Lotus root spoilage germ detection method based on RPA-Cas12a technology and application of lotus root spoilage germ detection method

Abstract

The invention relates to a method for detecting Fusarium commune on the basis of an RPA-Cas12a (Recombinase Pseudomonas Amplification Cas12a) technology and application of the Fusarium commune detection method. A specific genome site of the common fusarium is obtained through comparative analysis of genomes, a set of primers are designed on the site, the common fusarium can be rapidly and accurately identified from pathogenic tissues and cultures by combining an RPA-Cas12a detection reaction liquid system, the detection limit is as low as 1 copies / microliter, and rapid detection of lotus root fusarium pathogenic bacteria is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogen detection, and specifically relates to a lotus root corruption pathogen (Fusarium commune) detection method based on RPA-Cas12a technology and an application thereof. Background Art

[0002] Lotus rhizome rot disease is a devastating soil-borne fungal disease on lotus roots that can cause 10%-80% yield loss and is a major threat to my country's lotus root industry. Lotus rhizome rot disease was first identified by Nisikado and Watanabe in 1953 as Fusarium oxysporum Schl. f. sp. nelumbicola (Nis. & Wat.). As time goes by, there are continuous reports of other pathogens causing lotus root "rot disease", such as Fusarium incarnatum; F. tricinctum; F. commune and Phytopythium helicoides. The ambiguity of the pathogen has caused a long period of stagnation and confusion in the research on lotus root rot disease. In recent years, with the development of fungal taxonomy and molecular biology, many studies have shown that F. commune has become the main pathogen of lotus root rot disease.

[0003] Hubei Province is the largest research and development and production base for seed lotus roots in my country, providing more than 80% of the country's seed lotus roots. Since seed lotus roots are asexually propagated, there are unavoidable phenomena such as seed bacteria, virus accumulation and natural decline. Therefore, testing the seed lotus roots for pathogens or viruses before selling them is a key step to ensure the quality of the seed lotus roots. Lotus root rot disease, as the number one disease affecting lotus root production, is one of the main targets of seed lotus root testing. Summary of the invention

[0004] The present invention intends to develop a kit for rapidly detecting the lotus root corruption pathogen F. commune contained in seed lotus roots by means of molecular biological technology, so as to ensure the quality of seed lotus roots.

[0005] The present invention performs rapid detection of common Fusarium pathogens based on RPA-Cas12a technology. Through comparative analysis of the genome, a genomic site unique to common Fusarium is obtained, and a set of primers (4 in total) are designed at this site. Combined with the RPA-Cas12a detection reaction liquid system, common Fusarium can be quickly and accurately identified from diseased tissues and cultures, with a detection limit as low as 1 copis / μl, and can specifically distinguish F. commune from F. oxysporum strains.

[0006] Based on this, the present invention provides a primer set for detecting lotus root corruption bacteria (Fusarium commune), comprising an RPA primer pair and crRNA;

[0007] The RPA primer pair is a primer pair consisting of two single-stranded DNAs shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequence of the crRNA is shown in SEQ ID NO.3.

[0008] The present invention also provides a kit for detecting lotus root corruption bacteria (Fusarium commune), comprising an RPA amplification reagent, a CRISPR-Cas12a detection reagent and the above-mentioned primer set.

[0009] Furthermore, the RPA amplification reagent includes all or part of the following: a recombinase capable of binding to single-stranded nucleic acid, a single-stranded DNA binding enzyme, a strand displacement DNA polymerase, dNTPs and magnesium acetate.

[0010] Furthermore, the CRISPR-Cas12a detection reagent includes Cas12a protein and / or a signal reporter probe.

[0011] Furthermore, the Cas12a protein is selected from AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a and BoCas12a, preferably LbCas12a protein, and the signal reporter probe is: 5'-FAM-TTATT-BHQ1-3'.

[0012] The present invention also provides the use of the above primer set or kit in any of the following:

[0013] (A1) preparing a product for detecting lotus root spoilage bacteria (Fusarium commune);

[0014] (A2) preparing a product for diagnosing infection with lotus root spoilage bacteria (Fusarium commune);

[0015] (A3) Prepare products for diagnosing or assisting in the diagnosis of lotus root spoilage disease.

[0016] The present invention also provides a method for detecting lotus root corruption bacteria (Fusarium commune) or diagnosing lotus root corruption disease infection, comprising the following steps:

[0017] (b1) extracting DNA from the sample to be tested;

[0018] (b2) using the DNA extracted in (b1) as a template and using the primer set described in claim 1 or the kit described in claim 2 for detection;

[0019] (b3) Determine whether lotus root spoilage bacteria (Fusarium commune) or lotus root spoilage disease infection exists based on the test results.

