Transaminase mutant with high conversion rate, coding gene and application of transaminase mutant

Abstract

The invention discloses a high-conversion-rate transaminase mutant, a coding gene and application of the high-conversion-rate transaminase mutant, and belongs to the technical field of bioengineering. The transaminase mutant is obtained by amino acid mutation of a transaminase mutant M1 as shown in an amino acid sequence SEQ ID NO.3, and the mutation site is at least one of the 33rd site, the 88th site, the 90th site, the 157th site, the 177th site, the 391th site, the 392nd site and the 442nd site. Compared with the transaminase mutant M1, the transaminase mutant provided by the invention has higher enzyme activity, and can be used for preparing the transaminase mutant. According to the method, the (S)-1-(3-methoxyphenyl) ethylamine can be prepared by taking the 3-methoxyacetophenone as the substrate, the yield of the product is high, when the concentration of the substrate is increased, the conversion rate is still high, no by-product is generated, and the method has a very good industrial application prospect.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a transaminase mutant modified for Bacillus megaterium-derived transaminase BM-ATA, a coding gene and application thereof in the preparation of (S)-1-(3-methoxyphenyl)ethylamine. Background Art

[0002] Rivastigmine is an orally active, potent cholinesterase (ChE) inhibitor that inhibits butyrylcholinesterase (BChE) and acetylcholinesterase (AChE). Rivastigmine is a parasympathomimetic or cholinergic agent that can cross the blood-brain barrier (BBB) ​​and increase the function of cholinergic neurons in the brain by inhibiting acetylcholinesterase. It can be used to treat mild to moderate Alzheimer's dementia and dementia caused by Parkinson's disease.

[0003] (S)-1-(3-methoxyphenyl)ethylamine is one of the key chiral intermediates for the synthesis of rivastigmine. At present, there are two main methods for the preparation of rivastigmine chiral intermediates: chemical method and biocatalytic method. The chemical method mainly uses chiral catalysts for asymmetric induction synthesis, such as using chiral catalysts such as (salen)Mn(III) and tetraisopropyl titanate to asymmetrically induction synthesis of rivastigmine chiral intermediates; or using a specific splitting system to chirally split racemic amine or alcohol intermediates to obtain key chiral amine or chiral alcohol intermediates, and then obtain S-configuration rivastigmine products through subsequent transformation. Although the reagents used in the chemical splitting method are relatively cheap, only half of the racemate can be used, and the other configuration is wasted, which is costly and has a large amount of waste.

[0004] The biocatalytic method can be used to obtain the corresponding high stereoselective product in one step, which reduces the use of chiral inducing agents in the asymmetric induction synthesis method, simplifies the operation process, reduces production costs, and improves atom economy. For example, patent document CN116926027A introduces a mutant of alcohol dehydrogenase and its application in the synthesis of rivastigmine intermediates. In addition to alcohol dehydrogenase, transaminase can transfer amino groups from donors to acceptors by means of cofactor pyridoxal phosphate, has high stereoselectivity, and a wide substrate spectrum.

[0005] Patent document CN 116334022 A discloses a transaminase mutant for the synthesis of (S)-1-(3-methoxyphenyl)ethylamine, which is obtained by amino acid mutation of transaminase from Bacillus megaterium. The concentration of chiral amine catalyzed by the mutant is 1-8 g / L, the maximum space-time yield can reach 22.3 g / L / day, and the optical purity reaches 98%. However, when the substrate concentration is further increased, the problem of reduced conversion rate occurs. This is mainly because with the increase of the concentration of substrate and amine donor, unstable catalytic intermediates continue to accumulate, making the transaminase in the system more likely to lose activity or denature, resulting in the substrate's inhibitory effect on the enzyme activity.

[0006] Both resting stability and operational stability are closely related to the economical use of enzymes in industrial applications. In order to make transaminases more suitable for industrial applications, it is crucial to improve their stability. Therefore, the development of transaminases with high catalytic activity and strong stereoselectivity for the synthesis of (S)-1-(3-methoxyphenyl)ethylamine is a problem that those skilled in the art need to solve. Summary of the invention

