LAMP (loop-mediated isothermal amplification) detection plate, LAMP joint detection color development kit for multiple respiratory pathogens and detection method of LAMP joint detection color development kit

Abstract

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) detection plate, an LAMP joint detection color development kit for multiple respiratory pathogens and a detection method of the LAMP joint detection color development kit. A plurality of accommodating grooves are distributed in the LAMP detection plate; the detection plate at least comprises a reaction area for eluting nucleic acid and performing amplification reaction, an inner cavity of a tank body of a containing tank of the reaction area is divided into two containing cavities which are distributed up and down by a solid paraffin layer, and LAMP freeze-drying reaction microspheres and eluent are respectively contained in the two containing cavities. The kit comprises the LAMP detection plate, the containing groove of the reaction area is divided into a plurality of different subareas, and the LAMP freeze-drying reaction microspheres in the containing groove of each subarea are used for detecting one or more respiratory tract pathogens. According to the detection plate, the operation is greatly simplified, the operation space is greatly saved, the kit can realize rapid full-automatic nucleic acid extraction and isothermal amplification color development detection of samples, multiple respiratory tract pathogens can be detected on multiple pathogen samples at the same time, and the efficiency and accuracy of clinical diagnosis are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of detection kits, and in particular to a LAMP detection plate, a multiple respiratory pathogen LAMP combined detection color development kit and a detection method thereof. Background Art

[0002] Respiratory pathogen infection is one of the most common infectious diseases in humans worldwide and an important cause of death in humans. Common respiratory pathogens include viruses, bacteria, mycoplasmas and chlamydia, of which more than 70% are viruses. Common viruses include influenza A virus (IVA), influenza B virus (IVB), respiratory syncytial virus (RSV), human parainfluenza virus (HPIV), adenovirus (ADV), and human metapneumovirus (hMPV). Among them, Mycoplasma pneumoniae (MP) is one of the main pathogens causing respiratory tract infections and atypical pneumonia in children, and Chlamydia pneumoniae (CP) mainly causes atypical pneumonia in adults and adolescents, with clinical symptoms similar to those of Mycoplasma pneumoniae. These different types of pathogens can cause community-acquired pneumonia, mainly including local respiratory symptoms such as fever, cough, nasal congestion, runny nose, and throat discomfort, and systemic symptoms such as fatigue, headache, and muscle aches. Persistent viral infection may develop into bronchitis, pneumonia, etc., leading to increased morbidity and mortality in children, the elderly, and people with compromised immune function.

[0003] In pathogen detection, the extraction and amplification of nucleic acids is an important step to improve the efficiency of nucleic acid detection. Its speed and accuracy will directly affect the results of pathogen nucleic acid detection. With the rapid development of nucleic acid detection technology in recent years, POCT detection has become a general trend. Existing detection kits require multiple steps of tedious operations, the detection time is long, and different operations occupy many detection plates and occupy a large space. In addition, during a large number of centralized operations, it is easy to cause false positives due to product aerosol contamination.

[0004] Therefore, existing detection kits need to be further improved. Summary of the invention

[0005] In view of the problems of large space occupation, long detection time and product aerosol pollution of existing test kits, the present invention provides a LAMP detection plate, a LAMP combined detection colorimetric kit for multiple respiratory pathogens and a detection method thereof. The detection plate is easy to operate, saves space, can realize simultaneous elution of nucleic acid and LAMP amplification, and the detection result can be judged by observing the color change of the reaction solution with the naked eye, and the detection efficiency is high.

[0006] To solve the above problems, this application provides the following solutions: In the first aspect, the present application provides a LAMP detection plate having a plurality of receiving grooves distributed thereon; the detection plate includes at least a reaction area for eluting nucleic acids and performing amplification reactions, and the inner cavity of the receiving groove body of the reaction area is divided into two receiving cavities distributed upper and lower by a solid paraffin layer, and the two receiving cavities respectively contain LAMP freeze-dried reaction microspheres and eluent.

[0007] During operation, the inner cavity of the containing tank in the reaction area simultaneously performs the operations of elution, LAMP amplification reaction and color development reaction, thus greatly saving the operation space and simplifying the operation.

[0008] Optionally, in the LAMP detection plate, the eluent is weakly alkaline nuclease-free deionized water containing a pH indicator; the pH value is 8.5±0.2.

[0009] Optionally, in the LAMP detection plate, the pH indicator is one of neutral red, cresol red and phenol red. The concentration of the pH indicator is 10-1000 μM, preferably 100 μM.

[0010] The paraffin wax may be a solid paraffin wax with a low melting point, such as a solid paraffin wax with a melting point of 49-51°C.

[0011] Optionally, in the LAMP detection plate, the LAMP freeze-dried reaction microspheres are located in the upper receiving chamber, the eluent is located in the lower receiving chamber, and the solid paraffin is located between the two, which can prevent the eluent from re-dissolving the LAMP freeze-dried reaction microspheres, thereby facilitating the room temperature storage and transportation of the detection kit.

[0012] In the above scheme, the lower layer of the inner cavity of the holding tank contains an elution liquid for eluting the nucleic acid adsorbed on the magnetic beads, and the elution liquid contains a pH-sensitive dye; a layer of solid paraffin is arranged in the middle of the inner cavity of the holding tank, and LAMP freeze-dried reaction microspheres are placed in the upper layer of the inner cavity of the holding tank. Based on the above arrangement, on the one hand, the solid paraffin layer can isolate the LAMP freeze-dried reaction microspheres and the elution liquid when not in operation; on the other hand, in the working state, the solid paraffin melts and the upper and lower layers are mixed to react, and the solid paraffin finally floats and solidifies on the upper layer, which can also prevent aerosol contamination of the products of the amplification process.

