Method for inhibiting liver cancer by PRKDC gene

Abstract

The invention discloses short hairpin RNA (shPRKDC) for precise targeted therapy of hepatocellular carcinoma. The short hairpin RNA which is synthesized in vitro and aims at a PRKDC specific sequence can specifically target and knock down the expression of a DNA receptor gene PRKDC in HCC cells; the shPRKDC hepatoma carcinoma cells have the phenomena that the proliferation ability, the clone formation ability and the migration ability are obviously reduced and the cell cycle is retarded on the in-vitro cell level; meanwhile, in a mouse body, the growth speed of the tumor can be obviously reduced.

Description

Technical Field

[0001] The present invention relates to the field of medical and pharmaceutical biotechnology, and in particular to a method for inhibiting liver cancer with a PRKDC gene. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the major malignant tumors in the world, and its mortality rate ranks among the top causes of cancer death. Although there are more and more targeted treatments for HCC, such as multi-kinase inhibitors (such as sorafenib, lenvatinib) and anti-angiogenesis combined with immune checkpoint inhibitors (such as atezolizumab combined with bevacizumab) clinical treatments, the number of patients who can benefit from them is still very limited. In addition, due to the high heterogeneity of HCC, most current treatments adopt a "one-size-fits-all" paradigm. Therefore, in order to improve the benefits of HCC targeted treatment, it is urgent to discover new therapeutic targets to develop more precise treatment strategies.

[0003] There are many challenges in finding new targets for targeted therapy of HCC. First, the high heterogeneity of HCC means that different cell populations within the tumor may respond differently to the same treatment, which increases the complexity of target discovery and validation. Second, multiple factors in the tumor microenvironment, such as immunosuppression and angiogenesis, may mask the effectiveness of potential targets. In addition, the biological differences between preclinical models (such as mouse models) and human liver cancer make translational research from models to clinics highly uncertain. Finally, the high incidence and mortality of HCC require large-scale clinical trials to verify the effectiveness and safety of new targets, which requires a lot of time and resource investment.

[0004] The discovery of new targets can promote the development of personalized treatment, thereby overcoming the limitations of the current "one-size-fits-all" treatment model. Precision targeted therapy can be individualized according to the patient's specific tumor characteristics, thereby improving the treatment effect and patient survival rate. In addition, new therapeutic targets may also reveal the key mechanisms of liver cancer occurrence and development, providing new directions and ideas for future research; in short, the discovery and verification of new targets will not only help develop more effective treatments, but also bring more treatment options and hope to HCC patients; therefore, the research content of the present invention focuses on the DNA receptor gene PRKDC (Protein kinase, DNA-activated, catalytic subunit, PRKDC), aiming to explore the tumor suppressor effect of PRKDC gene in HCC by short hairpin RNA targeting PRKDC gene (short hairpin RNA targeting PRKDC gene, shPRKDC), cell transfection, cell proliferation experiment, clone formation experiment, scratch experiment, flow cytometry, mouse subcutaneous transplant tumor model, mouse in situ liver injection tumor model, and the completion of this study can provide new targets for precise targeting of liver cancer cells. Summary of the invention

[0005] The present invention has been proposed in view of the above-mentioned problems.

[0006] Therefore, the purpose of the present invention is to provide a method for inhibiting liver cancer by using the PRKDC gene, so as to achieve precise targeted treatment of HCC by knocking down the expression of the PRKDC gene.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] A short hairpin RNA (shPRKDC) for precise targeted therapy of hepatocellular carcinoma. The short hairpin RNA synthesized in vitro against the specific sequence of PRKDC can specifically target and knock down the expression of the DNA receptor gene PRKDC in HCC cells.

[0009] Furthermore, the Target sequence can target the mRNA sequence of PRKDC, and its sequence design enables it to effectively reduce the expression level of the PRKDC gene and protein expression level after transfection into HCC cells, thereby inhibiting the proliferation, cloning, migration and in vivo growth ability of HCC cells.

[0010] A method for constructing a hepatocellular carcinoma cell line with PRKDC gene knockdown comprises the following steps:

[0011] a. introducing the short hairpin RNA according to claim 1 or 2 into a hepatocellular carcinoma cell line;

[0012] b. culturing the cell line under appropriate culture conditions to express the short hairpin RNA and knock down the PRKDC gene;

[0013] c. Screen and verify cell clones with significantly reduced PRKDC gene expression to obtain hepatocellular carcinoma cell lines with PRKDC gene knockdown.

[0014] Furthermore, the hepatocellular carcinoma cell line includes but is not limited to HUH7 cell line and mouse liver cancer Hepa1-6 cell line.

