CDC7 gene targeting gRNA and application thereof

Abstract

The invention provides a gRNA targeting CDC7 gene and application thereof, and particularly provides a gRNA targeting CDC7 gene intron regions, it is found for the first time that the gRNA designed targeting CDC7 gene intron regions (such as intron 3, intron 6 and intron 9) can effectively inhibit CDC7 gene expression, and therefore the gRNA designed by the invention can significantly improve gene editing efficiency; and / or treating neoplastic diseases.

Description

Technical Field

[0001] The present invention relates to the field of gene editing, and in particular to a gRNA targeting a CDC7 gene and an application thereof. Background Art

[0002] Hepatocellular carcinoma accounts for the majority of primary liver cancers.

[0003] Most hepatocellular carcinomas develop in patients with underlying liver disease, primarily due to infection with the hepatitis B or C virus (HBV or HCV) or alcohol abuse or nonalcoholic fatty liver disease. Patients with chronic liver disease have persistent hepatic inflammation, fibrosis, and abnormal hepatocyte regeneration. These abnormalities lead to cirrhosis and promote a series of genetic and epigenetic events that culminate in the formation of dysplastic nodules, which are true preneoplastic lesions.

[0004] Additional molecular alterations provide dysplastic cells with proliferative, invasive, and survival advantages and complete the transition to full hepatocellular carcinoma. Hepatocellular carcinoma cells accumulate somatic DNA alterations, including mutations and chromosomal aberrations. TERT promoter mutations are the most common genetic alterations, accounting for approximately 60% of all cases. Other mutated genes include those affecting the cell cycle (e.g., TP53, approximately 30% of all cases), WNT signaling (CTNNB1 and AXIN1, approximately 30% and 10%, respectively), or chromatin remodeling (ARID1A and ARID2, approximately 10% and 5%, respectively). Mutation associations centered on CTNNB1 (alcoholic), TP53 (HBV), and AXIN1 are closely associated with the hepatocellular carcinoma risk index.

[0005] In clinical practice, early treatment of hepatocellular carcinoma usually adopts radiotherapy, chemotherapy, liver transplantation, ablation, resection, etc., but these measures can only temporarily inhibit the progression of early and middle stage hepatocellular carcinoma. At the same time, due to the continued proliferation of residual tumor cells, the tumor is prone to recurrence or metastasis, and radiotherapy, chemotherapy and surgery will cause a certain degree of damage to the patient's health. The first-line drugs for clinical systemic treatment include sorafenib and lenvatinib, but due to the need for long-term medication, their drug resistance problem cannot be ignored, and they are accompanied by a certain degree of adverse drug reactions and poor prognosis. At the same time, a considerable proportion of patients have no therapeutic response to sorafenib and lenvatinib. The widespread vaccination of HBV vaccines and the widespread use of direct antiviral drugs against HCV have also prevented and improved hepatocellular carcinoma in some patients to a certain extent. Therefore, for patients with hepatocellular carcinoma, especially for advanced cancer patients who have no therapeutic response to first-line drugs (sorafenib and lenvatinib), there is an urgent need for a new treatment method that can cure hepatocellular carcinoma more safely and effectively.

[0006] Currently, most gene-targeted cancer therapies exploit the phenomenon of “oncogene addiction,” where tumors become dependent on oncogenes or oncogenic pathways for survival. However, although small molecule and antibody-based oncogene inhibitors have been shown to be effective against some tumors, not all tumors have targeted oncogenes, and resistance to small molecule inhibitors and antibody drugs is also a problem that cannot be ignored. Therefore, synthetic lethality has attracted widespread attention as a new therapeutic strategy to increase survival benefit. Synthetic lethality refers to the fact that two genes mutate simultaneously, resulting in a cell with lethality, but a single gene mutation does not result in a cell with lethality. This concept was developed from genetic studies of model organisms such as flies and yeast. The most famous example of synthetic lethality is the relationship between BRCA1 / 2 and poly (ADP-ribose) polymerase (PARP) in the DNA repair pathway; inhibition of PARP, encoded by the PARP1 gene, leads to cell death in breast cancer cells with BRCA1 / 2 mutations. It has been reported in the literature that CDC7 is a synthetic lethal partner of TP53 mutant hepatocellular carcinoma. In multiple liver cancer mouse models, pharmacological inhibition of DNA replication kinase CDC7 can selectively induce senescence of TP53 mutant liver cancer cells, and combined with mTOR inhibitors can significantly inhibit the growth of liver tumors. CDC7 protein has a very important function in offsetting replication stress. Cancer cells show high levels of replication stress, and CDC7 protein expression is elevated in cancer cells. Therefore, CDC7 inhibition may be an attractive tumor treatment strategy, especially for TP53 mutant tumors.

[0007] There are also literature reports (CDC7-independent G1 / S transition revealed by targeted protein degradation, Nature, 2022 May; 605(7909): 357-365. doi: 10.1038 / s41586-022-04698-x.) that the function of CDC7 in normal cells is redundant and non-essential, and reducing CDC7 expression does not affect the growth and function of normal cells (Inducing and exploiting vulnerabilities for the treatment of liver cancer. Nature. 2019 Oct; 574(7777): 268-272. doi: 10.1038 / s41586-019-1607-3.).

[0008] There are currently a number of CDC7 small molecule inhibitors under development on the market, but small molecule inhibitors have the problems of long-term administration, easy to produce drug resistance, and poor targeting. It is generally believed that compared with small molecule chemical drugs, antibody drugs, recombinant proteins, and siRNA drugs, gene therapy (including CRISPR gene editing therapy) can achieve lasting and stable therapeutic effects through gene-level operations, reduce adverse reactions caused by long-term administration, and is convenient to treat, and the cost of long-term treatment is relatively lower. In addition, it is relatively easier to achieve a balance between therapeutic effect and safety by editing the regulatory elements of the non-coding region for treatment.