[0013] During use, while the nucleic acid in the sample is being extracted and washed away from impurities such as proteins, the heating module of the equipment can be started simultaneously to melt the solid paraffin, and the magnetic beads adsorbed with nucleic acid are transferred to the eluent in the lower layer through the magnetic rod, and the nucleic acid is released into the eluent. At the same time, the LAMP freeze-dried reaction microspheres are re-dissolved and a constant temperature amplification reaction is performed. Since the eluent in the lower layer contains a pH-sensitive pH indicator such as phenol red dye, as pyrophosphate is released during the amplification process, the color of the reaction system changes from red to yellow, and the test result can be observed to be positive (or negative) by the naked eye. During the above reaction process, paraffin is suspended on the surface of the mixed solution, which prevents aerosol contamination of the product of the amplification process and effectively reduces the problem of false positives caused by contamination.

[0014] Therefore, the above-mentioned detection plate saves space while improving work efficiency and detection accuracy, thereby realizing integrated constant temperature amplification and efficient detection of samples.

[0015] In addition, the above-mentioned detection plate can not only effectively utilize the nucleic acid extraction instruments currently on the market, but the anti-pollution operations after sample addition and extraction can not only ensure the accuracy of the test results but also be harmless to the experimental operators.

[0016] Optionally, the LAMP freeze-dried reaction microspheres include the following components: a freeze-dried LAMP reaction system for detecting target pathogens.

[0017] Preferably, the LAMP reaction system comprises: LAMP reaction buffer, dNTP, MgSO4, nucleic acid dye, LAMP primer set, DNA polymerase and lyophilization protective agent.

[0018] Further preferably, the LAMP reaction system comprises: 1×LAMP reaction buffer, 1.4mM dNTP, 6MmMgSO4, 0.2×Evagreen, 1.6μΜ FIP / BIP Primers, 0.2μΜ F3 / B3 Primers, 0.8μΜ F3 / B3 Primers, 0.32U / μL Bst DNA polymerase, and 1×lyophilized protective agent.

[0019] On the basis of the above, in order to further diversify and integrate the functions of the detection board and further save space, the following improvements are made: The detection plate further comprises: a lysis area and a washing area, wherein each receiving tank in the lysis area is encapsulated with a lysis solution; and each receiving tank in the washing area is encapsulated with a washing solution containing magnetic beads.

[0020] Optionally, in the LAMP detection plate, the lysate comprises the following components in mass volume percentage: one or more of 0.05%-0.2% Tween 20, 0.05%-0.2% Tween 80, 0.05%-0.2% ethylphenyl polyethylene glycol and 0.05-1% Triton X-100. The pH value is 6.0±0.2.

[0021] Preferably, the lysate is composed of the following components in mass volume percentage: 0.05%-0.2% Tween 20, 0.05%-0.2% Tween 80, 0.05%-0.2% ethylphenyl polyethylene glycol and 0.05-1% Triton X-100.

[0022] The above-mentioned lysis solution is used to dissolve lipids and proteins on the cell membrane or the protein shell of the virus, promote the cell or virus to break, and realize the release of nucleic acid in the lysis system.

[0023] Further preferably, the lysate is composed of the following components in mass volume percentage: 0.1% Tween 20, 0.1% Tween 80, 0.2% ethylphenyl polyethylene glycol and 0.08% Triton X-100. The optimized lysate has good lysis effect and high nucleic acid extraction efficiency.

[0024] Optionally, in the LAMP detection plate, the washing solution includes the following components in mass volume percentage: 5-10% magnetic beads, 5-15% sodium chloride, 60%-70% anhydrous ethanol, 1%-2% isopropanol, and the rest is nuclease-free deionized water. The pH value is 7.0±0.2.

[0025] In a second aspect, the present application also provides a colorimetric kit for LAMP combined detection of multiple respiratory pathogens, which includes the aforementioned LAMP detection plate, wherein the receiving tank of the reaction zone is divided into a plurality of different partitions, and the LAMP freeze-dried reaction microspheres in the receiving tank of each partition are used to detect one or more respiratory pathogens.