[0007] The object of the present invention is to provide a transaminase with high catalytic activity and strong stereoselectivity for preparing high optical purity (S)-1-(3-methoxyphenyl)ethylamine, which meets the requirements of industrial production.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] The present invention is directed to further site-directed mutagenesis of the mutant M1 obtained by the research group in the early stage of site-directed mutagenesis of the transaminase encoding gene from Bacillus megaterium, and obtains a transaminase mutant with a high conversion rate. Specifically, the transaminase mutant is a mutant obtained by amino acid mutation of the transaminase mutant M1 whose amino acid sequence is shown in SEQ ID NO.3, wherein the site of the amino acid mutation is at least one of the 33rd, 88th, 90th, 157th, 177th, 391st, 392nd and 442nd positions, and the proline at the 33rd position is mutated to cysteine, the threonine at the 88th position is mutated to lysine, the alanine at the 90th position is mutated to cysteine, the threonine at the 157th position is mutated to alanine, the serine at the 177th position is mutated to asparagine, the aspartic acid at the 391st position is mutated to glutamic acid, the isoleucine at the 392nd position is mutated to leucine, and the arginine at the 442nd position is mutated to isoleucine.

[0010] Studies have shown that compared with mutant M1, the enzyme activity of the transaminase mutant provided by the present invention in catalyzing 3-methoxyacetophenone to produce (S)-1-(3-methoxyphenyl)ethylamine is significantly improved.

[0011] Preferably, the amino acid mutation site is a combination of position 442 and at least one of the remaining sites. Further preferably, the amino acid mutation site is a combination of position 442, position 391 and at least one of the remaining sites.

[0012] More preferably, the amino acid mutation site is a combination of all the above sites, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.4.

[0013] The amino acid mutation sites are a combination of positions 88 and 157, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.5.

[0014] The amino acid mutation sites are a combination of positions 33, 90 and 442, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.6.

[0015] The amino acid mutation sites are a combination of positions 33, 90, 391 and 442, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.7.

[0016] The amino acid mutation sites are a combination of positions 391, 392 and 442, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.8.

[0017] The amino acid mutation sites are a combination of positions 88, 391 and 442, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.9.

[0018] The amino acid mutation sites are a combination of positions 157 and 442, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.10.

[0019] The amino acid mutation sites are a combination of positions 88, 391, 157 and 442, and the amino acid sequence of the obtained mutant is shown in SEQ ID NO.11.

[0020] The present invention also provides a coding gene for encoding the transaminase mutant, wherein the nucleotide sequence of the coding gene is obtained by replacing the codons encoding the corresponding amino acids based on the nucleotide sequence shown in SEQ ID NO. 2. The coding gene can be obtained by artificial synthesis; or the corresponding coding gene can be obtained by site-directed mutagenesis technology.

[0021] The present invention also provides a recombinant expression vector comprising a gene encoding the amino acid sequence of the transaminase mutant. Preferably, the recombinant expression vector uses pET30a as a vector plasmid.

[0022] The present invention also provides a genetically engineered bacterium comprising the recombinant expression vector, wherein the genetically engineered bacterium is used to produce the transaminase mutant. The recombinant vector transforms a host cell to obtain a recombinant genetically engineered bacterium, wherein the host cell may be any conventional host cell in the art, and preferably, the host bacterium of the genetically engineered bacterium is Escherichia coli BL21.

[0023] The present invention also provides a method for constructing the transaminase mutant, the method comprising the following steps:

[0024] (1) Designing site-directed mutagenesis primers, using a plasmid carrying the gene encoding the transaminase mutant M1 as a template, and performing inverse PCR to obtain a transaminase single-site mutation product;

[0025] (2) Using the single-site mutation product as a template, reverse PCR was performed using site-directed mutation primers to obtain multi-site mutation products;

[0026] (3) transforming the single-site mutation product and the multi-site mutation product into a host bacterium, screening and obtaining a transaminase mutant expression strain, inducing expression, and obtaining the transaminase mutant.

[0027] Preferably, the original vector of the recombinant plasmid is pET30a; the host bacteria is Escherichia coli BL21.

[0028] Another object of the present invention is to provide the use of the transaminase mutant in the preparation of (S)-1-(3-methoxyphenyl)ethylamine, wherein the use comprises asymmetric catalysis of the amination of 3-methoxyacetophenone to generate (S)-1-(3-methoxyphenyl)ethylamine under the condition of adding an amine donor.

[0029] The aminotransferase mutant provided by the invention asymmetrically catalyzes the amination of 3-methoxyacetophenone under the condition of adding an amine donor to generate (S)-1-(3-methoxyphenyl) with high optical purity and ee>99%, and has good industrial application prospects.