[0009] Genome editing technology is a genetic engineering technology that uses artificial nucleases to modify specific locations in the genome of an organism. In particular, CRISPR / Cas9 technology has attracted widespread attention from researchers due to its easy operation, high efficiency and universality. With the development of CRISPR / Cas9 technology, single-base editing technologies based on it, including cytosine base editing system and adenine base editing system, are used to guide the replacement of target bases in target genes. Adenine base editing technology mainly uses a fusion protein composed of Cas protein combined with adenosine deaminase. Under the guidance of sgRNA, the target base A located in the base editing active window is deaminated to form hypoxanthine I, which is then gradually replaced by G after DNA repair and replication, eventually forming a directional replacement of A to G (A>G). Since its development, base editing technology has been successfully applied to a variety of organisms such as animals and plants due to its advantages such as high efficiency, independence from DNA double-strand breaks, and the absence of donor DNA.

[0010] Currently, base editing therapy generally has the problem of low editing efficiency, making it difficult to achieve good therapeutic effects; there is currently no therapy targeting the CDC7 gene on the market, and there is a possibility of unpredictable toxicity after editing the CDC7 gene. Summary of the invention

[0011] Based on this, in order to address the above problems, it is urgent to provide a gRNA targeting the CDC7 gene that can be used in CRISPR gene editing therapy, which can achieve lasting and stable therapeutic effects through genetic level operations, reduce adverse reactions (such as drug resistance) caused by long-term administration, and has the advantages of convenient treatment and relatively lower cost of long-term treatment.

[0012] The human CDC7 gene is located at 1p22.2-p22.1. In order to obtain a gRNA that can effectively target and edit the CDC7 gene, the inventors investigated and experimentally verified the human CDC7 gene sequence and discovered a gRNA that can specifically target the CDC7 gene.

[0013] The first aspect of the present invention provides a gRNA, which targets the intron region of the CDC7 gene.

[0014] In another preferred embodiment, the intron region includes intron 3, intron 6 and intron 9.

[0015] In another preferred example, the gRNA targets the GU-AG splicing site in the intron region of the CDC7 gene.

[0016] In another preferred example, the gRNA guides the base editor to target the human CDC7 gene and changes the CDC7 gene sequence, so that the expression of the CDC7 gene is downregulated by 1%, 2%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99%.

[0017] In another preferred example, the gRNA can guide the base editor to destroy the splice sites of the CDC7 gene, thereby reducing the expression level of the CDC7 gene.

[0018] In another preferred embodiment, the similarity between the targeting sequence of the gRNA and the sequence shown in any one of SEQ ID NO.1-5 is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%,

[0019] 100%, or 90%, 91%, 92%,

[0020] 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the reverse complement of the sequence.

[0021] In another preferred example, the targeting site of the gRNA is located in the intron region, and the target sequence targeted by the gRNA is based on the sequence shown in any one of SEQ ID NOs: 1-5, by deleting, adding or replacing some bases, such as differing from the sequence shown in any one of SEQ ID NOs: 1-5 by no more than 1, 2, 3, 4 or 5 nucleotides.

[0022] In another preferred embodiment, the targeting sequence of the sgRNA is as shown in any one of SEQ ID NO.1-5, or is the reverse complementary sequence of the sequence shown in any one of SEQ ID NO.1-5.

[0023] In another preferred embodiment, the gRNA can be directly synthesized by chemical means, or prepared by other means, such as in vitro IVT.

[0024] In another preferred embodiment, the gRNA includes crRNA, tracrRNA, and sgRNA.

[0025] In another preferred embodiment, the gRNA includes unmodified and modified gRNA.

[0026] In another preferred embodiment, the modified gRNA includes chemical modification of the bases.

[0027] In another preferred embodiment, the chemical modification includes methylation modification, methoxy modification, fluorination modification or thio modification.

[0028] In another preferred embodiment, the base editor includes an adenine base editor (ABE).

[0029] In another preferred embodiment, the base editor includes ABE8e.

[0030] The second aspect of the present invention provides a nucleic acid, which encodes the gRNA described in the first aspect of the present invention, or encodes the precursor of the gRNA described in the first aspect of the present invention.

[0031] The third aspect of the present invention provides a vector, which comprises the gRNA described in the first aspect of the present invention or the nucleic acid described in the second aspect of the present invention.

[0032] In another preferred embodiment, the vector is a vector for targeted editing of the CDC7 gene.

[0033] In another preferred embodiment, the vector comprises a plasmid or a viral vector.

[0034] In another preferred embodiment, the viral vector is selected from the following group: adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, SV40, poxvirus, or a combination thereof.

[0035] The fourth aspect of the present invention provides a gene editing system, which comprises the gRNA described in the first aspect of the present invention.

[0036] In another preferred example, the gene editing system also includes a base editor.

[0037] In another preferred embodiment, the base editor includes an adenine base editor (ABE).

[0038] In another preferred embodiment, the base editor includes ABE8e.

[0039] In another preferred embodiment, the gene editing includes in vivo gene editing and in vitro gene editing.

[0040] The fifth aspect of the present invention provides a cell, which is obtained by editing with the gene editing system described in the fourth aspect of the present invention.

[0041] In another preferred embodiment, the cells are cells cultured in vitro.

[0042] In another preferred embodiment, the cells include primary cells and passaged cells.

[0043] In another preferred embodiment, the cells include mammalian cells.

[0044] In another preferred embodiment, the cells include human cells.

[0045] In another preferred embodiment, the cells include human hepatocytes.

[0046] The sixth aspect of the present invention provides a composition comprising a gRNA component and a protein component, wherein the gRNA comprises the gRNA described in the first aspect of the present invention, and the protein component comprises a base editor.

[0047] In another preferred embodiment, the gRNA component is selected from: the gRNA described in the first aspect of the present invention, or a nucleic acid encoding the aforementioned gRNA; the base editor is selected from: a base editor, or a nucleic acid encoding a base editor.

[0048] In another preferred embodiment, the base editor includes an adenosine base editor.

[0049] In another preferred embodiment, the base editor includes ABE8e.

[0050] In another preferred embodiment, the composition comprises a pharmaceutical composition.

[0051] In another preferred embodiment, the pharmaceutical composition is in liquid form.

[0052] In another preferred embodiment, the dosage form of the pharmaceutical composition includes injection or injection.

[0053] In another preferred embodiment, the dosage form of the pharmaceutical composition is an intravenous injection form or an intratumoral injection form.

[0054] A seventh aspect of the present invention provides a composition comprising:

[0055] The system according to the fourth aspect of the present invention or the cell according to the fifth aspect of the present invention; and

[0056] A pharmaceutically acceptable carrier.

