directly or indirectly regulate the growth rate and hyphae morphology of filamentous fungi. They affect hyphae growth by regulating key processes such as cell wall synthesis, establishment of cell polarity, and cell division. For example, the transcription factor Ste12 can regulate the expression of cell wall synthases, thereby affecting the elongation rate of hyphae. Some growth-related transcription factors are also involved in the regulation of metabolic pathways of filamentous fungi. They can regulate the expression of related genes, thereby affecting metabolic processes such as carbon source utilization and the production of secondary metabolites. For example, the transcription factor Vel1 can regulate the expression of secondary metabolic genes, thereby affecting the synthesis of secondary metabolites. They can also participate in the process of intracellular signal transmission, receive external signals and transmit them to the cell nucleus, thereby regulating the expression of related genes. For example, the MAPK pathway (Mitogen-activated protein kinase pathway) in filamentous fungi is involved in the signal transduction process of growth regulatory factors, activating or inhibiting transcription factors through phosphorylases, and regulating the expression of growth-related genes. Filamentous fungal growth regulatory factors can also affect the growth process by interacting with other proteins. They can interact with other proteins such as transcription factors, transcription activators, and transcription repressors to form complexes or regulate the activity of proteins, thereby affecting gene expression. For example, the transcription factor BrlA can interact with other transcription factors to form complexes, regulate the expression of branching initiation genes, and thus promote the branching of hyphae.

[0004] Cys2His2 (C2H2) transcription factors are a common family of transcription factors, whose name comes from the two conserved cysteine ​​(Cysteine, Cys) and two histidine (Histidine, His) residues in their structure. This type of transcription factor is widely present in eukaryotes and plays an important role in gene regulation. The mechanism of action of Cys2His2 transcription factors mainly involves their domains and DNA binding ability. This type of transcription factor usually has one or more Cys2His2 domains, which contain a pair of cysteine ​​and two pairs of histidine residues, which bind to specific sequences of DNA. Through specific binding to DNA sequences, Cys2His2 transcription factors can selectively regulate the transcription of specific genes.

[0005] Currently, most of the research on Inonotus obliquus is focused on its bioactive substances, while relatively few studies are conducted on the molecular mechanisms of its growth and synthesis of secondary metabolites. Summary of the invention

[0006] Purpose of the invention: The purpose of the present invention is to provide a C2H2-type transcription factor IoZFP2 of Inonotus obliquus and its application in increasing the growth rate of Inonotus obliquus and the alcohol content of Inonotus obliquus.

[0007] Technical solution: To achieve the above purpose, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides an Inonotus obliquus C2H2-type transcription factor IoZFP2, whose nucleotide sequence is shown in SEQ ID NO:1.

[0009] In a second aspect, the present invention provides a vector comprising the above-mentioned Inonotus obliquus C2H2-type transcription factor IoZFP2.

[0010] In a third aspect, the present invention provides a host cell comprising the above-mentioned Inonotus obliquus C2H2-type transcription factor IoZFP2 or the above-mentioned vector.

[0011] In a fourth aspect, the present invention provides the use of the Inonotus obliquus C2H2-type transcription factor IoZFP2, the vector or the host cell in improving the growth rate of Inonotus obliquus.

[0012] In a fifth aspect, the present invention provides the use of the Inonotus obliquus C2H2-type transcription factor IoZFP2, the vector or the host cell in increasing the alcohol content of Inonotus obliquus.

[0013] In a sixth aspect, the present invention provides a method for increasing the growth rate of Inonotus obliquus, wherein the method is achieved by overexpressing the Inonotus obliquus C2H2-type transcription factor IoZFP2.

[0014] In a seventh aspect, the present invention provides a method for increasing the alcohol content of Inonotus obliquus, wherein the method is achieved by overexpressing the Inonotus obliquus C2H2-type transcription factor IoZFP2.

[0015] Beneficial effects: The C2H2 transcription factor IoZFP2 provided by the present invention can significantly increase the growth rate of Inonotus obliquus and the biosynthesis of Inonotus obliquus alcohol. The present invention explores the function of IoZFP2, provides an important theoretical basis for genetic engineering technology to increase the growth rate of Inonotus obliquus and the content of Inonotus obliquus alcohol, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the agarose gel electrophoresis image after the Inonotus obliquus promoter IoPr is connected to the IoZFP2 gene in Example 1;

[0017] Figure 2 This is a microscopic examination image of the wild protoplasts of haploid Inonotus obliquus of Example 2;