[0026] Optionally, in the kit, the LAMP primer set in the LAMP freeze-dried reaction microspheres of each partition of the detection plate includes at least one of the following primer sets: (1) A primer set for detecting influenza A virus comprising: IVA-F3 having a sequence as shown in SEQ ID NO.1, IVA-B3 having a sequence as shown in SEQ ID NO.2, IVA-FIP having a sequence as shown in SEQ ID NO.3, IVA-BIP having a sequence as shown in SEQ ID NO.4, IVA-LF having a sequence as shown in SEQ ID NO.5, and IVA-LB having a sequence as shown in SEQ ID NO.6; (2) A primer set for detecting influenza B virus comprising: IVB-F3 having a sequence as shown in SEQ ID NO.7, IVB-B3 having a sequence as shown in SEQ ID NO.8, IVB-FIP having a sequence as shown in SEQ ID NO.9, IVB-BIP having a sequence as shown in SEQ ID NO.10, and IVB-LB having a sequence as shown in SEQ ID NO.11; (3) A primer set for detecting respiratory syncytial virus comprising: RSV-F3 having a sequence as shown in SEQ ID NO.12, RSV-B3 having a sequence as shown in SEQ ID NO.13, RSV-FIP having a sequence as shown in SEQ ID NO.14, and RSV-BIP having a sequence as shown in SEQ ID NO.15; (4) A primer set for detecting human parainfluenza virus comprising: HPIV-F3 having a sequence as shown in SEQ ID NO.16, HPIV-B3 having a sequence as shown in SEQ ID NO.17, HPIV-FIP having a sequence as shown in SEQ ID NO.18, HPIV-BIP having a sequence as shown in SEQ ID NO.19, and HPIV-LB having a sequence as shown in SEQ ID NO.20; (5) The primer set for detecting adenovirus includes: ADV-F3 as shown in SEQ ID NO.21, ADV-B3 as shown in SEQ ID NO.22, ADV-FIP as shown in SEQ ID NO.23, ADV-BIP as shown in SEQ ID NO.24, ADV-LF as shown in SEQ ID NO.25, and ADV-LB as shown in SEQ ID NO.26; (6) A primer set for detecting human metapneumovirus comprising: HMPV-F3 having a sequence as shown in SEQ ID NO.27, HMPV-B3 having a sequence as shown in SEQ ID NO.28, HMPV-FIP having a sequence as shown in SEQ ID NO.29, HMPV-BIP having a sequence as shown in SEQ ID NO.30, HMPV-LF having a sequence as shown in SEQ ID NO.31, and HMPV-LB having a sequence as shown in SEQ ID NO.32; (7) A primer set for detecting Mycoplasma pneumoniae includes: MP-F3 having a sequence as shown in SEQ ID NO.33, MP-B3 having a sequence as shown in SEQ ID NO.34, MP-FIP having a sequence as shown in SEQ ID NO.35, MP-BIP having a sequence as shown in SEQ ID NO.36, MP-LF having a sequence as shown in SEQ ID NO.37, and MP-LB having a sequence as shown in SEQ ID NO.38; (8) The primer set for detecting Chlamydia pneumoniae includes: CP-F3 as shown in SEQ ID NO.39, CP-B3 as shown in SEQ ID NO.40, CP-FIP as shown in SEQ ID NO.41, CP-BIP as shown in SEQ ID NO.42, CP-LF as shown in SEQ ID NO.43, and CP-LB as shown in SEQ ID NO.44.

[0027] The above primer set has high detection specificity and high detection accuracy, and is suitable for the LAMP detection colorimetric kit of the present application.

[0028] Optionally, the reaction area of ​​the kit includes eight partitions, and the primers in the LAMP freeze-dried reaction microspheres of each partition are one of the above-mentioned primer sets for influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae.

[0029] Optionally, each partition is a column or a row of receiving slots. According to the needs, the detection of multiple pathogens of one or more samples can be realized on one plate, and the detection of one pathogen of multiple samples can also be realized on one plate.

[0030] Optionally, the kit further includes: a positive quality control reagent and a negative quality control reagent. Among them, the positive quality control reagent is: a plasmid containing target genes of influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae, respectively. The plasmid can be an existing conventional plasmid, which is not specifically limited here. The negative quality control reagent is nuclease-free DEPC water.

[0031] On the basis of the above, the test plate is also provided with a negative control reaction area and a positive control reaction area. The solutions originally provided in the negative control reaction area and the positive control reaction area are the same as those in other reaction areas, except that positive quality control reagents and negative quality control reagents are added during operation.

[0032] In one embodiment, the detection plate uses a 96-deep-well plate, which consists of 8 horizontal rows and 12 vertical columns of wells. Among them, the 1st and 7th columns are lysis areas, the 2nd and 8th columns are washing areas, and the 3rd and 9th columns are sample reaction areas, where elution and amplification are performed simultaneously; the 4th and 10th columns are negative control reaction areas, and the 5th and 11th columns are positive control reaction areas. In the lysis area, each well is filled with 400 μL of lysis solution using a peristaltic pump, and in the washing area, each well is filled with 600 μL of washing solution containing magnetic beads using a peristaltic pump; in the reaction area, the lower layer is filled with 100 μL of elution solution, and the concentration of LAMP freeze-dried reaction microspheres is 50 μL.

[0033] In other cases, the carrier plate is not limited to a 96-well deep-well plate, and other types of reaction containers may also be used, such as a 48-well deep-well plate, a centrifuge tube, or a microfluidic chip.

[0034] In other embodiments, three deep well plates may be used, the first plate being the lysis area, the second plate being the washing area, columns 1 to 10 of the third plate being the sample reaction areas, column 11 being the positive control reaction area, and column 12 being the negative control reaction area.

[0035] In a third aspect, the present application also provides a pathogen LAMP detection method based on a magnetic bead method for fully automatic nucleic acid extraction and amplification, which uses the aforementioned kit, and the method comprises the following steps: S1. Take out the pre-packaged test plate from the test kit, mix it by inverting it several times, shake the test plate gently or use a flat plate centrifuge to centrifuge it briefly to concentrate the liquid and magnetic beads in the holding tank at the bottom of the test plate, and tear off the film on the top of the test plate; S2, lysis: adding an appropriate amount of sample to the lysis solution in the holding tank of the lysis area for lysis; S3, washing: the magnetic beads in the washing area are adsorbed by a magnetic rod and transferred to the lysis area, the nucleic acid in the lysis solution is adsorbed to the magnetic beads, and then the magnetic beads are transferred to the washing solution in the washing area for treatment; Wash off the proteins and other components carried by the magnetic beads.