[0030] The application includes: using wet bacteria obtained by centrifugation after fermentation and culture of engineered bacteria containing a transaminase mutant encoding gene, wet bacteria immobilized cells, enzymes extracted after ultrasonic disruption of wet bacteria, or immobilized enzymes as catalysts, using 3-methoxyacetophenone as a substrate under the conditions of adding (S)-α-methylbenzylamine and pyridoxal phosphate, using a buffer solution with a pH value of ≤8 containing an organic solvent as a reaction medium, reacting at 25-37°C and 150-300rpm, and after the reaction is completed, separating and purifying the reaction solution to obtain (S)-1-(3-methoxyphenyl)ethylamine.

[0031] The aminotransferase mutant of the present invention can be used in the form of whole cells of engineered bacteria, in the form of crude enzymes without purification, or in the form of partially purified or completely purified enzymes. The aminotransferase mutant of the present invention can also be made into a biocatalyst in the form of immobilized enzymes or immobilized cells using immobilization techniques known in the art.

[0032] The fermentation culture method is as follows: the recombinant engineered bacteria are inoculated into LB liquid medium containing kanamycin (final concentration of 50 μg / mL), and cultured at 37°C with shaking for 18 h; the seed liquid is inoculated into fresh LB liquid medium containing kanamycin (final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C and 220 rpm with shaking until the bacterial OD 600 The concentration of isopropyl-β-D-thiogalactopyranoside (IPTG) was 0.1 mM, and the culture was induced at 25°C and 220 rpm for 16 h. The bacterial cells were collected by centrifugation at 4°C and 3500 rpm for 10 min.

[0033] The present invention has the following beneficial effects:

[0034] (1) Compared with the transaminase mutant M1, the transaminase mutant provided by the present invention has higher enzyme activity, can use 3-methoxyacetophenone as a substrate to prepare (S)-1-(3-methoxyphenyl)ethylamine, has a high yield of the product, and still has a high conversion rate when the substrate concentration is increased, and no by-products are produced.

[0035] (2) The present invention utilizes a transaminase mutant as a chiral intermediate biocatalyst of rivastigmine, making it more economical and convenient to obtain a chiral product of high optical purity. The production method has the advantages of simple operation and low cost, which greatly reduces the production cost and has a good prospect for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the plasmid map of the recombinant mutant.

[0037] Figure 2 It is the HPLC retention time of the standard substances of (S / R)-1-(3-methoxyphenyl)ethylamine, substrate 3-methoxyacetophenone, (S)-phenylethylamine and acetophenone in the whole-cell catalytic reaction of 3-methoxyacetophenone. DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and are not intended to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements made to the inventive method, steps or conditions all belong to the scope of the present invention.

[0039] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0040] Nucleic acids are written left to right in 5' to 3' orientation and amino acid sequences are written left to right in amino to carboxyl orientation.

[0041] Example 1: Construction of engineered bacteria capable of expressing mutants

[0042] 1. According to the amino acid sequence of 5G0A (BM-ATA from Bacillus megaterium aminotransferase, www.rcsb.org / structure / 5G0A) protein in the PDB protein library, the corresponding coding gene was synthesized by Shanghai Jierui Bioengineering Co., Ltd., wherein the his tag at the end of the 5G0A amino acid sequence was removed, that is, the end sequence was changed from EWQALEHHHHHH to EWQ*. That is, the amino acid sequence of the wild type of Bacillus megaterium aminotransferase is shown in SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown in SEQ ID NO.2.

[0043] Using plasmid pET30a as a vector, a recombinant plasmid pET30a containing the coding gene was obtained through conventional preparation operations, and the recombinant plasmid was transferred into Escherichia coli E. coli BL21 to obtain an engineered recombinant strain of wild-type transaminase, and the recombinant strain was activated on an LB plate containing 1‰ kanamycin (Kan) resistance, cultured at 37°C for 18h, and a single colony was picked in a 50mL LB conical flask containing 1‰ kanamycin resistance, and cultured at 37°C and 220rpm until OD 600 The concentration was about 0.6, and the plasmid was extracted according to the instructions of the plasmid extraction kit.

[0044] 2. Construction of transaminase mutant M1

[0045] The plasmid extracted in step 1 was used as a template, and multiple rounds of mutations were performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, United States) to complete the construction of the mutant plasmid. Alanine (A) at position 242, threonine (T) at position 295, leucine (L) at position 387, and valine (V) at position 436 in the wild-type amino acid sequence were mutated at multiple sites, and the corresponding primers were designed as shown in Table 1.