[0018] Figure 3 The phenotype verification diagram of overexpressed IoZFP2 in Example 3 (with the haploid wild type as the control), wherein A is a white field photo of IoZFP2 overexpressed mycelium, B is a green fluorescence photo of mycelium corresponding to Figure A; C is a plate experiment diagram of IoZFP2 and haploid wild type; D is a colony diameter diagram corresponding to the plate experiment in Figure C; E is a 10-day shake flask fermentation image of the IoZFP2 overexpression strain; F is the mycelium dry weight data statistics corresponding to Figure E;

[0019] Figure 4 Graph showing the content of metabolites in the mycelium of the overexpressed IoZFP2 and haploid wild-type Inonotus obliquus of Example 4, wherein A is the GC-MS spectrum of triterpenes of the haploid wild-type; B is the GC-MS spectrum of triterpenes of the IoZFP2 overexpressing strain; and C is the statistical data of the peak areas of the A and B spectra;

[0020] Figure 5 The qPCR result diagram of overexpression of IoZFP2 and haploid Inonotus obliquus wild-type transcription factor gene and terpene synthase gene in Example 5; wherein A is the qPCR result diagram of each transcription factor; and B is the qPCR result diagram of the terpene synthase gene. DETAILED DESCRIPTION

[0021] The present invention is described in detail below in conjunction with examples. The following examples are implemented on the premise of the technical solution of the present invention, and detailed implementation plans and specific operating processes are given, but the protection scope of the present invention is not limited to the following examples.

[0022] Example 1: Cloning and sequence analysis of the IoZFP2 gene

[0023] (1) Extraction of RNA from Inonotus obliquus and synthesis of cDNA: Total RNA from the mycelium of Inonotus obliquus was extracted using FastPure Universal Plant Total RNA Isolation Kit (purchased from Nanjing Novozymes), and reverse transcribed using HiScriptⅡQ RT SuperMix for qPCR (+gDNA wiper) (purchased from Nanjing Novozymes) to synthesize cDNA.

[0024] (2) Cloning of transcription factors and strong promoters of Inonotus obliquus:

[0025] Primer software was used to design specific primers (IoPr-IoZFP2-F, IoZFP2-pYF11-R), and the target fragment was amplified by PCR reaction using Inonotus birch cDNA as a template. After sequencing, the cloned gene sequence was compared with the gene sequence in the transcriptome data in DNAMAN software to determine whether the sequence was correct. Bands with basically the same size as the target gene were recovered, and sequencing finally confirmed that the IoZFP2 gene was successfully cloned. The gene sequence of IoZFP2 gene is shown in SEQ ID NO.1. The promoter of the gene with the highest expression level in Inonotus birch was taken as the strong promoter, and the promoter sequence was searched in the Inonotus birch genome to design primers (pYF11-IoPr-F, IoPr-IoZFP2-R). PCR amplification and cloning sequencing were performed using Inonotus birch genomic DNA as a template. The sequence of the strong promoter IoPr is shown in SEQ ID NO.2. The band size of the agarose gel electrophoresis diagram is correct, as shown in Figure 1 shown.

[0026] Primer (5'-3'):

[0027] pYF11-IoPr-F:

[0028] TTTCGTAGGAACCCAATCTTCAAATGAAGCCGCTATTTAGGATAGTCT IoZFP2-pYF11-R:

[0029] CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACATCAAGTAAAGAAAGCCCAGTGA IoPr-IoZFP2-F:

[0030] TTGCTATACTTTACTGCCAACGATGGACACCGGCCATTCACCCT IoPr-IoZFP2-R:

[0031] AGGGTGAATGGCCGGTGTCCATCGTTGGCAGTAAAGTATAGCAA

[0032] Example 2: Preparation of Inonotus obliquus protoplasts, construction and transformation of IoZFP2 overexpression vector

[0033] (1) Preparation of Inonotus obliquus mycelium: First, the haploid wild-type slant-preserved strain of Inonotus obliquus was inoculated onto a PDA solid culture medium plate. When the colony grew to a diameter of 6 cm, four diagonal colonies were taken with a 0.5 cm agar borer and inoculated into 50 mL of PDB liquid culture medium. The culture was cultured at 28° C. and 160 rpm for 5 days. The culture was then homogenized with a sterilized homogenizer (15 s / time, 2 times). The homogenized culture medium was inoculated into fresh 100 mL of liquid PDB. The culture was cultured at 28° C. and 160 rpm for 8 days. The mycelium of Inonotus obliquus was collected under sterile conditions, rinsed three times with sterile deionized water and set aside.

[0034] (2) Preparation of enzymatic solution: Add 0.2 g of lytic enzyme, 0.1 g of lysozyme, 0.1 g of cellulase, and 0.1 g of snailase to every 10 mL of 0.7 M NaCl solution. After the enzymes are completely dissolved, filter the solution through a sterilized 0.22 μm water filter into a sterile 50 mL centrifuge tube to obtain the enzymatic solution.