[0057] In another preferred embodiment, in the composition, the system or the cells account for 1-99wt%, preferably 10-90wt%, and more preferably 30-70wt% of the total weight of the composition.

[0058] The eighth aspect of the present invention provides a delivery composition comprising an active ingredient and a delivery medium, wherein the active ingredient comprises the gRNA described in the first aspect of the present invention, the vector described in the third aspect of the present invention, or the system described in the fourth aspect of the present invention.

[0059] In another preferred embodiment, the delivery medium includes lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microbubbles, gene guns or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses or adeno-associated viruses).

[0060] The ninth aspect of the present invention provides a host cell, which comprises the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the composition described in the sixth aspect of the present invention, or the delivery composition described in the eighth aspect of the present invention.

[0061] In another preferred embodiment, the host cell includes mammalian cells.

[0062] In another preferred embodiment, the host cell includes human cells.

[0063] In another preferred embodiment, the host cell includes human hepatocytes.

[0064] The tenth aspect of the present invention provides a CRISPR complex, which includes the gRNA and base editor described in the first aspect of the present invention, and the gRNA contains a spacer sequence capable of hybridizing with a target nucleic acid.

[0065] The eleventh aspect of the present invention provides a medicine kit, comprising:

[0066] A first container, and an active ingredient or a drug containing the active ingredient, wherein the active ingredient or the drug is located in the first container, and the active ingredient comprises the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the cell described in the fifth aspect of the present invention, the composition described in any one of the sixth aspect or the seventh aspect of the present invention, or the delivery composition described in the eighth aspect of the present invention, or the host cell described in the ninth aspect of the present invention, or the CIRSPR complex described in the tenth aspect of the present invention.

[0067] In another preferred embodiment, the active ingredient or the drug is a single-ingredient preparation.

[0068] In another preferred embodiment, the dosage form of the active ingredient or the drug is an injection or injection.

[0069] In another preferred embodiment, the dosage form of the active ingredient or the drug is an intravenous injection dosage form or an intratumoral injection dosage form.

[0070] In another preferred embodiment, the medicine kit further contains instructions for administering the active ingredient or the drug to the subject, thereby (i) improving gene editing efficiency; and / or (ii) preventing and / or treating tumor diseases.

[0071] In another preferred embodiment, the administration object is a cell.

[0072] In another preferred embodiment, the administration object is human cells.

[0073] In another preferred embodiment, the administration target is human hepatocytes.

[0074] In another preferred embodiment, the administration subject is a human or non-human mammal.

[0075] In another preferred embodiment, the administration is to contact the active ingredient or the drug with human liver cells, or to inject the active ingredient or the drug into the human body.

[0076] The twelfth aspect of the present invention provides a method for gene editing of cells, comprising contacting the cells with the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the composition described in the sixth aspect of the present invention, or the delivery composition described in the eighth aspect of the present invention or the host cell described in the ninth aspect of the present invention or the CIRSPR complex described in the tenth aspect of the present invention or the drug kit described in the eleventh aspect of the present invention.

[0077] In another preferred embodiment, the contacting is performed in vitro.

[0078] In another preferred embodiment, the cells are cells cultured in vitro.

[0079] In another preferred embodiment, the cells include primary cells and passaged cells.

[0080] In another preferred embodiment, the cells include mammalian cells.

[0081] In another preferred embodiment, the cells include human cells.

[0082] In another preferred embodiment, the cells include human hepatocytes.

[0083] The thirteenth aspect of the present invention provides a kit for gene editing, which comprises the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the composition described in the sixth aspect of the present invention, or the delivery composition described in the eighth aspect of the present invention or the host cell described in the ninth aspect of the present invention or the CIRSPR complex described in the tenth aspect of the present invention or the medicine kit described in the eleventh aspect of the present invention.

[0084] In another preferred embodiment, the kit further comprises a label or instructions.

[0085] In another preferred example, the label or the instructions record instructions for administering the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the composition described in the sixth aspect of the present invention, or the delivery composition described in the eighth aspect of the present invention, or the host cell described in the ninth aspect of the present invention, or the CIRSPR complex described in the tenth aspect of the present invention, or the drug kit described in the eleventh aspect of the present invention to the editing object, thereby performing gene editing.

[0086] In another preferred example, the editing object includes cells.

[0087] In another preferred embodiment, the cells include primary cells and passaged cells.

[0088] In another preferred embodiment, the cells include mammalian cells.

[0089] In another preferred embodiment, the cells include human cells.

[0090] In another preferred embodiment, the cells include human hepatocytes.

[0091] The fourteenth aspect of the present invention provides the use of the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the composition described in the sixth aspect of the present invention, or the delivery composition described in the eighth aspect of the present invention or the host cell described in the ninth aspect of the present invention or the CIRSPR complex described in the tenth aspect of the present invention or the drug kit described in the eleventh aspect of the present invention in gene editing, gene targeting or gene cutting.

[0092] In the fifteenth aspect, the present invention provides the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the cell described in the fifth aspect of the present invention, the composition described in any one of the sixth to seventh aspects of the present invention, or the delivery composition described in the eighth aspect of the present invention or the host cell described in the ninth aspect of the present invention or the CIRSPR complex described in the tenth aspect of the present invention or the medicine kit described in the eleventh aspect of the present invention for preparing a medicament for preventing and / or treating tumor diseases.

[0093] In another preferred embodiment, the tumor disease includes hepatocellular carcinoma.

[0094] The sixteenth aspect of the present invention provides a method for treating a tumor disease, comprising administering to a subject an effective amount of the gRNA described in the first aspect of the present invention, the nucleic acid described in the second aspect of the present invention, the vector described in the third aspect of the present invention, the system described in the fourth aspect of the present invention, the cell described in the fifth aspect of the present invention, the composition described in any one of the sixth to seventh aspects of the present invention, or the delivery composition described in the eighth aspect of the present invention or the host cell described in the ninth aspect of the present invention or the CIRSPR complex described in the tenth aspect of the present invention or the drug kit described in the eleventh aspect of the present invention.

[0095] In another preferred embodiment, the tumor disease includes hepatocellular carcinoma.

[0096] In another preferred embodiment, the administration comprises administration by injection.

