Application of bifidobacterium longum in preparation of heavy metal adsorption product

Abstract

The invention relates to the technical field of food biology, in particular to application of bifidobacterium longum in preparation of a heavy metal adsorption product. The bifidobacterium longum disclosed by the invention is bifidobacterium longum BD3150, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.20105. Compared with other bifidobacteria, the bifidobacterium longum subsp. Longum strain BD3150 provided by the invention has a good adsorption effect on heavy metals of lead and copper.

Description

Technical Field

[0001] The invention relates to the field of food biotechnology, in particular to use of Bifidobacterium longum in preparing heavy metal adsorption products. Background Art

[0002] Among various metal pollutants, lead (Pb) and its compounds are the most harmful. They are widely distributed in the environment and food chain. When accumulated to a certain extent in the human body, they will cause oxidative stress and destroy the metabolism of essential metals, leading to acute or chronic toxic effects on nerves and damage to the urinary and cardiovascular systems. Clinically, patients with lead poisoning will suffer from mental delusions, hematuria, anemia due to liver disease, renal tubular atrophy and even death. Data show that the number of cases of lead poisoning caused by industrial development has increased year by year. Among them, the blood lead level of children in areas with the most serious heavy metal pollution can reach 7.06mg / dL, far exceeding the normal value.

[0003] Currently, the most common treatment strategy for heavy metal poisoning is to promote the excretion of metals by using chelators, such as ethylenediaminetetraacetic acid (EDTA) and dimercaptosuccinic acid (DMSA) for lead poisoning. However, these chelators have certain side effects and are not suitable for large-dose and long-term treatment. Summary of the invention

[0004] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a use of Bifidobacterium longum in preparing a heavy metal adsorption product, so as to solve the problems in the prior art.

[0005] To achieve the above object and other related objects, the present invention provides use of Bifidobacterium longum in preparing a heavy metal adsorption product.

[0006] Preferably, the Bifidobacterium longum is Bifidobacterium longum BD3150, and its deposit number is CGMCC No.20105.

[0007] The present invention also provides a method for removing heavy metal ions in water, the method comprising the following steps:

[0008] 1) mixing the aforementioned Bifidobacterium longum with water;

[0009] 2) Separating the Bifidobacterium longum cells and the water in step 1), the separated water is the water from which the heavy metal ions are removed.

[0010] As described above, the use of Bifidobacterium longum in the preparation of heavy metal adsorption products of the present invention has the following beneficial effects:

[0011] Compared with other bifidobacteria, the Bifidobacterium longum subspecies longum strain BD3150 provided by the present invention has good adsorption effects on heavy metals lead and copper. DETAILED DESCRIPTION

[0012] The invention provides use of Bifidobacterium longum in preparing a heavy metal adsorption product.

[0013] In some specific embodiments, the Bifidobacterium longum is Bifidobacterium longum subsp. longum BD3150, which is deposited in the China General Microbiological Culture Collection Center CGMCC with a deposit number of CGMCC No. 20105 and an address of deposit at the Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.

[0014] In some specific embodiments, the Bifidobacterium longum BD3150 contains a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No. 1 or SEQ ID No. 2.

[0015] In some specific embodiments, in the heavy metal adsorption product, based on the total mass of the heavy metal adsorption product, the content of Bifidobacterium longum subsp. longum BD3150 is 10 6 -10 11 CFU / ml. More specifically, the content of Bifidobacterium longum subsp. longum BD3150 is 10 6 -10 7 CFU / ml, 10 7 -10 8 CFU / ml, 10 8 -5×10 8 CFU / ml, 5×10 8 -10 9 CFU / ml, 10 9 -10 10 CFU / ml or 10 10 -10 11 CFU / ml. Preferably, the content of Bifidobacterium longum subsp. longum BD3150 is 10 8 -10 9 CFU / ml.

[0016] In some specific embodiments, the heavy metal ion is selected from one or more of copper ion, lead ion, zinc ion, tin ion, nickel ion, cobalt ion, antimony ion, mercury ion, cadmium ion or bismuth ion. Preferably, the heavy metal ion is lead ion or copper ion.