[0046] Table 1. Mutation primers

[0047] Primers Sequence (5'-3') A242V-F: GAAGTTAGCCAGGGTGTGGGTAGCGCAATG A242V-R: CATTGCGCTACCCACACCCTGGCTAACTTC T295C-F: CAGCCGGATATTATTTGCATGGGTAAAGGTCTGAG T295C-R: CTCAGACCTTTACCCATGCAAATAATATCCGGCTG L387A-F: GATGGTTATGGCCTGGCGTGGATTGTTGATATTGTG L387A-R: CACAATATCAACAATCCACGCCAGGCCATAACCATC V436A-F: GATTGGTGGTGCTATGCCGAATACCATGCG V436A-R: CGCATGGTATTCGGCATCGCACCACCAATC

[0048] The mutant plasmid constructed above was transferred into E. coli BL21 competent cells, mixed and placed on ice for 25 minutes. After that, the E. coli BL21 competent cells were placed in a heat shock at 42°C for 90 seconds and then placed on ice for 5 minutes. Then 1 mL of LB medium was added and cultured at 37°C for 50 minutes. After that, the cells were centrifuged at 12000 rpm for 1 minute, 100 μL of the supernatant was taken to resuspend the cells, spread on an LB plate containing 1‰ kanamycin, and cultured in a constant temperature incubator at 37°C for 18 hours.

[0049] Pick a single colony on the plate and place it in a test tube containing 5 mL of LB medium. After culturing for 8 hours, take 1 mL of it for sequencing. If the sequencing result is correct, add an equal volume of 40% glycerol solution to the remaining bacterial liquid and store it in a -80°C refrigerator for later use.

[0050] The transaminase mutant engineered bacteria E. coli BL21 / pET30a-BmATA-M1 was obtained. The sequencing results showed that the codon GCA encoding alanine (A) at position 242 mutated to the codon GTG encoding valine (V); the codon ACC encoding threonine (T) at position 295 mutated to the codon TGC encoding cysteine ​​(C); the codon CTG encoding leucine (L) at position 387 mutated to the codon GCG encoding alanine (A); the codon GTT encoding valine (V) at position 436 mutated to the codon GCT encoding alanine (A). The amino acid sequence of mutant M1 is SEQ ID NO.3.

[0051] 3. Construction of transaminase mutant M2

[0052] Using the pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to complete the construction of the mutant plasmid. Specifically, the proline (P) at position 33 was mutated to cysteine ​​(C), the threonine (T) at position 88 was mutated to lysine (K), the alanine (A) at position 90 was mutated to cysteine ​​(C), the threonine (T) at position 157 was mutated to alanine (A), the serine (S) at position 177 was mutated to asparagine (N), the aspartic acid (D) at position 391 was mutated to glutamic acid (E), the isoleucine (I) at position 392 was mutated to leucine (L), and the arginine (R) at position 442 was mutated to isoleucine (I). The corresponding primers were designed as shown in Table 2. The construction method is the same as above.

[0053] Table 2. Mutation primers

[0054]

[0055] Obtain the transaminase mutant engineering bacteria E. coli BL21 / pET30a-BmATA-M2. The sequencing results showed that the codon CCG encoding proline (P) at position 33 mutated into the codon TGC encoding cysteine ​​(C), the codon ACC encoding threonine (T) at position 88 mutated into the codon AAA encoding lysine (K), the codon GCC encoding alanine (A) at position 90 mutated into the codon TGC encoding cysteine ​​(C), the codon ACC encoding threonine (T) at position 157 mutated into the codon GCC encoding alanine (A), the codon AGC encoding serine (S) at position 177 mutated into the codon AAC encoding asparagine (N), the codon GAT encoding aspartic acid (D) at position 391 mutated into the codon GAA encoding glutamic acid (E), the codon ATT encoding isoleucine (I) at position 392 mutated into the codon CTG encoding leucine (L), and the codon CGT encoding arginine (R) at position 442 mutated into the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M2 is SEQ ID NO.4.

[0056] 4. Construction of transaminase mutant M3

[0057] Using the pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to complete the construction of the mutant plasmid, and the threonine (T) at position 88 was mutated to lysine (K), and the threonine (T) at position 157 was mutated to alanine (A). The construction method was the same as above.