[0097] In another preferred embodiment, the subject is a human or non-human mammal.

[0098] In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, and monkeys.

[0099] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0100] Figure 1 The positions of different gRNAs on the genome (the picture from left to right corresponds to the genome from 5' to 3' end).

[0101] Figure 2 Electropherograms of DNA fragments used for editing guided by different sgRNAs.

[0102] Figure 3 Deep sequencing results of base editing efficiency guided by different sgRNAs.

[0103] Figure 4 CDC7 mRNA knockdown caused by base editing guided by different sgRNAs. DETAILED DESCRIPTION

[0104] After extensive and in-depth research, the inventor unexpectedly discovered for the first time that the gRNA designed to target the intron region of the CDC7 gene (such as intron 3, intron 6 and intron 9) can effectively inhibit the expression of the CDC7 gene. In addition, the inventor also discovered for the first time that 5 of the gRNAs designed for the GU-AG splicing site in the intron region have very high gene editing efficiency. Therefore, the gRNA designed by the present invention can significantly improve the gene editing efficiency; and / or treat tumor diseases. On this basis, the inventor completed the present invention.

[0105] the term:

[0106] "Splice site mutation" refers to changing or abolishing the correct splicing of the pre-mRNA sequence so that it produces a protein with an amino acid sequence different from the wild type. For example, one or more exons can be skipped during RNA splicing to produce a protein lacking the amino acids encoded by the skipped exons. Alternatively, the reading frame can be changed by incorrect splicing, or one or more introns can be retained, or other splicing donors or acceptors can be produced, or splicing can be initiated at other positions (e.g., within an intron), or other polyadenylation signals can be produced. Correct pre-mRNA splicing is a complex process that can be affected by a variety of mutations in the nucleotide sequence of the GTR encoding gene. In higher eukaryotic organisms (such as plants), the main spliceosome splices introns that contain GU at the 5' splice site (donor site) and AG at the 3' splice site (acceptor site). About 99% of splice sites in nuclear eukaryotic genes follow this GU-AG rule (or GT-AG rule; see Lewin, Genes VI, Oxford University Press 1998, pp. 885-920, ISBN 0198577788).

[0107] The term "in vitro transcription (IVT)" refers to a technique that uses linear DNA as a template to transcribe RNA in an in vitro cell-free system containing RNA transcriptase and NTPs, mimicking the in vivo transcription process.

[0108] The term "cell transfection" refers to the technology of introducing exogenous molecules such as DNA, RNA, etc. into eukaryotic cells using transfection reagents.

[0109] The term "base editor", also referred to as a "nucleobase editor (NBE)", refers to an agent that binds to a polynucleotide and has nucleobase modification activity. In some embodiments, the base editor comprises a nucleobase modification polypeptide (e.g., a deaminase) and a polynucleotide programmable nucleotide binding domain (e.g., Cas9, Cas12) bound to a guide polynucleotide (e.g., a guide RNA). In some embodiments, the domain with base editing activity is capable of deaminating bases within a nucleic acid molecule. In some embodiments, the base editor is capable of deaminating one or more bases within a DNA molecule. In some embodiments, the base editor is capable of deaminating cytosine (C) or adenosine (A) within DNA. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenosine base editor (ABE). In some embodiments, the base editor is an adenosine base editor (ABE) and a cytidine base editor (CBE). In some embodiments, the base editor is a nuclease-inactive Cas protein (e.g., dCas9, dCas12) fused to an adenosine deaminase.

[0110] The term "base editing activity" refers to the activity used to chemically change a base within a polynucleotide. In one embodiment, a first base is converted to a second base. In one embodiment, the base editing activity is a cytidine deaminase activity, such as converting a target C·G to T·A. In another embodiment, the base editing activity is an adenosine or adenine deaminase activity, such as converting a target A·T to C·G. In another embodiment, the base editing activity is a cytidine deaminase activity, such as converting a target C·G to T·A, and an adenosine or adenine deaminase activity, such as converting A·T to G·C.

[0111] The term "gRNA", also known as guide RNA, crRNA or guide sequence, generally speaking, the guide RNA may include a direct repeat sequence and a guide sequence, or may consist essentially of or consist of a direct repeat sequence and a guide sequence. In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and guide the CRISPR / Cas complex to specifically bind to the target sequence. When optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.

[0112] Gene editing system

[0113] The present invention provides a gene editing system, which includes the gRNA described in the first aspect of the present invention, and the gRNA can target a target sequence.

[0114] In a preferred embodiment, the gene editing system also includes a base editor.

[0115] In a preferred embodiment, the target sequence is an intron region of the CDC7 gene.

[0116] In a preferred embodiment, the intron region includes intron 3, intron 6 and intron 9.

[0117] In a preferred embodiment, the target sequence is a splicing site in the intron region of the CDC7 gene.

[0118] The gene editing system of the present invention can significantly improve the gene editing efficiency.

[0119] If the Cas protein of the base editor selected is different, those skilled in the art can understand and select other possible conventional backbone sequences and the targeting structure sequence or adjacent sequence in this embodiment, and achieve the editing of the target gene of the present invention.

[0120] In the sequence of the gRNA of the present invention, SEQ ID NO.1-6 is designed according to the sequence of the splicing site, and the splicing site mutation occurs by editing the targeted splicing site, which affects the transcription process of the target gene, thereby reducing the expression of the target gene.

[0121] In one embodiment, the sgRNA target sequence is selected from any one of CDC7-gRNA1, CDC7-gRNA2, CDC7-gRNA3, CDC7-gRNA4, CDC7-gRNA5, and CDC7-gRNA6. The inventors have experimentally confirmed that the above sequence has a good editing effect.

[0122] Pharmaceutical compositions and methods of administration

[0123] On the other hand, the present invention also provides a pharmaceutical composition, which contains (a) a safe and effective amount of the gene editing system of the present invention or the cell described in the fifth aspect of the present invention; and (b) a pharmaceutically acceptable carrier or excipient. The dosage of the gene editing system of the present invention is generally 10 micrograms to 100 milligrams per dose, preferably 100-1000 micrograms per dose.