[0036] S4, elution and amplification: heat until the solid paraffin melts, transfer the magnetic beads in the washing solution to the elution solution in the holding tank of the reaction area, elute the nucleic acid, and at the same time, re-dissolve the LAMP freeze-dried reaction microspheres to form a reaction mixture in the tank, and perform LAMP isothermal amplification reaction. After the reaction is completed, determine whether the test result is positive or negative based on the color development result of the reaction mixture.

[0037] Optionally, the lysis conditions are: lysis at room temperature for 1 to 10 minutes.

[0038] If phenol red is used as the pH indicator, when the reaction mixture changes from red to yellow, it indicates that the test result is positive, otherwise it is negative. The color change result depends on the selected pH indicator.

[0039] The present invention has the following beneficial effects: 1. The LAMP detection plate provided by the present invention fully and organically combines the LAMP freeze-dried reaction microspheres and the eluent in one receiving tank through the central setting of solid paraffin, thereby realizing the multifunctional integration of nucleic acid elution, amplification and color development detection, which not only greatly simplifies the operation, but also greatly saves the operation space.

[0040] 2. The respiratory pathogen LAMP detection colorimetric kit provided by the present invention can realize gentle, rapid, and fully automatic nucleic acid extraction and constant temperature amplification colorimetric detection of samples, and can simultaneously perform multiple respiratory pathogen detections on multiple pathogen samples. At the same time, the coverage of the paraffin layer can effectively avoid aerosol contamination of the product, greatly shortening the time and labor costs required for nucleic acid detection, and improving the efficiency and accuracy of clinical diagnosis.

[0041] 3. The kit can effectively utilize the nucleic acid extraction instrument currently on the market, without the need for a qPCR instrument or the purchase of additional instruments, thus saving costs, shortening the reaction time, and easing the sample-in and result-out, with less manual operation and simple and clear interpretation. The actual ingredients used are simple, mild and harmless, and the lysis solution extracts nucleic acids with high accuracy and efficiency.

[0042] 4. The detection plate and the test kit of the present invention only use one or three 96-deep-well plates, which greatly saves the use of consumables and precision detection instruments, and can efficiently, accurately and safely perform the nucleic acid extraction and amplification process of the sample, solving the time-consuming and labor-intensive difficulties and pain points in the current nucleic acid detection industry; at the same time, a pH-sensitive dye is added to the eluent, and the visual amplification detection of the detection sample can be achieved by heating the module. The experimental results are clearly visible by naked eye, and combined with the paraffin sealing layer, aerosol contamination of the product can be effectively prevented, thereby realizing fully automatic integrated nucleic acid amplification detection of the sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 is a side view of the detection board before the present invention is used; Figure 2 It is a side view schematic diagram of the three-layer components of the lysing solution, the washing solution containing magnetic beads and the reaction area of ​​the present invention; for easy observation, the container of each solution adopts a transparent test tube; A is the lysing solution, B is the washing solution, C1 is the LAMP freeze-dried reaction microsphere, C2 is solid paraffin, and C3 is the eluent; Figure 3It is a reaction result diagram of the detection plate of the present invention after sample nucleic acid extraction and amplification; wherein A is the lysis area, B is the washing area, C is the sample reaction area, D is the positive control reaction area, and E is the negative control reaction area; Figure 4 This is the result graph of the detection sensitivity amplification of 8 pathogens; Figure 5 It is a result chart that uses the positive results of different pathogens detected in actual samples; Figure 5 Not all sample results are listed in the figure. The location of positive samples is marked in the figure, and positive samples are colored yellow. DETAILED DESCRIPTION

[0044] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0045] Optimization of Lysis Solution Components and Concentrations in Example 1 Kit 1. Experimental methods: In order to obtain better extraction effect, the components and concentration of the lysate of the kit were adjusted and optimized, and the following five lysate solutions were designed: Solution 1: 0.2% (w / v) guanidine thiocyanate, 0.1% (w / v) tris-HCl, 0.1% (w / v) sodium chloride, 0.1% (w / v) isopropanol; Solution 2: 0.1% (w / v) Tween 20, 0.1% (w / v) Tween 80, 0.2% (w / v) ethylphenyl polyethylene glycol, and 0.08% (w / v) Triton X-100; Solution 3: 0.2% (w / v) disodium EDTA, 0.08% (w / v) Triton X-100, 0.1% (w / v) Tween 80, 0.1% (w / v) isopropanol; Regimen 4: 0.2% (w / v) Tween 20, 0.1% (w / v) Tween 80, 0.15% (w / v) ethylphenyl polyethylene glycol, and 0.1% (w / v) Triton X-100; Scheme 5: 0.1% (w / v) Tween 20, 0.2% (w / v) Tween 80, 0.3% (w / v) ethylphenyl polyethylene glycol and 0.06% (w / v) Triton X-100.

[0046] The five lysis buffers were used to extract nucleic acids of eight viruses (see Table 1 for details), and the nucleic acid concentrations of the extracted nucleic acid solutions were measured using Nanodrop (ultra-micro spectrophotometer).