[0058] The engineered transaminase mutant E. coli BL21 / pET30a-BmATA-M3 was obtained. The sequencing results showed that the codon ACC encoding the 88th threonine (T) was mutated to the codon AAA encoding lysine (K), and the codon ACC encoding the 157th threonine (T) was mutated to the codon GCC encoding alanine (A). The amino acid sequence of the mutant M3 is SEQ ID NO.5.

[0059] 5. Construction of transaminase mutant M4

[0060] Using the pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to complete the construction of the mutant plasmid, and the proline (P) at position 33 was mutated to cysteine ​​(C), the alanine (A) at position 90 was mutated to cysteine ​​(C), and the arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0061] The transaminase mutant engineered bacteria E. coli BL21 / pET30a-BmATA-M4 was obtained. The sequencing results showed that the codon CCG encoding proline (P) at position 33 mutated to the codon TGC encoding cysteine ​​(C), the codon GCC encoding alanine (A) at position 90 mutated to the codon TGC encoding cysteine ​​(C), and the codon CGT encoding arginine (R) at position 442 mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of mutant M4 is SEQ ID NO.6.

[0062] 6. Construction of transaminase mutant M5

[0063] Using the pET30a-BmATA-M4 constructed in step 5 as a template, a point mutation kit was used to complete the construction of the mutant plasmid, and the aspartic acid (D) at position 391 was mutated to glutamic acid (E). The construction method was the same as above.

[0064] The engineered transaminase mutant E. coli BL21 / pET30a-BmATA-M5 was obtained. The sequencing results showed that the codon GAT encoding the 391st aspartic acid (D) was mutated to the codon GAA encoding glutamic acid (E). The amino acid sequence of the mutant M5 is SEQ ID NO.7.

[0065] 7. Construction of transaminase mutant M6

[0066] Using the pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to complete the construction of the mutant plasmid. The aspartic acid (D) at position 391 was mutated to glutamic acid (E), the isoleucine (I) at position 392 was mutated to leucine (L), and the arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0067] The transaminase mutant engineered bacteria E. coli BL21 / pET30a-BmATA-M6 was obtained. The sequencing results showed that the codon GAT encoding the 391st aspartic acid (D) mutated to the codon GAA encoding glutamic acid (E), the codon ATT encoding the 392nd isoleucine (I) mutated to the codon CTG encoding leucine (L), and the codon CGT encoding the 442nd arginine (R) mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of the mutant M6 is SEQ ID NO.8.

[0068] 8. Construction of transaminase mutant M7

[0069] Using the pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to complete the construction of the mutant plasmid. The threonine (T) at position 88 was mutated to lysine (K), the aspartic acid (D) at position 391 was mutated to glutamic acid (E), and the arginine (R) at position 442 was mutated to isoleucine (I). The construction method was the same as above.

[0070] The transaminase mutant engineered bacteria E. coli BL21 / pET30a-BmATA-M7 was obtained. The sequencing results showed that the codon ACC encoding the 88th threonine (T) mutated to the codon AAA encoding lysine (K), the codon GAT encoding the 391st aspartic acid (D) mutated to the codon GAA encoding glutamic acid (E), and the codon CGT encoding the 442nd arginine (R) mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of the mutant M7 is SEQ ID NO.9.

[0071] 9. Construction of transaminase mutant M8

[0072] Using the pET30a-BmATA-M1 constructed in step 2 as a template, a point mutation kit was used to complete the construction of the mutant plasmid, and the threonine (T) at position 157 was mutated to alanine (A), and the arginine (R) at position 442 was mutated to isoleucine (I). The construction method is the same as above.

[0073] The engineered transaminase mutant E. coli BL21 / pET30a-BmATA-M8 was obtained. The sequencing results showed that the codon ACC encoding the 157th threonine (T) was mutated to the codon GCC encoding alanine (A), and the codon CGT encoding the 442nd arginine (R) was mutated to the codon ATT encoding isoleucine (I). The amino acid sequence of the mutant M8 is SEQ ID NO.10.

[0074] 10. Construction of transaminase mutant M9

[0075] Using the pET30a-BmATA-M7 constructed in step 8 as a template, a point mutation kit was used to complete the construction of the mutant plasmid, and the threonine (T) at position 157 was mutated to alanine (A). The construction method was the same as above.