[0124] In a preferred embodiment, the concentration of the cells in the pharmaceutical composition is 1×10 3 -1×10 8 cells / kg body weight, preferably 1×10 5 -1×10 7Cells / Kg body weight. For the purpose of the present invention, an effective dose is about 0.01 mg / kg to 50 mg / kg, preferably 0.05 mg / kg to 10 mg / kg body weight of the gene editing system of the present invention. In addition, the gene editing system of the present invention can be used alone or in combination with other therapeutic agents (such as formulated in the same pharmaceutical composition).

[0125] In the present invention, the pharmaceutical composition of the present invention can be administered in the form of a cell therapy agent, for example, the gene editing system of the present invention can be used to transform cells, and then the transformed cells are administered to subjects in need by intravenous or intratumoral injection. In certain embodiments, the gene editing system of the present invention can be used to transform in vivo or isolated cells. In certain embodiments, the cell can be a hepatocyte, and the transformation can include gene editing.

[0126] The pharmaceutical composition may also contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent. The term refers to such pharmaceutical carriers: they do not induce the production of antibodies harmful to the individual receiving the composition, and there is no excessive toxicity after administration. These carriers are well known to those of ordinary skill in the art. A full discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, adjuvants and combinations thereof.

[0127] Pharmaceutically acceptable carriers in therapeutic compositions may contain liquids such as water, saline, glycerol and ethanol. In addition, auxiliary substances such as wetting agents or emulsifiers, pH buffer substances, etc. may also be present in these carriers.

[0128] Typically, therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution or suspension in liquid vehicles prior to injection can also be prepared.

[0129] Once formulated, the composition of the present invention can be administered by conventional routes, including (but not limited to): intratumoral, intramuscular, intravenous, subcutaneous, intradermal, or topical administration. The subject to be prevented or treated can be an animal; especially a human.

[0130] When the pharmaceutical composition of the present invention is used for actual treatment, various dosage forms of the pharmaceutical composition can be used according to the usage, preferably intravenous preparations or intratumoral injections.

[0131] These pharmaceutical compositions can be formulated by mixing, diluting or dissolving according to conventional methods, and appropriate pharmaceutical additives such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonicities, preservatives, wetting agents, emulsifiers, dispersants, stabilizers and solubilizers are occasionally added, and the formulation process can be carried out in a conventional manner according to the dosage form.

[0132] The pharmaceutical composition of the present invention can also be administered in the form of a sustained release agent. For example, the gene editing system of the present invention can be incorporated into a pill or microcapsule with a sustained release polymer as a carrier, and then the pill or microcapsule is surgically implanted into the tissue to be treated. As examples of sustained release polymers, ethylene-vinyl acetate copolymers, polyhydroxymethylacrylate (polyhydrometaacrylate), polyacrylamide, polyvinyl pyrrolidone, methylcellulose, lactic acid polymers, lactic acid-glycolic acid copolymers, etc., preferably biodegradable polymers such as lactic acid polymers and lactic acid-glycolic acid copolymers can be exemplified.

[0133] In one embodiment, the pharmaceutical composition may include a buffer such as neutral buffered saline, sulfate buffered saline, etc.; a carbohydrate such as glucose, mannose, sucrose or dextran, mannitol; a protein; a polypeptide or an amino acid such as glycine; an antioxidant; a chelating agent such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative. The pharmaceutical composition of the present invention is preferably formulated for intravenous administration.

[0134] When the pharmaceutical composition of the present invention is used for actual treatment, the dosage of the gene editing system of the present invention as an active ingredient can be reasonably determined based on the weight, age, gender, and symptom severity of each patient to be treated.

[0135] The main advantages of the present invention include:

[0136] (1) The present invention first discovered that the gRNA designed to target the intron region (such as intron 3, intron 6 and intron 9) of the CDC7 gene can effectively inhibit the expression of the CDC7 gene. In addition, the inventors also first discovered that among the gRNAs designed for the GU-AG splicing site in the intron region, 5 have very high gene editing efficiency. Therefore, the gRNA designed by the present invention can significantly improve the gene editing efficiency; and / or treat tumor diseases.

[0137] (2) The present invention provides a gRNA targeting the CDC7 gene, which can be used in CRISPR gene editing therapy. It can achieve a lasting and stable therapeutic effect through gene-level manipulation, reduce adverse reactions (such as drug resistance) caused by long-term administration, and has the advantages of convenient treatment and relatively lower cost of long-term treatment.

[0138] Below in conjunction with specific embodiment, in order to facilitate understanding of the present invention, the present invention will be described more comprehensively in conjunction with the accompanying drawings and examples. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not indicated in the following examples are usually according to conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. In the absence of special instructions, the cell lines listed in the context of the present invention are cultured according to the prior art. Unless otherwise defined, all technical and scientific terms used herein are the same as those generally understood by technicians in the technical field of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0139] Unless otherwise specified, the materials and reagents used in the examples are commercially available products.

[0140] Example 1 Chemical synthesis of sgRNA targeting the target sequence.

[0141] (1) The CDC7 gene sequence was obtained from the NCBI database (GeneBank, ID 8317). Based on the intron region of the human CDC7 gene, the corresponding sgRNA targeting sequence was designed to find the GU-AG cleavage site that can destroy the CDC7 gene. Six sgRNA targeting sequences were designed. The location of each sgRNA targeting sequence is shown in Figure 1 The specific design of sgRNA targeting sequences is shown in Table 1.

[0142] Table 1 CDC7-gRNA target sequences and their editing sites

[0143]

[0144]

[0145] The positive control AAVs1-sgRNA targeting sequence is as follows:

[0146] AAVs1-sgRNA targeting sequence: ACCCCACAGTGGGGCCACTA (SEQ ID NO. 19).

[0147] The backbone sequences used in the above Table 1 and the positive control sgRNA are as follows:

[0148] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 7).

[0149] Each sgRNA sequence structure is a targeting sequence + backbone sequence (5'-3'). For example, the CDC7-sgRNA1 sequence is as follows:

[0150] TTGCCTACCCAGCCACTGTTAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO. 8).

[0151] The sgRNA sequence was commissioned to be chemically synthesized by GenScript Biotech Co., Ltd., and three bases at the 5' and 3' ends of the sgRNA were modified with thio and methoxy groups.