[0047] 2. Experimental results and analysis The nucleic acid concentrations extracted by the five schemes are shown in Table 1. From the results, it can be seen that the nucleic acid concentration extracted by the lysate of Scheme 2 is the highest, which is significantly higher than the other four schemes. The kit used in this application has greater advantages.

[0048] Table 1 Nucleic acid detection concentrations obtained by five lysis buffer solutions

[0049] Example 2 Preparation of a multi-respiratory pathogen LAMP detection colorimetric kit In this embodiment, a LAMP combined detection colorimetric kit for detecting eight respiratory pathogens is prepared, wherein the eight respiratory pathogens are influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae. In other embodiments, the kit can also be configured to detect other pathogens or one or more of the above pathogens.

[0050] (1) Design of primer set: According to the characteristics of pathogens, corresponding LAMP primer sets were designed and synthesized. The corresponding primer sets of LAMP freeze-dried microsphere reaction microspheres used to detect the above eight pathogens are as follows: IVA-F3:TCTCTATCGTCCCGTCAGG (SEQ ID NO.1) IVA-B3:GCATTTTGGACAAAGCGTCT (SEQ ID NO.2) IVA-FIP:GCCACTCCATGAGAGCCTCAAGCTCAAAGCCGAGATCGCAC (SEQ ID NO.3) IVA-BIP:AGACCGATCCTGTCACCTCTGATGCAGTCCTCGCTCACTG (SEQ ID NO.4) IVA-LF:CAGCAAAGACATCTTCAAGTCTCT (SEQ ID NO.5) IVA-LB:AGGGGATTTTAGGATTTGTGTTCAC (SEQ ID NO.6) IVB-F3:AAGAGAGAAAAGCAATTGGAG(SEQ ID NO.7) IVB-B3:GTTGGGCCATCAACATCC(SEQ ID NO.8) IVB-FIP:CTGTTCATACAGTATGGCTCAAACCTGAAAGTACTCCTATTTATGAATCC (SEQ IDNO.9) IVB-BIP:GCAACTGTACGAAATACAATTGGACTGGTTCTTCCTCTATGTCATC (SEQ ID NO.10) IVB-LB:CGATTACCCCTCAACACCAGA (SEQ ID NO.11) RSV-F3:GCAAGTGATGTTACGGTG(SEQ ID NO.12) RSV-B3:CATTGCCCAATACTACACTAG(SEQ ID NO.13) RSV-FIP:ACCTCCACAACTTGTTCCATTTGTTAAAAACATTATGTTAGGACACG (SEQ IDNO.14) RSV-BIP:GGTGGAGAAGCAGGATTCTACCAGAAGTGAGGAAATTGAGTCAA (SEQ ID NO.15) HPIV-F3:CGCAAATACATCGCGTGT(SEQ ID NO.16) HPIV-B3:GAACAACATAGGTTGTAAGGTA(SEQ ID NO.17) HPIV-FIP:TGTCCATTTTTGAGTCTTAGCATGTTAATCCTACCATAATGTACTCAAGT (SEQ IDNO.18) HPIV-BIP:ACTACATCATGTATCACTCACTTCGTAAGGCTGGTTTGGTTGA (SEQ ID NO.19) HPIV-LB:GAAAGGGCTACTGCTTCCAC(SEQ ID NO.20) ADV-F3:TGGTGCAGTTTGCCCG (SEQ ID NO.21) ADV-B3:TGTCACCCACAGCCAGG(SEQ ID NO.22) ADV-FIP:TCACGTCGTGCGTAGGCGCGCCACCGAGACGTACTTCA (SEQ ID NO.23) ADV-BIP:CACAGACCGGTCCCAGCGTCCGCGCCTTGTACGAGTA(SEQ ID NO.24) ADV-LF:GGGTTTCTAAACTTGTTATTCAGGC(SEQ ID NO.25) ADV-LB:CGGTTCATCCCTGTGGATCG(SEQ ID NO.26) HMPV-F3:GTGTATCACAGAAGTTTGTTCA (SEQ ID NO.27) HMPV-B3:TGTGACCTGTTTCAACTCG(SEQ ID NO.28) HMPV-FIP:GCTTGCATGAATATGTTGACGAATAGAGTATGGTAAAGCATTAGGCT(SEQ IDNO.29) HMPV-BIP:GCTGGTCAAACAATGCTGAGGGCTTGTACAGATACATGTCCT(SEQ ID NO.30) HMPV-LF:CTTTGCTGCCTGTAGAGGATG(SEQ ID NO.31) HMPV-LB:TGGGGGGTTATCGCCAG(SEQ ID NO.32) MP-F3:TCTTACCACTGTTAACGGCC(SEQ ID NO.33) MP-B3:CCGCTTTGGTCAACACATCA(SEQ ID NO.34) MP-FIP:ACGGCAACACGTAATCAGGTCATCCAGTCAAGGTCCCCAA(SEQ ID NO.35) MP-BIP:AGGACTTGCCATTGGAATCCCAGATAGCGCAAACCCAGCC(SEQ ID NO.36) MP-LF:CTGGTTAAACGGACTAAACAAGGT(SEQ ID NO.37) MP-LB:ATGCACAAGAACAAACAGGCC (SEQ ID NO.38) CP-F3:AATGAACTACCAAACGTTTTCT (SEQ ID NO.39) CP-B3:TGTTTACAGAGAATTGCGATAC (SEQ ID NO.40) CP-FIP:ATTCCCATAAGGCTCCACGAGGGAGTTGTTGAACTTTACACA (SEQ ID NO.41) CP-BIP:CGGTTGTGCAACTTTGGGAGGTTACAGATCACATTAAGTTCTTCA (SEQ ID NO.42) CP-LF:CGCTCCAAGAGAAAGAGGTGTC (SEQ ID NO.43) CP-LB:CTGAATTCCAATATGCACAGTCCA (SEQ ID NO.44) (2) Setting of the test board: This kit uses a 96-deep-well plate, which consists of 8 horizontal rows and 12 vertical columns of wells. Figure 1 As shown, the deep well plate is provided with a lysis area, a washing area and a reaction area (including: LAMP freeze-dried reaction microspheres, solid paraffin and an elution solution containing a pH-sensitive dye), which play different roles respectively and perform the sample extraction and amplification process in the fully automatic nucleic acid extractor.