[0020] Furthermore, the test result is to observe the fluorescence under ultraviolet light with a wavelength of 308nm. Fluorescence represents a positive result, that is, the presence of infection.

[0021] Furthermore, during the detection process, the RPA reaction system includes: 28.5-30.5 μl Buffer, 10-11.6 μl H2O, 2-3 μl primer F / R, 2-3 μl DNA, 2-3 μl MgOAC, and the reaction conditions are: 37-42°C, 10-30 min.

[0022] Furthermore, the Cas12a system during the detection process includes: 15-20μl DEPC H2O, 5-10μl ssDNA reporter, 1-5μl Buffer, 1-3μl crRNA, 1-2μl Cas12a, 1-2μl Target DNA, and the reaction conditions are: 37-42°C, 10-60min.

[0023] Beneficial effects:

[0024] The present invention obtains a genomic site unique to common Fusarium through comparative analysis of the genome, and designs a set of specific primers for the site. Combined with the RPA-Cas12a detection reaction liquid system, common Fusarium can be quickly and accurately identified from diseased tissues and cultures, and lotus root Fusarium pathogens can be quickly detected. The lowest detectable target fragment concentration is 1copy / μl (0.3fg / μl), which is nearly 3000 times higher than the existing LAMP technology (10pg / μl), and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 Fluorescence response produced by different crRNAs;

[0027] Figure 2It is the fluorescence effect of the RPA-Cas12a system at different copy numbers;

[0028] Figure 3 The fluorescence responses produced by different strains. DETAILED DESCRIPTION

[0029] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0030] Example

[0031] 1. Specific gene screening

[0032] The whole genome information of F. commune (GCA_023065405.1) was compared with all fungal gene data, and the specific gene sequence RNA polymerase II (RPB2) (No.: OP661093.1) was screened out. The database showed that this gene fragment only existed in the database of the species F. commune, and did not exist in other species.

[0033] The sequence information is:

[0034] CAGATATACCTTTGCTTCTACTCTTTCACATTTGCGTCGAACCAATACTCCTATTGGACGAGATGGTAAATTGGCCAAGCCTCGACAGCTTCACAATACTCACTGGGGTTTGGTGTGTCCCGCCGAAACGCCTGAGGGTCAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGTTATGTCAGTGTCGGCTCTCCAGCCGAGCCTCTCATTGAATTCATGATCAACAGAGGTATGGAAGTTGTTGAGGAGTACGAGCCGACAAGATATCCCCACGCTACAAAGATTTTCGTCAACGGTAGCTGGGTTGGTGTTCACGCCGACCCCAAGCATCTCGTGAATCAGGTTTTGGACACAAGACGAAAGTCGTACGTTCAGTTCGAAGTATCACTTGTTCGTGATATTCGAGACCGTGAATTCAAGATTTTCTCAGACGCTGGTCGTGTCATGAGACCCGTCTTTACAGTCCATCAGGAGGATGACTATGAGAACAACATCACCAAGGGACAACTAGTGTTGACAAAGGAACATGTCAATAGGCTAGCCCAAGAGCAGGCAGAGCCACCTGCCAACCCCGCGGACAAGTTTGGATGGGATGGCTTGATTCGCGAAGGAGCTGTCGAGTATCTCGACGCTGAGGAAGAAGAGACAGCCATGATTTGCATGACGCCAGAGGATCTCGAACTTTACCGTGAGCAAAAGAATGATGAAGCTACACTCACGGAAGAAGAGAAACGGGCCAAGGCAGAGGCAGAGAAGAGGGAACAAGAGGAGGACCGCAACAAGCGATTGAAGACAAAGGTCAACCCCACAACTCACATGTACACACATTGTGAGATTCACCCCAGTATGATTCTCGGTATCTGTGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTATGTAGTCCCTTTGATCACACACCTCACTAACAGCAATAGTCTC(SEQ ID NO:6)

[0035] 2. Design and verification of RPA-specific amplification primers:

[0036] According to the RPA primer design principles, the target gene sequence OP661093.1 was used as the amplification template to design RPA-specific amplification primers with a target amplification fragment in the range of 100bp-200bp, and the designed primers were compared for specificity, and the primer sequence with the highest specificity was selected. Then, according to the RPA primer design requirements, the length of this pair of primers was extended to 32nt according to the target sequence, and RPA-specific primers were designed and synthesized. Considering that RPA detection is very sensitive, it is recommended that primers be synthesized using PAGE or HPLC methods with higher accuracy.