[0152] Example 2 ABE8e mRNA Synthesis

[0153] ABE8e mRNA synthesis was performed using in vitro transcription (IVT). The specific method is as follows:

[0154] (1) ABE8e plasmid was purchased from Addgene (Plasmid, #138489), and then digested with BspQI restriction endonuclease (purchased from NEB), and linearized as a template for in vitro transcription (Template DNA). Then, use tweezers to take a PCR tube and place it on a tube rack and mark it. Then, use the corresponding pipette to add each reaction component in sequence according to Table 2, and gently pipette to mix evenly.

[0155] Table 2 ABE8e mRNA in vitro transcription (IVT) components

[0156]

[0157]

[0158] (2) After capping the PCR tube, place it in a PCR instrument and incubate at 37°C for 2 h.

[0159] (3) After the incubation is complete, remove the PCR tube from the PCR instrument. Take another clean ice box and fill it halfway with ice. Take out DNaseI (purchased from NEB, M0303S) from the -20℃ refrigerator and transfer them to the cell-free biosafety cabinet. First, remove the sample tube with RNaseZapTM Spray the tube with RNase decontamination solution (Invitrogen, AM9780) and then wipe it clean with clean paper towels and place it on the PCR tube rack in the biosafety cabinet. Then, add 1 μl of DNaseI (purchased from Takara Bio) to the reaction tube and stir gently to mix, then place it in the PCR instrument and react at 37°C for 15 minutes.

[0160] (4) After the reaction is completed, collect the sample in the biosafety cabinet. First, take a centrifuge column from the Rnaeasy mini kit (purchased from Qianen) and place it on the tube rack and open the lid. Then take a clean 1.5ml centrifuge tube and place it on the tube rack. Use a 100μl pipette to aspirate the reaction solution into the tube, add 350μl RLT Buffer solution, and then add 250μl of anhydrous ethanol to the tube. Use a 1ml pipette to gently mix and add it to the previously prepared centrifuge column. After covering the tube cap, transfer it to the centrifuge and centrifuge it at 12000rpm for 30sec.

[0161] (5) After centrifugation, transfer the sample column to a biosafety cabinet, aspirate the waste liquid with a 1 ml pipette, then put the sample column back into the waste liquid tube, open the lid, adjust the 1 ml pipette range to 500 μl, pipette 500 μl RPE Buffer into the sample column, cover the tube, and transfer to a centrifuge and centrifuge at 12,000 rpm for 30 seconds.

[0162] (6) After centrifugation, transfer the sample column to a biosafety cabinet, aspirate the waste liquid, and then return the sample column to the waste liquid tube. Open the lid, adjust the 1 ml pipette range to 500 μl, pipette 500 μl RPE Buffer into the sample column, cover the tube, and transfer to a centrifuge and centrifuge at 12,000 rpm for 2 min.

[0163] (7) After centrifugation, transfer the sample column to a biosafety cabinet, take out a clean waste tube, transfer the sample column to the clean waste tube, and centrifuge again at 12,000 rpm for 2 min.

[0164] (8) After centrifugation, transfer the sample column to a biosafety cabinet, take out a clean 1.5 ml EP tube, transfer the sample column to the clean EP tube, open the lid, and let it stand on the tube rack for 2 minutes. Adjust the 100 μl pipette range to 50 μl, draw 50 μl of enzyme-free water and add it to the middle of the membrane of the sample column, then cover the tube, let it stand on the tube rack for 1 minute, and then transfer it to the centrifuge and centrifuge it at 12000 rpm for 1 minute.

[0165] (9) After centrifugation, transfer the sample column to the biosafety cabinet and use the 50 μl pipette to draw another 50 μl of enzyme-free water and add it to the middle of the sample column membrane. After capping the tube, let it stand on the tube rack for 2 minutes and then centrifuge at 12,000 rpm for 1 minute.

[0166] (10) After centrifugation, transfer the sample column to the biosafety cabinet. Take out a clean PCR tube and EP tube, place them on the tube rack, collect all the eluate in the newly prepared 1.5 ml EP tube, then use a 10 μl range pipette to draw 3 μl of sample and place it in the PCR tube for subsequent concentration determination, label the sample name and date. Place both tubes on ice.

[0167] (11) The concentration was marked on the tube containing the mRNA sample, sealed with sealing film, and frozen at −80°C. The ABE8e mRNA concentration obtained by Nanodrop measurement was 1542 ng / μl.

[0168] Example 3 Detection of base editing efficiency of CDC7 target gene site

[0169] 1. Cell culture

[0170] Hepatoma cell Huh7 was used as the base editing target.

[0171] 1.1 Preparation before the experiment

[0172] (1) Before use, add Opti-MEM TM I reduced serum medium (Gibco, 31985070) was placed at room temperature for equilibration for 30 min.

[0173] (2) After the biosafety cabinet operating surface is wiped and disinfected with 75% alcohol cotton, turn on the ultraviolet light for 30 minutes.

[0174] 1.2 Preparation of culture medium

[0175] (1) Culture medium preparation

[0176] 50 ml of FBS and 5 ml of double antibody (Gibco, #15140122) were added to 500 ml of DMEM high-glucose medium (purchased from Gibco).

[0177] (2) Filter the prepared culture medium through a filter, mark the bottle and store it in a refrigerator at 4°C.

[0178] 1.3 Operation

[0179] (1) After the wind speed of the biosafety cabinet stabilizes, wipe the operating table with alcohol gauze and put in the required consumables and reagents (items entering and leaving the operating table need to be wiped and disinfected with alcohol gauze);

[0180] (2) Take out the cell culture dish from the incubator and observe the cell growth under an inverted microscope. When the cell density reaches 80-90%, cell subculture can be performed.

[0181] (3) Remove the plate and discard the supernatant in the culture dish. Add 3 ml of DPBS to a 100 mm culture dish, cover the bottom of the dish, wash, and discard.

[0182] (4) Add 1 ml of 0.25% trypsin-EDTA to each 100 mm culture dish and place in a 37°C incubator for 5 min. Gently shake the dish to remove the cells.