[0017] The present invention also provides a method for removing heavy metal ions in water, the method comprising the following steps:

[0018] 1) mixing the aforementioned Bifidobacterium longum with water;

[0019] 2) Separating the Bifidobacterium longum cells and the water in step 1), the separated water is the water from which the heavy metal ions are removed.

[0020] In some specific embodiments, the mixing time in step 1) is 0.5-2 h. Specifically, the mixing time is 0.5-1 h, 1-1.25 h, 1.25-1.75 h or 1.75-2 h.

[0021] In some embodiments, the viable count of Bifidobacterium longum after mixing in step 1) is 5×10 7 -5 x10 8 CFU / ml. Specifically, the viable count is 5x10 7 -7.5x10 7 CFU / ml, 7.5x10 7 -1 x10 8 CFU / ml, 1x10 8 -2.5x10 8 CFU / ml or 2.5x10 8 -5 x10 8 CFU / ml.

[0022] In some specific embodiments, the separation method in step 2) can be selected from centrifugation, filtration or static precipitation.

[0023] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0024] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0025] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0026] Example 1 Screening, identification and preservation of Bifidobacterium longum BD3150

[0027] The Bifidobacterium longum BD3150 in the present invention is obtained by the following method: 1 g of stool sample from healthy Tibetan people is aseptically weighed, serially diluted with sterile physiological saline, and the dilution is evenly spread on a sterile TPY agar medium (purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., China) by coating, and anaerobically cultured at 37°C for 48 hours, and a single colony with smooth, translucent colonies and obvious protrusions is selected and streaked again on an MRS agar medium. After anaerobically cultured at 37°C for 24 hours, a single colony is selected and entrusted to the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration for rpoβ and tuf gene sequencing and physiological and biochemical detection (as shown in Table 1).

[0028] The rpoβ gene sequence of this strain is as follows:

[0029] SEQ ID No.1

[0030] TTTAGGGTTGTCGATTTACGATCGTTCCCTCCACCAGGAAGACATCATCGCCACAATCAAGTACCTGGTGGCCCTGCACGACGGTGCGGCGACCTTCCCGGGCAAGCGCAACGGCGAAGACGTTGACCTGCGCGTGGACGTCGACGATATCGATCACTTCGGCAACCGTCGTATCCGCCAGGTCGGCGAGCTGATTCAGAACCAGCTGCGTACCGGTCTGAGCCGTATGGAGCGCGTGGTGCGCGAGCGTATGACCACTCAGGACGCCGAGGCCATCACCCCGCAGTCCCTGATCAACATCCGTCCGGTGAACGCCACCATCAAGGAGTTCTTCGGCACTTCCCAGCTCTCCCAGTTCATGGATCAAAACAACCCGCTGTCCGGTGTGACGAACAAGCGTCGTCTTTCCGCACTGGGCCCCGGCGGTCTGTCCCGCGACCGCGCCTCCATGGAGGTGCGCGACGTGCACCCGTCCCACTTCGGCCGTATGTGCCCCCGATAGA

[0031] The tuf gene sequence of this strain is shown as follows:

[0032] SEQ ID No.2

[0033] GTGCGGGACGAGGTGTGGCACCTTCACGCACAGCGAAGGTCAGGCCTTCCTCCATAGCGATGGGCTGAATCAGCTCAACGGTGAAGGTAGCGTGGTCGCCCGGCTGAACCATCTCGACGCCTTCCGGCAGCTCGATGACGCCGGTGACGTCGGTGGTGCGGAAGTAGAACTGCGGACGGTAGTTGGAGAAGAACGGCGAGTGACGGCCGCCTTCGTCCTTGGTCAGCACGTAGACTTCGCCCTCGAACTTGGTGTGCGGGGTGACGGAGCCCGGCTTGGCCACAACCTGGCCACGCTCGACATCGTCACGGCCGAGACCACGCAGAAGCAGACCGGTGTTGTCGCCAGCCTCGCAGGCGTCCATGGTCTTGTGGAAGGTCTCGATGGAGGTGACGGTGGTCTGCTGGGTCGGACGGATACCAACGATCTCGACCGGGGTGTTGACGGCCAGCTGGCCACGCTCGACACGACCGGTGACAACGGTACCACGGCCGGAGATGGTGAAGACGTCCTCGATCGGCATCAGGAACGGCTTGTCCAGGTCGTGAACCGGGGTCGGGATGTAGTCGTCGACAGCGTCCATGAGGTCCTTAACGGACTGGACCCA CTTCTCGTGGTCCGGAGCGTCGTCGTGCAGAGCACCGTAAGCGGAGGTGTGGATGACCGGGCAGTCACGGTCGAAGCCGTTCTCGTCGAGGAGGTCGCGGACCTCTTCTTCGACGAGCTCGATGAGCTCTTCATCGTCGACCATGTC GCACTTGTTCAGGGCGACGAGGATCTTCGGAACGCCAACCTGACGGGCGAGCAGCACGTGCTCGCGAGTCTGGGCCATCGGGGCCGTCGGTGGCGGACACAACGAGGATAGCGCCATCCATCTGGGCAGCACCGGTAATCATGTTCT TCACGAAGTCGGCGTGGTCCGGGCAGTCGACGTGAGCGTAGTGACGCTTCTCGGTCTGGTACTCGATGTGGGCGATGTTGATGTGATACCGGCGGCGGTCTCTTCCGGGAGCGAAATCGATCTGGATGAAGAGTCGTACCTTCAAAA

[0034] Table 1 Results of physical and chemical tests on strains

[0035] Test Project result Test Project result Test Project result glycerin - Inositol - Inulin - Erythrocarb - Mannitol - Melezitose - D-arabinose - Sorbitol - Raffinose + L-arabinose + α-Methyl-D-mannoside - starch - D-Ribose + α-Methyl-D-glucoside - Glycogen - D-Xylose + N-acetyl-glucosamine - Xylitol - L-Xylose - Amygdalin + Gentianobiose - Adonol - Arbutin - D-turanose + β-Methyl-D-xyloside - Aesculin + D-Lyxose - D-Galactose + Salicin - D-Tagatose - D-Glucose + Cellobiose + D-fucose - D-Fructose - maltose + L-fucose - D-Mannose - lactose + D-arabinitol - L-sorbitol - Melibiose + L-arabinitol - L-Rhamnose - sucrose + Gluconate - Dacron - Trehalose - 2-Keto-gluconate -

[0036] The strain was identified as Bifidobacterium longumsubsp.longum by rpoβ and tuf gene sequence comparison and physiological and biochemical analysis at the China General Microbiological Culture Collection Center (CGMCC). The strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 18, 2020, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101. The strain's deposit number is CGMCC No.20105.

[0037] Example 2 Heavy metal adsorption effect of Bifidobacterium longum BD3150

[0038] 1. Preparation of Bifidobacterium longum BD3150 bacterial suspension: The lyophilized powder of Bifidobacterium longum BD3150 was dissolved in a small amount of sterile distilled water, and a loop was taken with an inoculation loop and streaked on TPY solid medium (purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., China), and anaerobically cultured at 37°C for 48 hours. A single colony was picked with an inoculation loop and placed in 10 mL TPY liquid medium (purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., China), and the colony was evenly dispersed in the liquid medium using a vortex oscillator, cultured at 37°C for 24 hours, and inoculated into TPY liquid medium with an inoculum of 2% (v / v). After culturing again at 37°C for 24 hours, the culture was centrifuged at 15,000 rpm for 10 minutes, the supernatant was discarded, the bacteria were washed twice with sterile distilled water, and then suspended with a small amount of sterile water to obtain a bacterial suspension of Bifidobacterium longum BD3150. The concentration of the bacterial suspension was determined to be 1.8×10 10 CFU / mL.

[0039] 2. Heavy metal adsorption effect of Bifidobacterium longum BD3150

[0040] The Bifidobacterium longum BD3150 suspension prepared above was added to a final concentration of 1×10 8 CFU / mL was added to 20 mg / L lead ion aqueous solution for adsorption experiment, and the reaction was oscillated at 37°C and 200 rpm for 1 h, and centrifuged at 6000 rpm for 15 min, and the supernatant solution and bacterial precipitate were collected respectively.