[0051] A. Columns 1 and 7 are lysis areas. In the lysis areas, each well is filled with 400 μL of lysis solution using a peristaltic pump.

[0052] The formula of the lysis solution is: 0.1% (w / v) Tween 20, 0.1% (w / v) Tween 80, 0.2% (w / v) ethylphenyl polyethylene glycol and 0.08% (w / v) Triton X-100.

[0053] B. Columns 2 and 8 are washing areas; in the washing area, each well is filled with 600 μL of washing solution containing magnetic beads using a peristaltic pump; The washing solution includes the following components in mass volume percentage: 7% magnetic beads, 2M sodium chloride, 60% anhydrous ethanol, 1.5% isopropanol, and the rest is nuclease-free deionized water. The pH value is 7.0±0.2.

[0054] C, columns 3 and 9 are the reaction areas of the samples; In the reaction area, the lower layer is filled with 100 μL of elution solution, which is deionized water without nuclease containing pH indicator. The dye used in the elution solution is phenol red.

[0055] The volume of the LAMP freeze-dried reaction microspheres is 100 μL and is composed of the following components: 1×LAMP reaction buffer, 1.4 mM dNTP, 6 Mm MgSO4, 0.2×Evagreen, 1.6 μΜ FIP / BIP Primers, 0.2 μΜ F3 / B3 Primers, 0.8 μΜ LF / LB Primers, 0.32 U / μL Bst DNA polymerase, and 1×lyophilized protective agent.

[0056] D. Columns 4 and 10 are negative control reaction areas; E. Columns 5 and 11 are positive control reaction areas, and their settings are consistent with the reaction areas.

[0057] Finally, the detection board is packaged.

[0058] (3) This kit may also include other costs, such as acidic solution or alkaline solution for adjusting the pH value of the solution, magnetic rod cover, centrifuge tube, pipette tip, etc.

[0059] All the prepared reagents and the test plate are packaged together into a test kit. The internal components of the test plate are shown in Figure 2 .

[0060] (4) The method of using the above kit is: ① Take out the pre-packaged 96-deep-well plate from the kit, invert and mix several times, shake the plate gently or use a plate centrifuge at 500 rpm for 1 minute to concentrate the reagents and magnetic beads at the bottom of the plate, and carefully tear off the film of the 96-deep-well plate to prevent liquid splashing.

[0061] ② Take 200 μL of sample and add it to the lysis solution wells in the 1st and 7th columns of the 96-deep-well plate, then place the deep-well plate into the instrument, insert the magnetic rod stirring sleeve into the magnetic rod holder, and open the instrument operating software.

[0062] ③ Set up the reaction program. First, perform the sample lysis process. The magnetic bars in the 2nd and 8th columns of the 96-well plate absorb the magnetic beads into the lysis solution in the 1st and 7th columns, and the nucleic acids are free in the lysis system.

[0063] ④ The nucleic acid in the lysate is adsorbed on the magnetic beads and enters the magnetic beads + washing solution in the 2nd and 8th columns of the 96-deep-well plate. Proteins and other components are washed away, and the module heating function is started at the same time. When the temperature rises to the melting point of the solid paraffin, it begins to melt.

[0064] ⑤ The magnetic rod sleeve enters the elution liquid layer of the 3rd and 10th columns, the nucleic acid is eluted, and the LAMP freeze-dried reaction microspheres are re-dissolved to perform LAMP isothermal amplification reaction. As the pH changes, a color reaction occurs to determine the type of target.

[0065] Example 3 Test kit sensitivity for eight pathogens 1. Experimental methods 100 μL of each of the plasmids of influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae at concentrations of 1E6 copies / mL, 1E5 copies / mL, 1E4 copies / mL, 1E3 copies / mL, 500 copies / mL, and 200 copies / mL were added to the freeze-dried reaction microspheres of the kit of Example 2 for LAMP amplification reaction. For the specific detection method, refer to Example 2.

[0066] The existing conventional qPCR detection method requires the design and synthesis of primers and probes, and relies on a fluorescent quantitative PCR instrument for reverse transcription and fluorescent amplification. The existing qPCR freeze-dried reagent used is the reverse transcription reagent with the Yisheng product number of 13650. The specific method is shown in the instructions of the reagent.

[0067] 2. Experimental results and analysis Test results such as Figure 4 As shown, the detection sensitivity of the eight pathogens is 200 copies / mL, which is consistent with the detection sensitivity of the existing qPCR freeze-dried reagents. The conventional qPCR detection process takes about 2 hours, while the invention does not require sample transfer and manual sample addition. The extraction time is 10 minutes and the amplification time is 30 minutes. The reaction time is only 1 / 3 of the qPCR detection method.