[0076] The engineered transaminase mutant E. coli BL21 / pET30a-BmATA-M9 was obtained. The sequencing results showed that the codon ACC encoding the 157th threonine (T) was mutated to the codon GCC encoding alanine (A). The amino acid sequence of the mutant M9 is SEQ ID NO.11.

[0077] Example 2: Inducible expression of each mutant

[0078] The engineered bacteria expressing the wild enzyme and the engineered bacteria expressing each mutant constructed in Example 1 were inoculated into 5 mL LB liquid culture medium test tubes containing 50 μg / mL kanamycin, and cultured at 37°C for 18 h. Then, 1% inoculum (v / v) was inoculated into 50 mL LB culture medium containing 50 μg / mL kanamycin, and cultured at 37°C and 220 rpm until the bacterial concentration OD 600 When the pH reaches about 0.6, IPTG with a final concentration of 0.1 mmol / L was added, and the culture was induced at 25°C and 220 rpm for 16 h. The wet cells were collected by centrifugation at 4°C and 3500 rpm for 10 min to obtain wet cells of engineered bacteria expressing wild enzymes and engineered bacteria expressing various mutants.

[0079] Example 3: Preparation of (S)-1-(3-methoxyphenyl)ethylamine by mutant M1 (A242V / T295C / L387A / V436A)

[0080] A NaH2PO4-Na2HPO4 buffer solution with a pH of 7.5 containing 12 g / L (S)-α-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 3 g / L 3-methoxyacetophenone, and 10% isopropanol was prepared as a reaction solution.

[0081] The obtained mutant A242V / T295C / L387A / V436A wet bacteria were resuspended in the reaction solution so that the wet bacteria content was 50g / L, and the solution was configured as a reaction system. Take 1mL of the reaction system solution and place it at 37°C and 220rpm constant temperature shaker for 4 hours. After the reaction, extract with ethyl acetate and centrifuge, vacuum evaporate at 35°C for 1.5 hours, and then redissolve with a liquid mobile phase (aqueous perchloric acid solution with a pH of 1.0). The yield and ee value were determined by high performance liquid chromatography (HPLC), and the product ee was finally measured at a substrate concentration of 3g / L. s The value reached 95% and the yield was 42.02%.

[0082] When the substrate concentration was further increased, the conversion rate decreased, as shown in Table 3, so the mutant needed to be further optimized.

[0083] Table 3

[0084] Substrate concentration (g / L) Conversion rate (%) 3 42.02 4 36.15 5 22.1 6 12.11 7 5.9

[0085] Example 4: Mutant M2 (P33C / T88K / A90C / T157A / S177N / A242V / T295C / L387A / D391E / I392L / V436A / R442I) Preparation of (S)-1-(3-methoxyphenyl)ethylamine at a substrate concentration of 7.5 g / L

[0086] A NaH2PO4-Na2HPO4 buffer solution with a pH of 7.5 containing 30 g / L (S)-α-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 7.5 g / L 3-methoxyacetophenone, and 10% isopropanol was prepared as a reaction solution.

[0087] The obtained mutant M2 (P33C / T88K / A90C / T157A / S177N / A242V / T295C / L387A / D391E / I392L / V436A / R442I) wet bacteria were resuspended in the reaction solution to make the wet bacteria content 50g / L, and the reaction system solution was configured. Take 1mL of the reaction system solution and place it at 37°C and 220rpm constant temperature shaker for 4h. After the reaction, extract with ethyl acetate and centrifuge, vacuum rotary evaporate at 35°C for 1.5h, and then redissolve with liquid mobile phase (pH 1.0 perchloric acid aqueous solution).

[0088] The yield and ee were determined by HPLC analysis. s The liquid chromatogram of the (S / R)-1-(3-methoxyphenyl)ethylamine standard is as follows: Figure 2 As shown, the final measured ee s The value was >99%, and the yield was 91.91%. Example 5: Preparation of (S)-1-(3-methoxyphenyl)ethylamine by transaminase mutants M3-M9 at a substrate concentration of 7.5 g / L

[0089] A NaH2PO4-Na2HPO4 buffer solution with a pH of 7.5 containing 30 g / L (S)-α-methylbenzylamine, 0.25 g / L pyridoxal phosphate, 7.5 g / L 3-methoxyacetophenone, and 10% isopropanol was prepared as a reaction solution.