[0041] After the supernatant solution was filtered through a 0.22 μm filter membrane, the concentrations of lead ions and copper ions in the solution were detected by inductively coupled plasma optical emission spectrometry (ICP-OES). The removal rate was calculated as follows:

[0042]

[0043] In the above formula, C 初始 is the metal solubility in the original solution before adsorption (mg / L); C 实验 is the metal solubility (mg / L) in the supernatant after adsorption. After freeze-drying, the bacterial precipitate was digested in a graphite digester at 130°C for 30 min by adding 2.5 mL of concentrated nitric acid (superior purity), and the tube was rinsed twice with deionized water, and the volume was fixed to 10 mL. The concentrations of lead ions and copper ions in the solution were detected by inductively coupled plasma optical emission spectrometry (ICP-OES). The heavy metal adsorption per unit weight of the bacterial cell was obtained by conversion, and the results are shown in the following table.

[0044] Table 2 Heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150

[0045] lead copper Heavy metal removal rate in supernatant (%) 50.6 32.4 Heavy metal adsorption capacity (mg / g bacterial weight) 12.8 7.9

[0046] Example 3 Heavy metal adsorption effect of Bifidobacterium longum

[0047] 1. Preparation of Bifidobacterium longum BD3150 bacterial suspension: same as Example 2.

[0048] 2. Heavy metal adsorption effect of Bifidobacterium longum BD3150

[0049] The above prepared Bifidobacterium longum BD3150 bacterial suspension was added to a final concentration of 5×10 8 CFU / mL was added to 20 mg / L lead ion aqueous solution for adsorption experiment, and the reaction was oscillated at 37°C and 200 rpm for 0.5 h. After centrifugation at 6000 rpm for 15 min, the supernatant solution and bacterial precipitate were collected respectively.

[0050] The heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150 were detected and calculated by referring to the method described in Example 2. The results are shown in the following table.

[0051] Table 3 Heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150

[0052] lead copper Heavy metal removal rate in supernatant (%) 60.7 34.6 Heavy metal adsorption capacity (mg / g bacterial weight) 12.1 7.2

[0053] Example 4 Heavy metal adsorption effect of Bifidobacterium longum

[0054] 1. Preparation of Bifidobacterium longum BD3150 bacterial suspension: same as Example 2.

[0055] 2. Heavy metal adsorption effect of Bifidobacterium longum BD3150

[0056] The above prepared Bifidobacterium longum BD3150 bacterial suspension was added to a final concentration of 5×10 7 CFU / mL was added to 20 mg / L lead ion aqueous solution for adsorption experiment, and the reaction was oscillated at 37°C and 200 rpm for 2 h, and centrifuged at 6000 rpm for 15 min, and the supernatant solution and bacterial precipitate were collected respectively.

[0057] The heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150 were detected and calculated by referring to the method described in Example 2. The results are shown in the following table.

[0058] Table 4 Heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150

[0059] lead copper Heavy metal removal rate in supernatant (%) 54.3 33 Heavy metal adsorption capacity (mg / g bacterial weight) 13.4 8.2

[0060] Example 5 Heavy metal adsorption effect of Bifidobacterium longum

[0061] 1. Preparation of Bifidobacterium longum BD3150 bacterial suspension: same as Example 2.

[0062] 2. Heavy metal adsorption effect of Bifidobacterium longum BD3150

[0063] The Bifidobacterium longum BD3150 suspension prepared above was added to a final concentration of 2.5×10 8 CFU / mL was added to 20 mg / L lead ion aqueous solution for adsorption experiment, and the reaction was oscillated at 37°C and 200 rpm for 1.25 h, and centrifuged at 6000 rpm for 15 min, and the supernatant solution and bacterial precipitate were collected respectively.

[0064] The heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150 were detected and calculated by referring to the method described in Example 2. The results are shown in the following table.

[0065] Table 5 Heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150

[0066] lead copper Heavy metal removal rate in supernatant (%) 86.4 59.7 Heavy metal adsorption capacity (mg / g bacterial weight) 13.6 8.1

[0067] Example 6 Heavy metal adsorption effect of Bifidobacterium longum

[0068] 1. Preparation of Bifidobacterium longum BD3150 bacterial suspension: same as Example 2.