[0037] After screening, the primer information obtained is as follows:

[0038] RPA 5F5:GACAAGATATCCCCACGCTACAAAGATTTTCG(SEQ ID NO:1)

[0039] RPA 5R5:AGCGTCTGAGAAAATCTTGAATTCACGGTCT(SEQ ID NO:2)

[0040] The RPA reaction was performed using the previously extracted F. commune DNA (reaction system: 29.5 μl Buffer, 10.8 μl H2O, 2.4 μl primer F / R, 2.4 μl DNA, 2.5 μl MgOAC; reaction conditions: 39°C, 20 min). The amplified products were then subjected to gel electrophoresis and recovered for sequencing to confirm that the amplified fragment was consistent with the target fragment to verify the primer availability and accuracy.

[0041] RPA amplification target fragment sequence:

[0042] GACAAGATATCCCCACGCTACAAAGATTTTCGTCAACGGTAGCTGGGTTGGTGTTCACGCCGACCCCAAGCATCTCGTGAATCAGGTTTTGGACACAAGACGAAAGTCGTACGTTCAGTTCGAAGTATCACTTGTTCGTGATATTCGAGACCGTGAATTCAAGATTTTCTCAGACGCT

[0043] 3. Design and synthesis of crRNA:

[0044] According to the RPA product sequence and the cleavage characteristics of the LbCas12a enzyme, the crRNA binding segment was screened.

[0045] A total of 3 segments were screened out, namely:

[0046] 5S3: TTTGGACACAAGACGAAAGTCGTAC;

[0047] 5S4:TTTCGTCAACGGTAGCTGGGTTGGT;

[0048] 5S5:TTTCGTCAACGGTAGCTGGGTTGGT.

[0049] A Puc57 vector containing a T7 promoter and a crRNA conservative neck loop sequence (GGATCCCTAAT ACGACTCACTATAGGGAATTTCTACTGTTGTAGAT) was synthesized, named T7crRNA. The reverse complementary sequence of the target DNA sequence + the reverse complementary sequence of the conservative neck loop structure were designed according to the crRNA binding site.

[0050] crDNA 5S3B:TACGACTTTCGTCTTGTGTCATCTACACTTAGTAGAAAT TA (SEQ ID NO: 3);

[0051] crDNA 5S4B: AATCAGGTTTTGGACACAAGACATCTACACTTAGTAGA AATTA (SEQ ID NO: 4)

[0052] crDNA5S5B: CACCACCCAGCTACCGTTGACATCTACAACAGTAGAA ATTA (SEQ ID NO: 5).

[0053] Primer T7-F-300: TACCGCACAGATGCGTAAGG was used as a forward primer to pair with crDNA5S3B, crDNA5S4B, and crDNA 5S5B, and T7crRNA was PCR-generated to recover the PCR product. The PCR product was used as a template and transcribed using the HiScribe T7 Quick High Yield RNA Synthesis kit. The transcription product was purified using the SpinColumn RNA Cleanup & Conce ntration Kit to obtain crRNA5S3B, crRNA5S4B, and crRNA5S5B.

[0054] 4. Screening of crRNA

[0055] Using the DNA of F. commune as a template, the RPA target fragment was amplified and recovered by PCR, and then the recovered DNA was placed in three different crRNA and its combined Cas12a systems (30ul system: 17μl DEPC H2O; 6μl ssDNA reporter; 3μl Buffer; 2μl crRNA; 1μl Cas12a; 1μl Target DNA) for cleavage reaction (reaction conditions: 37°C, 30min). After the reaction is completed, the fluorescence is observed under 308nm wavelength ultraviolet light with a gel reader. Among them, ssDNA reporter is a fluorescent reporter probe with a concentration of 2μM: 5'-FAM-TTATT-BHQ1-3', which is visible to the naked eye under 308nm wavelength ultraviolet light.

[0056] like Figure 1 As shown, the results show that all three crRNAs can successfully carry out the cleavage reaction, but the efficiency is different, namely crRNA 5S3B: 70, crRNA 5S4B: 56, crRNA5S5B: 33, and the combination of crRNA5S4B and crRNA 5S5B did not produce fluorescence, so crRNA 5S3B was selected as the final crRNA.

[0057] 5. Sensitivity detection of RPA-Cas12a system

[0058] Extract DNA from F. commune strain NAN-15, use primers PCR 5F (CACTGGGG TTTGGTGTGTCC) and PCR 5R (TTAGTGAGGTGTGTGATCAAAGGGA) to amplify the target fragment (amplification conditions: 94℃5min, 95℃30S, 56℃15S, 72℃15S, 32 cycles, 72℃5min), after amplification, gel electrophoresis was performed on the product, and the 834bp band was recovered. Use the TOPO vector to clone the fragment into Escherichia coli (Zero Background pTOPO-TA / Blun t Simple Cloning Kit), culture for 24h, and extract the plasmid. The recovered plasmid concentration is 14ng / μl.