[0183] (5) Add 3 ml of complete culture medium, collect the cells into a centrifuge tube, pipette to mix, and record the total volume;

[0184] (6) Take 10 μl of cell suspension, add 10 μl AO / PI (purchased from Beijing Biolab Technology Co., Ltd., #HR0462), pipette evenly and transfer to a cell counting plate, count with a cell counter, and calculate the total number of cells;

[0185] (7) Centrifugation at 400 g for 5 min at room temperature;

[0186] (8) After centrifugation, discard the supernatant and add an appropriate amount of culture medium according to the total number of cells to ensure that the cell concentration is 20 million / ml. Resuspend the cells by pipetting repeatedly and inoculate 1 ml of cells into a new 100 mm culture dish;

[0187] (9) Mix the culture dishes crosswise and place them in the incubator, and record the time;

[0188] (10) Remove the sealed reagents and consumables from the biosafety cabinet, wipe the disinfected table with alcohol, and turn on the ultraviolet disinfection lamp.

[0189] 2. Cell transfection

[0190] (1) Huh7 cells with a cell confluence of 80-90% were passaged, counted, and seeded into 48-well plates at 40,000 cells / well. Cell density was observed after 24 hours, and mRNA transfection was performed when the cell confluence reached 70%.

[0191] (2) The dosage was based on a total of 500 ng mRNA (250 ng sgRNA + 250 ng ABE8e mRNA) per well of a 48-well plate and 1.5 μl Lipofectamine MessengerMax (Invitrogen, LMRNA003).

[0192] Prepare two 1.5ml EP tubes, add 20μl Opti-MEM medium to each tube, add sgRNA 250ng and ABE8e 250ng to one tube, and add 1.5μl Lipofectamine MessengerMax to the other tube, mix them well, and let them stand at room temperature for 10min.

[0193] (3) Mix the reagents in the two EP tubes and let stand at room temperature for 5 minutes; then add the mRNA-transfection reagent complex to the cells for transfection, and the editing time is 72 hours.

[0194] 3. Genome extraction

[0195] Genomic DNA of Huh7 cells was extracted using a blood / cell / tissue genomic DNA extraction kit (Tiangen, DP304).

[0196] (1) Resuspend cells in 200 μl Buffer GA.

[0197] (2) Add 20 μl Proteinase K and mix well.

[0198] (3) Add 200 μl of Buffer GB, mix thoroughly by inversion, and incubate at 70°C for 10 min. When the solution becomes clear, centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0199] (4) Add 200 μl of anhydrous ethanol and vortex thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0200] (5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0201] (6) Add 500 μl of Buffer GD to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and return the adsorption column CB3 to the collection tube.

[0202] (7) Add 600 μl of Buffer PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and return the adsorption column CB3 to the collection tube.

[0203] (8) Repeat step (7).

[0204] (9) Centrifuge at 12000 rpm for 2 min and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0205] (10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μl of enzyme-free water to the middle part of the adsorption membrane, let it stand at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min, and collect the solution in a centrifuge tube.

[0206] (11) DNA concentration was measured using Nanodrop.

[0207] 4. Base editing efficiency determination

[0208] (1) The target sequence site detection primers for each target gene are shown in the table below. All primers were commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0209] Table 3 Target sequence site detection primers

[0210]

[0211] (2) PCR reaction system and reaction.

[0212] The upstream and downstream primers for the detection are shown in Table 3. The PCR reactions all used the high-fidelity enzyme KOD-Plus-Neo (purchased from TOYOBO, catalog number KOD-401) to amplify the target fragment.

[0213] The amplification system was as follows: 10×PCR Buffer for KOD-Plus-Neo 5μl, dNTP 5μl, Mg 2+ 3μl, KOD-Plus-Neo 1μl, target sequence site detection upstream and downstream primers 1μl each, DNA Template 50ng, ddH2O to 50μL.

[0214] The PCR reaction program was as follows: pre-denaturation: 95°C for 5 min, 35 cycles (95°C for 10 s; 60°C for 10 s; 68°C for 10 s), extension: 68°C for 5 min, storage temperature: 4°C.

[0215] The gel electrophoresis results of PCR products are as follows Figure 2 As shown, deep sequencing was commissioned to Sangon Biotech (Shanghai) Co., Ltd.

[0216] The sequencing results are as follows Figure 3 As shown, the results show:

[0217] The base editing efficiency mediated by AAVS1 sgRNA was 67.00±2.80%, the base editing efficiency mediated by CDC7 sgRNA1 was 54.20±27.40%, the base editing efficiency mediated by CDC7 sgRNA2 was 60.45±3.35%, the base editing efficiency mediated by CDC7sgRNA3 was 81.95±0.05%, the base editing efficiency mediated by CDC7 sgRNA4 was 72.10±1.00%, the base editing efficiency mediated by CDC7 sgRNA5 was 72.20±0.70%, and the base editing efficiency mediated by CDC7 sgRNA6 was 0%.

[0218] It can be seen from this that the base editing efficiency mediated by CDC7-sgRNA1 to sgRNA5 is higher than 50%, especially the base editing efficiency mediated by CDC7-sgRNA3 is close to 82%, while the designed CDC7 sgRNA6 did not play a mediating role and the editing efficiency was 0.

[0219] Example 4 Detection of mRNA transcription level after CDC7 target gene editing

[0220] 1. The total RNA of Huh7 cells was extracted using Trizol method.

[0221] (1) Collect cells by centrifugation, add 1 ml of TRIzol, and pipette repeatedly.

[0222] (2) Place the homogenized sample at room temperature (15-30°C) for 5 minutes to completely separate the nucleic acid-protein complex.

[0223] (3) Add 0.2 ml of chloroform per 1 ml of TRIzol, shake vigorously for 15 seconds, and leave at room temperature for 10 minutes.

[0224] (4) Centrifuge at 12000×g for 15 minutes at 4℃. The sample is divided into three layers: the bottom layer is a red organic phase, the upper layer is a colorless aqueous phase, and an intermediate layer. RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 60% of the TRIzol reagent used. Transfer the upper aqueous phase to a new EP tube.

[0225] (5) Add an equal volume of isopropanol (about 500 μL) to the upper aqueous phase (about 500 μL) to precipitate the RNA in the aqueous phase with isopropanol. After adding isopropanol, invert and mix thoroughly, and leave at room temperature for 10 minutes.

[0226] (6) Centrifuge at 12,000 × g at 4°C for 10 min. No RNA precipitate was visible before centrifugation, but a gelatinous precipitate appeared on the sides and bottom of the tube after centrifugation. Remove the supernatant.