[0069] 2. Heavy metal adsorption effect of Bifidobacterium longum BD3150

[0070] The above prepared Bifidobacterium longum BD3150 bacterial suspension was added to a final concentration of 7.5×10 7 CFU / mL was added to 20 mg / L lead ion aqueous solution for adsorption experiment, and the reaction was oscillated at 37°C and 200 rpm for 1.75 h, and centrifuged at 6000 rpm for 15 min, and the supernatant solution and bacterial precipitate were collected respectively.

[0071] The heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150 were detected and calculated by referring to the method described in Example 2. The results are shown in the following table.

[0072] Table 6 Heavy metal removal rate and heavy metal adsorption per unit weight of Bifidobacterium longum BD3150

[0073] lead copper Heavy metal removal rate in supernatant (%) 69.5 43.2 Heavy metal adsorption capacity (mg / g bacterial weight) 13.6 8.3

[0074] Comparative Example 1 Comparison of different bifidobacteria in adsorption of heavy metals

[0075] Referring to the method described in Example 2, the heavy metal removal rate and the heavy metal adsorption per unit weight of bacteria were compared by adding Bifidobacterium longum BD3150 (provided by Bright Dairy Co., Ltd., Shanghai, China) and Bifidobacterium animalis BB12 (provided by Chr. Hansen, Denmark). The concentration of bacteria was 1x10 8 CFU / mL.

[0076] The heavy metal removal rates and heavy metal adsorption per unit weight of the bifidobacteria (BD3150, BB12) were measured. The results are shown in the following table.

[0077] Table 7 Heavy metal removal rate of different bifidobacteria and heavy metal adsorption per unit weight of bacteria

[0078] Bifidobacterium BD3150 BB12 Lead removal rate in supernatant (%) 50.6 17.1 Copper removal rate in supernatant (%) 32.4 4.8 Lead adsorption capacity (mg / g bacterial weight) 12.8 7.1 Copper adsorption capacity (mg / g bacterial weight) 7.9 2.8

[0079] It can be seen from the above table that the removal rate (adsorption rate) of lead and copper by Bifidobacterium longum BD3150 is significantly higher than that of BB12 with the same number of live bacteria, that is, the heavy metal adsorption capacity per unit weight of BD3150 bacteria is greater than that of BB12.

[0080] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of Bifidobacterium longum in preparing heavy metal adsorption products.

2. The use according to claim 1, characterized in that The Bifidobacterium longum is Bifidobacterium longum subsp. longum BD3150, and its preservation number is CGMCC No.20105.

3. The use according to claim 2, characterized in that: The long bifidobacterium (Bifidobacteriumlongum subsp. longum) BD3150 contains a nucleic acid fragment with a nucleotide sequence as shown in SEQ ID No.1 or SEQ ID No.

2.

4. The use according to claim 1, characterized in that In the heavy metal adsorption product, based on the total mass of the heavy metal adsorption product, the content of Bifidobacterium longum subsp. longum BD3150 is 10 6 -10 11 CFU / ml.

5. The use according to claim 1, characterized in that: The heavy metal ions are selected from one or more of copper ions, lead ions, zinc ions, tin ions, nickel ions, cobalt ions, antimony ions, mercury ions, cadmium ions or bismuth ions.

6. The use according to claim 5, characterized in that The heavy metal ions are lead ions or copper ions.

7. A method for removing heavy metal ions from water, characterized in that: The method comprises the following steps: 1) mixing Bifidobacterium longum with a preservation number of CGMCC No.20105 with water; 2) Separating the Bifidobacterium longum cells and the water in step 1), the separated water is the water from which the heavy metal ions are removed.

8. The method according to claim 7, characterized in that The mixing time in step 1) is 0.5-2h.

9. The method according to claim 7, characterized in that: The viable count of the long bifidobacterium after mixing in step 1) is 5×10 7 -5 x10 8 CFU / ml.

10. The method according to claim 7, characterized in that The separation method in step 2) is selected from centrifugation, filtration or static precipitation.

Images