[0035] (3) Preparation of protoplasts of Inonotus obliquus: The mycelium in Example 2 (1) was picked up and placed in the enzymatic hydrolyzate in Example 2 (2), and then incubated at 28°C, 100rpm, and protected from light for 5 hours. Then, the mycelium was removed by filtering with a sterile double-layer nylon membrane. The filtrate was placed in a sterile centrifuge tube, centrifuged at 3000rpm and 4°C for 30min, and the supernatant was removed. 7ml 1xSTC was added for suspension (first add 1mL, then gently blow with a gun with a cut tip, and then add to 6ml), and centrifuged at 3000rpm and 4°C for 15min. After observing the protoplast concentration under a microscope, the added STC content was determined. An appropriate amount of 1xSTC was added for suspension (the operation was the same as before), and the mixture was divided into 150μL / tube (1ml centrifuge tube). The protoplast concentration was qualified, which was 3.28×10 8 Pieces / mL, see Figure 2 .

[0036] (4) Construction of IoZFP2 overexpression vector: Plasmid pYF11 was linearized by single restriction enzyme digestion with XhoI and connected to the IoZFP2 gene (with XhoI linker sites at both ends and the promoter Pr from Inonotus obliquus at the front end). Escherichia coli was transformed, and single colonies were picked for colony PCR. Positive results were sequenced and tested. Single colonies whose test results were completely aligned with the IoZFP2 gene were selected for shaking to extract plasmids, which were used for subsequent transformation.

[0037] (5) Transformation of Inonotus birchii protoplasts: Add 2 μg of plasmid DNA (10 μL of plasmid) to 150 μl of protoplasts, mix gently, and let stand at room temperature in the dark for 25 min (DNA concentration must be high enough and clean). Add 1 mL of PTC (PEG / STC) and mix gently, and let stand at room temperature for 30 min. Add AMP (ampicillin) to TB3 liquid (generally 100 μL AMP-100 mL TB3 liquid) and mix well. Add 7-8 mL of this mixture to a 50 mL centrifuge tube and culture in the dark at 27°C, 80 rpm in a shaker. Melt the TB3 solid culture medium, keep it warm at 45-55°C, pour two layers of culture medium, and the upper layer of bleomycin (mother solution concentration: 100 mg / mL) is twice that of the lower layer. The protoplasts are in the lower layer. Pour 5 plates for one gene, and both layers are 10 ml. (Bloemycin: 20 ug / mL in the upper layer; 10 ug / mL in the lower layer)

[0038] Note: Pour a bottle of TB3 culture medium kept at 55℃ into the 50mL centrifuge tube in step 14 to 50mL. Pour a control group without adding bleomycin first. Add bleomycin (15ug / mL, add 6μl) to the remaining 40mL, cover the lid tightly, mix well, and pour 4 plates. Wait for 20 minutes for the plate to solidify. Pour the upper layer from another bottle. Add 30μL to 100mL of culture medium and pour directly. After the upper layer of culture medium naturally covers the culture dish, cover the lid and solidify for about 10 minutes. After pouring the double-layer plate, culture it in the dark at 28℃ for 18 days (incubator), pick the transformants and place them on the PDA solid culture medium plate containing 10ug / mL bleomycin, and culture it in the dark at 28℃ for 12 days.

[0039] Example 3: Verification of Positive Transformants of Inonotus obliquus

[0040] When the transformant colonies selected in Example 2 (5) grow to a suitable size, slide preparation and fluorescence detection are performed. The results are as follows: Figure 2 The preparation steps are as follows: pick the hyphae at the edge of the transformant colony with a sterilized toothpick, rinse both sides with sterile deionized water, place on a clean slide, add 10 μL of sterile deionized water, cover with a clean coverslip, and observe the fluorescence under a fluorescence microscope. The results show that green fluorescence ( Figure 3 A and B). This indicates that the gene of transcription factor IoZFP2 is overexpressed in Inonotus obliquus.