[0068] Example 4 Application of the kit to detect eight common respiratory pathogens national reference substances In this example, the kit prepared in Example 2 was applied to the detection of eight common respiratory pathogens.

[0069] 1. Experimental methods (1) After opening the test plate of the kit, add 200 μL of the national reference materials of eight respiratory pathogens, including influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae, to the lysis solution in the first column of the 96-well plate, and perform lysis at room temperature. The composition of the lysis solution is: 0.1% (w / v) Tween 20, 0.1% (w / v) Tween 80, 0.2% (w / v) ethylphenyl polyethylene glycol, and 0.08% (w / v) Triton X-100, and the lysis time is 2 minutes.

[0070] (2) The magnetic beads in the washing solution of the second column are adsorbed by a magnetic rod and transferred to the lysis solution of the first column. After the nucleic acid in the lysis solution is adsorbed to the magnetic beads, the magnetic beads are transferred to the washing solution of the second column for processing to wash away components such as proteins. At the same time, the module heating function is started to melt the solid paraffin.

[0071] (3) The magnetic beads in the washing solution are transferred to the elution solution in the holding tank of the reaction area by a magnetic rod to elute the nucleic acid. At the same time, the LAMP freeze-dried reaction microspheres are re-dissolved. The order of adding positive controls is influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae. The LAMP system performs a constant temperature amplification color reaction at 65°C for 30 minutes.

[0072] 2. Experimental results and analysis The experimental results of LAMP constant temperature amplification color reaction are as follows Figure 3 As shown, in the deep wells of the reaction area where influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae national reference substances were added in sequence, the color of the mixed solution (a mixture of the eluent and the reaction solution) changed from red to yellow, which was consistent with the color of the positive control wells in the 4th column, while the color of the negative control wells in the 5th column remained red.

[0073] The above results indicate that the kit provided by the present invention is not only easy to use and space-saving, but also has a detection plate that integrates multiple functions such as nucleic acid extraction, washing, elution and amplification, and identification. The detection time is short, and rapid and accurate identification of a variety of different pathogens can be achieved.

[0074] Example 5 Pathogen diagnosis of 20 patients with respiratory tract infection 1. Experimental methods In this example, samples collected from 20 patients with respiratory tract infection were subjected to LAMP constant temperature colorimetric detection according to the operating method of the kit in Example 2. The order of adding positive controls was influenza A virus, influenza B virus, respiratory syncytial virus, human parainfluenza virus, adenovirus, human metapneumovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae. Each 96-deep-well plate can detect 8 pathogens of 2 samples.

[0075] 2. Experimental results and analysis The color development results of several samples that tested positive are as follows: Figure 5 As shown, among the 20 patients with respiratory tract infection, 15 patients were confirmed to be positive and 5 patients were confirmed to be negative; among them, 3 patients were infected with influenza A virus, 2 patients were infected with influenza B virus, 2 patients were infected with respiratory syncytial virus, 2 patients were infected with human parainfluenza virus, 1 patient was infected with adenovirus, 1 patient was infected with human metapneumovirus, 2 patients were infected with Mycoplasma pneumoniae, and 2 patients were infected with Chlamydia pneumoniae.

[0076] The test results of the kit were consistent with the PCR amplification results, with a positive coincidence rate of 100% and a specificity of 100%. The test results of 20 patients with respiratory tract infection are shown in Table 2 below: Table 2 The interpretation results of the present invention and PCR for 20 patients

[0077] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solution and concept of the present invention, and all these changes or substitutions should fall within the protection scope of the claims attached to the present invention.

Claims

1. A LAMP detection board, characterized in that: There are multiple receiving grooves distributed on the detection plate; the detection plate includes at least a reaction area for encapsulating reaction components, and the inner cavity of the receiving groove body of the reaction area is divided into two receiving cavities distributed upper and lower by a solid paraffin layer, and the two receiving cavities are respectively filled with LAMP freeze-dried reaction microspheres and eluent.

2. The LAMP detection board according to claim 1, characterized in that: The eluent is nuclease-free deionized water containing a pH indicator; the pH value is 8.5±0.

2.

3. The LAMP detection board according to claim 1, characterized in that: The LAMP freeze-dried reaction microspheres are located in the upper holding chamber, and the eluent is located in the lower holding chamber.

4. The LAMP detection board according to claim 1, characterized in that: The LAMP freeze-dried reaction microspheres include the following components: a freeze-dried LAMP reaction system for detecting target pathogens; preferably, the LAMP reaction system includes: a LAMP reaction buffer, dNTP, MgSO4, a nucleic acid dye, a LAMP primer set, a DNA polymerase and a freeze-drying protective agent.

5. The LAMP detection board according to claim 1, characterized in that: The detection plate further comprises: a lysis area and a washing area, wherein each receiving tank in the lysis area is encapsulated with a lysis solution; and each receiving tank in the washing area is encapsulated with a washing solution containing magnetic beads.

6. The LAMP detection board according to claim 1, characterized in that: The lysate comprises the following components in mass volume percentage: one or more of 0.05%-0.2% Tween 20, 0.05%-0.2% Tween 80, 0.05%-0.2% ethylphenyl polyethylene glycol and 0.05-1% Triton X-100.