[0059] According to the original plasmid size of 1865 bp and the amplified fragment size of 834 bp, the plasmid size after cloning is 2699 bp, so the concentration of the plasmid solution is calculated to be 14 ng / ul, and the target plasmid copy number is 5.071×10 9According to this data, the plasmid solution was diluted to 1copy / μl (0.3fg / μl), 10copis / μl (3fg / μl) and 100copis / μl (30fg / μl), and then the Cas12a reaction system was added to perform the Cas12a cleavage reaction (the reaction system and conditions are the same as 4). After the reaction is completed, the fluorescence is observed under 308nm wavelength ultraviolet light with a gel reader. The results are as follows Figure 2 As shown, the results showed that the system can detect target fragments with a minimum concentration of 1 copy / μl (0.3fg / μl), and the sensitivity is nearly 3000 times higher than that of LAMP's 10pg / μl.

[0060] 6. Specificity detection and verification of RPA-Cas12a system

[0061] Extract DNA from F. commune strains NAN-15, LFB2, LFB3, NAN3, JINHUA, GUANGCHANG, F. oxysporum strain FO-1, and F. oxysporum f. sp. niveum strain FonSH. Then, use their DNA as template DNA, use RPA5F5 and RPA 5R5 as primers for RPA reaction (reaction conditions as described in 2), and add crRNA 5S3B as the guide Cas12a reaction system as Target DNA for cleavage reaction (reaction system and conditions are the same as described in 4). After the reaction is completed, use a gel reader to observe fluorescence under 308nm wavelength ultraviolet light, and the results are as follows Figure 3 As shown, the results showed that the designed RPA primers and crRNA could accurately distinguish F. commune from F. oxysporum strains with good specificity.

[0062] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A primer set for detecting lotus root spoilage bacteria (Fusarium commune), characterized in that: Including RPA primer pairs and crRNA; The RPA primer pair is a primer pair consisting of two single-stranded DNAs shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequence of the crRNA is shown in SEQ ID NO.

3.

2. A kit for detecting lotus root spoilage bacteria (Fusarium commune), characterized in that: Contains an RPA amplification reagent, a CRISPR-Cas12a detection reagent and the primer set according to claim 1.

3. The kit according to claim 2, characterized in that The RPA amplification reagent includes all or part of the following: a recombinase capable of binding to single-stranded nucleic acid, a single-stranded DNA binding enzyme, a strand displacement DNA polymerase, dNTPs and magnesium acetate.

4. The kit according to claim 2 or 3, characterized in that The CRISPR-Cas12a detection reagent includes Cas12a protein and / or a signal reporter probe.

5. The kit according to claim 4, characterized in that The Cas12a protein is selected from AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a and BoCas12a, preferably LbCas12a protein, and the signal reporter probe is: 5'-FAM-TTATT-BHQ1-3'.

6. Use of the primer set according to claim 1 or the kit according to any one of claims 2 to 5 in any of the following: (A1) preparing a product for detecting lotus root spoilage bacteria (Fusarium commune); (A2) preparing a product for diagnosing infection with lotus root spoilage bacteria (Fusarium commune); (A3) Prepare products for diagnosing or assisting in the diagnosis of lotus root spoilage disease.

7. A method for detecting lotus root corruption bacteria (Fusarium commune) or diagnosing lotus root corruption disease infection, comprising the following steps: (b1) extracting DNA from the sample to be tested; (b2) using the DNA extracted in (b1) as a template and using the primer set described in claim 1 or the kit described in claim 2 for detection; (b3) Determine whether lotus root spoilage bacteria (Fusarium commune) or lotus root spoilage disease infection exists based on the test results.

8. The method according to claim 7, characterized in that The test result is the fluorescence observed under ultraviolet light with a wavelength of 308nm. Fluorescence represents a positive result, which means infection exists.

9. The method according to any one of claims 7-8, characterized in that: During the detection process, the RPA reaction system includes: 28.5-30.5μl Buffer, 10-11.6μl H2O, 2-3μl primer F / R, 2-3μl DNA, 2-3μl MgOAC, and the reaction conditions are: 37-42°C, 10-30min.

10. The method according to any one of claims 7-8, characterized in that: During the detection process, the Cas12a system includes: 15-20μl DEPC H2O, 5-10μl ssDNA reporter, 1-5μl Buffer, 1-3μl crRNA, 1-2μl Cas12a, 1-2μl Target DNA, and the reaction conditions are: 37-42°C, 10-60min.

Images