[0041] Example 4: Verification of the growth-promoting function of the Inonotus obliquus transcription factor IoZFP2

[0042] When the transformant colonies selected in Example 3 (5) grow to a suitable size, use an agar punch to take a 0.5 cm colony block from the edge of the colony and inoculate it into a new PDA. The control group is a colony block from the edge of the haploid colony of Inonotus birchii cultured for the same time. Each treatment is replicated 5 times, and the colony diameter is observed and recorded every day. The results show that the diameter of the transformant is larger than that of the control (see Figure 3 C and D). When the colony diameter grows to 6 cm, use a 0.5 cm agar puncher to take 4 diagonal bacterial blocks of the colony, inoculate them in 50 mL of PDB liquid culture medium, culture at 28 ° C, 160 rpm, and then use a sterilized sterile homogenizer to homogenize (15 s / time, 2 times), and inoculate all the homogenized culture medium into fresh 100 mL of liquid PDB, culture at 28 ° C, 160 rpm, and culture for 6 days. Collect the mycelium of birch Inonotus under sterile conditions, resuspend it with sterile deionized water, and then use a sterilized sterile homogenizer to homogenize (15 s / time, 3 times) to obtain liquid seed solution. Add birch Inonotus liquid seed solution at a ratio of 1:50 (seed solution: culture medium), 28 ° C, 160 rpm, collect the mycelium at 6 days and 12 days of culture, respectively, dry it at 55 ° C to constant weight, and measure its weight with an analytical balance. Results The biomass of the transformant was significantly higher than that of the control (such as Figure 3 E and F).

[0043] Example 4: Functional verification of the inonotus betulinum transcription factor IoZFP2 in increasing the alcohol content in inonotus betulinum

[0044] (1) The wild-type haploid mycelium of Inonotus obliquus and the haploid mycelium of Inonotus obliquus overexpressing the IoZFP2 gene after shake flask fermentation for 10 days were used as materials, dried in an oven to constant weight, and then ground into powder using a mortar.

[0045] (2) Weigh 0.1 g of powder and add methanol at a solid-liquid ratio of 1:30, shake at 28°C and 160 rpm overnight, and use an ultrasonic cleaning instrument to sonicate for 30 minutes the next day.

[0046] (3) The material in Example 3 (2) was centrifuged at 6000 rpm and 4°C for 10 min, and the supernatant was collected by filtering through a 0.22 μm organic phase filter into a liquid phase bottle, followed by GC-MS analysis.

[0047] (4) GC-MS detection conditions: The chromatographic column is an Agilent 122-1733 (30m×0.25mm×0.25μm) elastic quartz capillary column; the programmed temperature conditions are: column temperature 150℃ (maintained for 5min), heated to 250℃ at 10℃ / min (maintained for 10min), heated to 300℃ at 15℃ / min and maintained for 15min until the analysis is completed. The injection port temperature is 250℃, the carrier gas is high-purity helium, the carrier gas flow rate is 3mL / min, the injection volume is 0.5μL, and the split ratio is 10:1; mass spectrometry conditions: the ion source is EI source, the ion source temperature is 280℃, the interface temperature is 280℃, the electron energy is 70eV, the solvent delay is 1.5min, and the mass range is 50-800amu. The detection results show that the transcription factor IoZFP2 of Inonotus obliquus can significantly promote the content of inotodiol, an active ingredient in Inonotus obliquus (such as Figure 4 shown).

[0048] Example 5: qPCR verification of the relative expression levels of IoZFP2 overexpression-related transcription factors and terpene synthases:

[0049] Real-time quantitative PCR:

[0050] This experiment was performed with reference to the ChamQ SYBR qPCR Master Mix Kit Q341 from Novozymes, using ABI Step One Plus for quantitative real-time PCR. The internal reference gene was the 18S rRNA gene. Three sets of biological replicates were used. -ΔΔCt The expression level was calculated by the method. Figure 5 , the reaction system, procedure and primer sequences are as follows:

[0051] qRT-PCR amplification reaction system

[0052]

[0053] qRT-PCR amplification reaction procedure

[0054]

[0055] qRT-PCR primer sequences

[0056]

[0057]

[0058]

[0059] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A C2H2-type transcription factor IoZFP2 from Inonotus obliquus, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. A vector comprising the Inonotus obliquus C2H2-type transcription factor IoZFP2 according to claim 1.

3. A host cell comprising the Inonotus obliquus C2H2-type transcription factor IoZFP2 according to claim 1 or the vector according to claim 2.

4. Use of the Inonotus obliquus C2H2-type transcription factor IoZFP2 according to claim 1, the vector according to claim 2 or the host cell according to claim 3 in increasing the growth rate of Inonotus obliquus.

5. Use of the Inonotus obliquus C2H2-type transcription factor IoZFP2 according to claim 1, the vector according to claim 2 or the host cell according to claim 3 in increasing the alcohol content of Inonotus obliquus.

6. A method for increasing the growth rate of Inonotus obliquus, characterized in that: The method is achieved by overexpressing the Inonotus obliquus C2H2 type transcription factor IoZFP2 described in claim 1.

7. A method for increasing the content of inonotus betulinum, characterized in that: The method is achieved by overexpressing the Inonotus obliquus C2H2 type transcription factor IoZFP2 described in claim 1.

Images