[0015] A method for evaluating the response of a hepatocellular carcinoma cell line to PRKDC gene knockdown, wherein the hepatocellular carcinoma cell line with PRKDC gene knockdown is constructed and at least one of the following experiments is performed:

[0016] a. CCK8 assay to evaluate changes in cell proliferation ability;

[0017] b. Clone formation assay to evaluate changes in cell clone formation ability;

[0018] c. Scratch assay to evaluate changes in cell migration ability;

[0019] d. Flow cytometry was used to detect changes in cell cycle distribution.

[0020] A strategy for precise targeted treatment of hepatocellular carcinoma, wherein the short hairpin RNA or the constructed hepatocellular carcinoma cell line with PRKDC gene knockdown inhibits the proliferation, cloning and migration of HCC cells by inhibiting the expression of PRKDC gene, thereby slowing down the growth rate of tumors in vivo.

[0021] A pharmaceutical composition for treating hepatocellular carcinoma, comprising the short hairpin RNA according to claim 1 or 2 as an active ingredient, and a pharmaceutically acceptable carrier or diluent.

[0022] In the above technical solution, the technical effects and advantages provided by the present invention are:

[0023] The present invention, by transfecting PRKDC sequence ( CCAGTGAAAGTCTGAATCATT ) can reduce the expression of PRKDC gene and protein in human and mouse liver cancer cell lines;

[0024] In the present invention, the shPRKDC liver cancer cells show a significant decrease in proliferation ability, clone formation ability, migration ability and cell cycle arrest at the in vitro cell level; at the same time, a significant decrease in tumor growth rate can also be observed in mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0026] Figure 1 A map of human shPRKDC tool vectors;

[0027] Figure 2 This is the map of the mouse shPRKDC tool vector;

[0028] Figure 3 This is the experimental flow chart;

[0029] Figure 4 This is a diagram of the construction of PRKDC knockdown cell lines;

[0030] Figure 5 This is a graph analyzing the proliferation ability of PRKDC knockdown cell lines;

[0031] Figure 6 This is a diagram of the clone formation analysis of the PRKDC knockdown cell line;

[0032] Figure 7 This is a graph analyzing the migration ability of PRKDC knockdown cell lines;

[0033] Figure 8 This is a cell cycle analysis diagram of the PRKDC knockdown cell line;

[0034] Fig. 9 Growth graph of PRKDC knockdown cell line observed in subcutaneous xenograft tumor model of C-NKG immunodeficient mice. DETAILED DESCRIPTION

[0035] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.

[0036] The embodiment of the present invention discloses a method for inhibiting liver cancer by using the PRKDC gene.

[0037] First embodiment

[0038] A short hairpin RNA (shPRKDC) for precise targeted therapy of hepatocellular carcinoma. The short hairpin RNA synthesized in vitro against the specific sequence of PRKDC can specifically target and knock down the expression of the DNA receptor gene PRKDC in HCC cells.

[0039] Furthermore, the Target sequence can target the mRNA sequence of PRKDC, and its sequence design enables it to effectively reduce the expression level of the PRKDC gene and protein expression level after transfection into HCC cells, thereby inhibiting the proliferation, cloning, migration and in vivo growth ability of HCC cells.

[0040] A method for constructing a hepatocellular carcinoma cell line with PRKDC gene knockdown comprises the following steps:

[0041] a. introducing the short hairpin RNA according to claim 1 or 2 into a hepatocellular carcinoma cell line;

[0042] b. culturing the cell line under appropriate culture conditions to express the short hairpin RNA and knock down the PRKDC gene;

[0043] c. Screen and verify cell clones with significantly reduced PRKDC gene expression to obtain hepatocellular carcinoma cell lines with PRKDC gene knockdown.

[0044] Furthermore, the hepatocellular carcinoma cell line includes but is not limited to HUH7 cell line and mouse liver cancer Hepa1-6 cell line.

[0045] A method for evaluating the response of a hepatocellular carcinoma cell line to PRKDC gene knockdown, wherein the hepatocellular carcinoma cell line with PRKDC gene knockdown is constructed and at least one of the following experiments is performed:

[0046] a. CCK8 assay to evaluate changes in cell proliferation ability;

[0047] b. Clone formation assay to evaluate changes in cell clone formation ability;

[0048] c. Scratch assay to evaluate changes in cell migration ability;

[0049] d. Flow cytometry was used to detect changes in cell cycle distribution.

[0050] A strategy for precise targeted treatment of hepatocellular carcinoma, wherein the short hairpin RNA or the constructed hepatocellular carcinoma cell line with PRKDC gene knockdown inhibits the proliferation, cloning and migration of HCC cells by inhibiting the expression of PRKDC gene, thereby slowing down the growth rate of tumors in vivo.

[0051] A pharmaceutical composition for treating hepatocellular carcinoma, comprising the short hairpin RNA according to claim 1 or 2 as an active ingredient, and a pharmaceutically acceptable carrier or diluent.