7. The LAMP detection board according to claim 1, characterized in that: The washing solution includes the following components in mass volume percentage: 5-10% magnetic beads, 5-15% sodium chloride, 60%-70% anhydrous ethanol, 1%-2% isopropanol, and the rest is nuclease-free deionized water.

8. A multi-respiratory pathogen LAMP detection colorimetric kit, characterized in that: The invention comprises a LAMP detection plate as described in any one of claims 1 to 7, wherein the receiving tank of the reaction zone is divided into a plurality of different partitions, and the LAMP freeze-dried reaction microspheres in the receiving tank of each partition are used to detect one or more respiratory pathogens.

9. The multi-respiratory pathogen LAMP detection colorimetric kit according to claim 8, characterized in that: The LAMP primer set in each partitioned LAMP freeze-dried reaction microsphere includes at least one of the following primer sets: (1) A primer set for detecting influenza A virus comprising: IVA-F3 having a sequence as shown in SEQ ID NO.1, IVA-B3 having a sequence as shown in SEQ ID NO.2, IVA-FIP having a sequence as shown in SEQ ID NO.3, IVA-BIP having a sequence as shown in SEQ ID NO.4, IVA-LF having a sequence as shown in SEQ ID NO.5, and IVA-LB having a sequence as shown in SEQ ID NO.6; (2) A primer set for detecting influenza B virus comprising: IVB-F3 having a sequence as shown in SEQ ID NO.7, IVB-B3 having a sequence as shown in SEQ ID NO.8, IVB-FIP having a sequence as shown in SEQ ID NO.9, IVB-BIP having a sequence as shown in SEQ ID NO.10, and IVB-LB having a sequence as shown in SEQ ID NO.11; (3) A primer set for detecting respiratory syncytial virus comprising: RSV-F3 having a sequence as shown in SEQ ID NO.12, RSV-B3 having a sequence as shown in SEQ ID NO.13, RSV-FIP having a sequence as shown in SEQ ID NO.14, and RSV-BIP having a sequence as shown in SEQ ID NO.15; (4) A primer set for detecting human parainfluenza virus comprising: HPIV-F3 having a sequence as shown in SEQ ID NO.16, HPIV-B3 having a sequence as shown in SEQ ID NO.17, HPIV-FIP having a sequence as shown in SEQ ID NO.18, HPIV-BIP having a sequence as shown in SEQ ID NO.19, and HPIV-LB having a sequence as shown in SEQ ID NO.20; (5) The primer set for detecting adenovirus includes: ADV-F3 as shown in SEQ ID NO.21, ADV-B3 as shown in SEQ ID NO.22, ADV-FIP as shown in SEQ ID NO.23, ADV-BIP as shown in SEQ ID NO.24, ADV-LF as shown in SEQ ID NO.25, and ADV-LB as shown in SEQ ID NO.26; (6) A primer set for detecting human metapneumovirus comprising: HMPV-F3 having a sequence as shown in SEQ ID NO.27, HMPV-B3 having a sequence as shown in SEQ ID NO.28, HMPV-FIP having a sequence as shown in SEQ ID NO.29, HMPV-BIP having a sequence as shown in SEQ ID NO.30, HMPV-LF having a sequence as shown in SEQ ID NO.31, and HMPV-LB having a sequence as shown in SEQ ID NO.32; (7) A primer set for detecting Mycoplasma pneumoniae includes: MP-F3 having a sequence as shown in SEQ ID NO.33, MP-B3 having a sequence as shown in SEQ ID NO.34, MP-FIP having a sequence as shown in SEQ ID NO.35, MP-BIP having a sequence as shown in SEQ ID NO.36, MP-LF having a sequence as shown in SEQ ID NO.37, and MP-LB having a sequence as shown in SEQ ID NO.38; (8) The primer set for detecting Chlamydia pneumoniae includes: CP-F3 as shown in SEQ ID NO.39, CP-B3 as shown in SEQ ID NO.40, CP-FIP as shown in SEQ ID NO.41, CP-BIP as shown in SEQ ID NO.42, CP-LF as shown in SEQ ID NO.43, and CP-LB as shown in SEQ ID NO.

44.

10. A pathogen LAMP detection method based on magnetic bead method for fully automatic nucleic acid extraction and amplification, characterized in that: Using the kit as claimed in claim 8, the method comprises the following steps: S1. Take out the pre-packaged test plate from the test kit, mix it by inverting it several times, shake the test plate gently or use a flat plate centrifuge to centrifuge it briefly to concentrate the liquid and magnetic beads in the holding tank at the bottom of the test plate, and tear off the film on the top of the test plate; S2, lysis: adding an appropriate amount of sample into the lysis solution in the holding tank of the lysis area for lysis at room temperature; S3, washing: the magnetic beads in the washing area are adsorbed by a magnetic rod and transferred to the lysis area, the nucleic acid in the lysis solution is adsorbed to the magnetic beads, and then the magnetic beads are transferred to the washing solution in the washing area for treatment; S4, elution and amplification: heat until the solid paraffin melts, transfer the magnetic beads in the washing solution to the elution solution in the holding tank of the reaction area, elute the nucleic acid, and at the same time, re-dissolve the LAMP freeze-dried reaction microspheres to form a reaction mixture in the tank, and perform LAMP isothermal amplification reaction. After the reaction is completed, determine whether the test result is positive or negative based on the color development result of the reaction mixture.

Images