[0227] (7) Wash the RNA precipitate with 1 mL of 75% ethanol, centrifuge at 12,000 × g for 5 min at 4°C, and discard the supernatant.

[0228] (8) Allow the RNA precipitate to dry at room temperature for about 5-10 minutes. Over-drying will greatly reduce the solubility of the RNA.

[0229] (9) Add 50 μL of enzyme-free water, pipette several times, measure the concentration using Nanodrop, and store at -80°C for later use.

[0230] 2. cDNA synthesis and real-time PCR (qPCR)

[0231] (1) The reverse transcription system (10 μl) is as follows:

[0232] ⅡSuperMix plus 5μL, total RNA 500ng, the balance is RNase-free H2O.

[0233] (2) The RT-PCR procedure is as follows:

[0234] 25℃5min, 42℃30min, 85℃5min.

[0235] The collected cDNA products were stored at -20°C for later use.

[0236] 3. Real-time PCR reaction

[0237] (1) Take 10 μl of the obtained cDNA, add 40 μl DNase / RNase-free water to dilute (i.e. dilute the cDNA 5 times) and use it as a template for subsequent Real-time qPCR.

[0238] Real-time PCR reaction system (20 μl) is as follows:

[0239] qPCR SYBR Green Master Mix 10μl, upstream and downstream primers 0.5μl each, Real-timeqPCR template 1μl, and the balance is sterile ultrapure water.

[0240] The upstream and downstream primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. The sequences are as follows:

[0241] CDC7 qPCR-F: CTAGCCTGACCTGTGACTGC (SEQ ID NO: 20);

[0242] CDC7 qPCR-R: GGGGCACTTTGTCAAGACCT (SEQ ID NO: 21).

[0243] Real-time PCR reaction procedure is as follows:

[0244] Pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing / extension at 60°C for 30 s, for a total of 40 cycles. Melting curves were drawn using the instrument default settings. -ΔΔCT Methods The mRNA expression was analyzed. The untreated group was selected as the control group (control), the NT group was selected as the negative control group 1 (i.e., non-targeting group), and AAVS1 was selected as the negative control group 2 (i.e., AAVS1 site editing group).

[0245] The mRNA expression levels Figure 4 As shown, compared with the control group, CDC7 sgRNA1-mediated editing reduced the CDC7 mRNA expression by 14.01%, CDC7 sgRNA2-mediated editing did not knock down the CDC7 mRNA expression, CDC7 sgRNA3-mediated editing knocked down the CDC7 mRNA expression by 71.19%, CDC7 sgRNA4-mediated editing knocked down the CDC7 mRNA expression by 78.12%, CDC7 sgRNA5-mediated editing knocked down the CDC7 mRNA expression by 85.76%, and CDC7 sgRNA6-mediated editing reduced the CDC7 mRNA expression by 0.77%.

[0246] The above results show that CDC7 sgRNA3, CDC7 sgRNA4 and CDC7 sgRNA5 in the present invention can significantly knock down the expression level of CDC7 mRNA, and CDC7 sgRNA1 can knock down the expression level of CDC7 mRNA to a certain extent.

[0247] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A gRNA, characterized in that The gRNA targets the intron region of the CDC7 gene.

2. A nucleic acid, characterized in that The nucleic acid encodes the gRNA according to claim 1, or encodes a precursor of the gRNA according to claim 1.

3. A carrier, characterized in that The vector comprises the gRNA of claim 1 or the nucleic acid of claim 2.

4. A gene editing system, characterized in that: The gene editing system includes the gRNA described in claim 1.

5. A cell, characterized in that The cells are obtained by editing with the gene editing system according to claim 4.

6. A composition, characterized in that It comprises a gRNA component and a protein component, wherein the gRNA comprises the gRNA according to claim 1, and the protein component comprises a base editor.

7. A composition, characterized in that include: The system of claim 4 or the cell of claim 5; and A pharmaceutically acceptable carrier.

8. A delivery composition, characterized in that Comprising an active ingredient and a delivery medium, wherein the active ingredient comprises the gRNA described in claim 1, the vector described in claim 3 or the system described in claim 4.

9. A host cell, characterized in that The host cell comprises the gRNA of claim 1, the nucleic acid of claim 2, the vector of claim 3, the system of claim 4, the composition of claim 6, or the delivery composition of claim 8.

10. A CRISPR complex, characterized in that The complex includes the gRNA of claim 1 and a base editor, wherein the gRNA contains a spacer sequence capable of hybridizing with a target nucleic acid.

11. A medicine box, characterized in that: include: A first container, and an active ingredient or a drug containing the active ingredient, wherein the active ingredient or the drug is located in the first container, and the active ingredient comprises the gRNA of claim 1, the nucleic acid of claim 2, the vector of claim 3, the system of claim 4, the cell of claim 5, the composition of any one of claims 6-7, or the delivery composition of claim 8, or the host cell of claim 9, or the CRISPR complex of claim 10.

12. A method for gene editing of cells, characterized in that: Comprising contacting the cell with the gRNA of claim 1, the nucleic acid of claim 2, the vector of claim 3, the system of claim 4, the composition of claim 6, or the delivery composition of claim 8 or the host cell of claim 9 or the CRISPR complex of claim 10 or the kit of claim 11.

13. A kit for gene editing, characterized in that: The kit comprises the gRNA of claim 1, the nucleic acid of claim 2, the vector of claim 3, the system of claim 4, the composition of claim 6, or the delivery composition of claim 8 or the host cell of claim 9 or the CRISPR complex of claim 10 or the kit of claim 11.

14. Use of the gRNA of claim 1, the nucleic acid of claim 2, the vector of claim 3, the system of claim 4, the composition of claim 6, or the delivery composition of claim 8, or the host cell of claim 9, or the CRISPR complex of claim 10, or the kit of claim 11 in gene editing, gene targeting or gene cutting.

15. Use of the gRNA of claim 1, the nucleic acid of claim 2, the vector of claim 3, the system of claim 4, the cell of claim 5, the composition of any one of claims 6-7, or the delivery composition of claim 8, or the host cell of claim 9, or the CRISPR complex of claim 10, or the kit of claim 11, characterized in that: Used for preparing medicines for preventing and / or treating tumor diseases.

Images