[0052] The Target sequence information of the shRNA of the present invention is as follows:

[0053]

[0054] Reference Figure 1 The human vector information is as follows: vector number: GV493; element sequence: hU6-MCS-CBh-gcGFP-IRES-puromycin; control number: CON313; control insertion sequence: TTCTCCGAACGTGTCACGT.

[0055] Reference Figure 2 The mouse vector information is as follows: vector number: GV493; element sequence: hU6-MCS-CBh-gcGFP-IRES-puromycin; control number: CON313; control insertion sequence: TTCTCCGAACGTGTCACGT.

[0056] Second embodiment

[0057] (1) Construction of liver cancer cell line with PRKDC gene knockdown:

[0058] The PRKDC gene was successfully knocked down by transfecting short hairpin RNA, and the expression level and protein expression level of the PRKDC gene in the liver cancer cell line HUH7 and the mouse liver cancer cell line Hepa1-6 were significantly decreased (P < 0.05).

[0059] (2) CCK8 experiment to observe proliferation ability:

[0060] The proliferation ability of liver cancer cell lines with PRKDC gene knockdown was significantly reduced within 72 hours (P<0.0001).

[0061] (3) Clone formation experiment:

[0062] The clone-forming ability of liver cancer cell lines with PRKDC gene knockdown was significantly decreased (P<0.001).

[0063] (4) Scratch test to observe migration ability:

[0064] The migration rate of liver cancer cell lines with PRKDC gene knockdown was significantly reduced (P<0.01).

[0065] (5) Flow cytometry detection of cell cycle:

[0066] The liver cancer cell line with PRKDC gene knockdown showed cell cycle S phase arrest (P<0.0001).

[0067] (6) Mouse subcutaneous transplant tumor model and orthotopic liver injection tumor model:

[0068] The tumor volume of the liver cancer cell line in which the PRKDC gene was knocked down in mice was significantly reduced (P < 0.0001) and the tumor growth rate was significantly slowed down (P < 0.0001).

[0069] Third embodiment

[0070] Data quantification technology effect:

[0071] PRKDC gene expression reduction: 85%

[0072] Reduced cell proliferation ability: 40%

[0073] Reduced colony formation ability: 50%

[0074] Cell migration speed decreased: 60%

[0075] Increased proportion of cells in G0 / G1 phase: 30%

[0076] Reduction in the proportion of cells in S phase: 35%

[0077] In vivo tumor volume reduction: 45%

[0078] Slowdown of tumor growth in vivo: 50%.

[0079] The above description is only by way of illustration of certain exemplary embodiments of the present invention. It is undoubted that those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the above drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A short hairpin RNA for precise targeted therapy of hepatocellular carcinoma, characterized in that: In vitro synthesized short hairpin RNA targeting the specific sequence of PRKDC can specifically target and knock down the expression of the DNA sensor gene PRKDC in HCC cells.

2. The short hairpin RNA according to claim 1, characterized in that The target sequence can target the mRNA sequence of PRKDC. Its sequence design enables it to effectively reduce the expression level of the PRKDC gene and protein expression level after transfection into HCC cells, thereby inhibiting the proliferation, cloning, migration and in vivo growth ability of HCC cells.

3. A method for constructing a hepatocellular carcinoma cell line with knockdown of the PRKDC gene, comprising the following steps: a. introducing the short hairpin RNA according to claim 1 or 2 into a hepatocellular carcinoma cell line; b. culturing the cell line under appropriate culture conditions to express the short hairpin RNA and knock down the PRKDC gene; c. Screen and verify cell clones with significantly reduced PRKDC gene expression to obtain hepatocellular carcinoma cell lines with PRKDC gene knockdown.

4. The method for constructing a hepatocellular carcinoma cell line with knockdown of PRKDC gene according to claim 3, characterized in that: The hepatocellular carcinoma cell lines include but are not limited to HUH7 cell line and mouse liver cancer Hepa1-6 cell line.

5. A method for evaluating the response of a hepatocellular carcinoma cell line to PRKDC gene knockdown, comprising using the hepatocellular carcinoma cell line with PRKDC gene knockdown constructed according to claim 3 or 4 to perform at least one of the following experiments: a. CCK8 assay to evaluate changes in cell proliferation ability; b. Clone formation assay to evaluate changes in cell clone formation ability; c. Scratch assay to evaluate changes in cell migration ability; d. Flow cytometry was used to detect changes in cell cycle distribution.

6. A strategy for precise targeted treatment of hepatocellular carcinoma, characterized in that The short hairpin RNA according to any one of claims 1 to 5 or the constructed hepatocellular carcinoma cell line with PRKDC gene knockdown is used to inhibit the proliferation, cloning and migration of HCC cells by inhibiting the expression of PRKDC gene, thereby slowing down the growth rate of tumors in vivo.

Images