[0090] The obtained mutant wet bacteria were resuspended in the reaction solution to make the wet bacteria content 50g / L, and the reaction system solution was prepared. Take 1mL of the reaction system solution and place it in a constant temperature shaker at 37°C and 220rpm for 4 hours. After the reaction, extract with ethyl acetate and centrifuge, vacuum evaporation at 35°C for 1.5 hours, and then redissolve with liquid mobile phase (pH 1.0 perchloric acid aqueous solution). The yield and ee were determined by high performance liquid chromatography analysis. s The results are shown in Table 4.

[0091] Table 4

[0092] name Mutation site Yield (%) <![CDATA[ee s Value (%)]]> M3 T88K / T157A 67.1745 >99 M4 P33C / A90C / R442I 62.05805 >99 M5 P33C / A90C / D391E / R442I 55.4336 >99 M6 D391E / I392L / R442I 65.53105 >99 M7 T88K / D391E / R442I 88.17675 >99 M8 T157A / R442I 83.9663 >99 M9 T88K / D391E / T157A / R442I 77.1745 >99

[0093] Experimental results analysis: Compared with the aminotransferase mutant BmATA-M1, the BM-ATA mutant provided by the present invention has better catalytic activity. The concentration of BM-ATA mutant catalyzing the synthesis of chiral amines is 1-8 g / L. For example, when the substrate concentration of mutant M2 is 7.5 g / L, the maximum space-time yield can reach 41.4 g / L / day, and the ee s The value is >99%, and the optical purity is high. The catalyst is easy to prepare, the reaction conditions are mild, the substrate adaptability is wide, and it is environmentally friendly. It can efficiently catalyze the asymmetric amination reaction of potential chiral ketones and has a good prospect for industrial application development.

[0094] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A transaminase mutant, characterized in that: The transaminase mutant is a mutant obtained by amino acid mutation of the transaminase mutant M1 whose amino acid sequence is shown in SEQ ID NO.3, wherein the site of the amino acid mutation is at least one of the 33rd, 88th, 90th, 157th, 177th, 391st, 392nd and 442nd positions, and the proline at position 33 is mutated to cysteine, the threonine at position 88 is mutated to lysine, the alanine at position 90 is mutated to cysteine, the threonine at position 157 is mutated to alanine, the serine at position 177 is mutated to asparagine, the aspartic acid at position 391 is mutated to glutamic acid, the isoleucine at position 392 is mutated to leucine, and the arginine at position 442 is mutated to isoleucine.

2. The aminotransferase mutant according to claim 1, characterized in that The amino acid sequence of the transaminase mutant is shown in any one of SEQ ID NO.4 to SEQ ID NO.

11.

3. A transaminase mutant gene, characterized in that: The gene is used to encode the transaminase mutant according to claim 1 or 2.

4. A recombinant expression vector, characterized in that: The recombinant expression vector comprises a gene encoding the amino acid sequence of the transaminase mutant according to claim 1 or 2.

5. The recombinant expression vector according to claim 4, characterized in that The recombinant expression vector uses pET30a as a vector plasmid.

6. A genetically engineered bacterium for producing the aminotransferase mutant according to claim 1 or 2, characterized in that: The genetically engineered bacteria comprises the recombinant expression vector as described in claim 4 or 5.

7. The genetically engineered bacterium according to claim 6, characterized in that The host bacteria is Escherichia coli BL21.

8. Use of the aminotransferase mutant according to claim 1 or 2 in the preparation of (S)-1-(3-methoxyphenyl)ethylamine, characterized in that: The application includes asymmetric catalytic amination of 3-methoxyacetophenone to generate (S)-1-(3-methoxyphenyl)ethylamine under the condition of adding an amine donor.

9. The use according to claim 8, characterized in that The application includes: using wet bacteria obtained by centrifugation after fermentation and culture of engineered bacteria containing a transaminase mutant encoding gene, wet bacteria immobilized cells, enzymes extracted after ultrasonic disruption of wet bacteria, or immobilized enzymes as catalysts, using 3-methoxyacetophenone as a substrate under the conditions of adding (S)-α-methylbenzylamine and pyridoxal phosphate, using a buffer solution with a pH value of ≤8 containing an organic solvent as a reaction medium, reacting at 25-37°C and 150-300rpm, and after the reaction is completed, separating and purifying the reaction solution to obtain (S)-1-(3-methoxyphenyl)ethylamine.

Images