Nucleic acid test strip for detecting smut gene and detection method

Abstract

The invention provides a nucleic acid test strip for detecting smut genes and a detection method, and belongs to the technical field of detection. The test strip comprises a bottom plate, a sample pad and a water absorption pad, the NC membrane is pasted on the bottom plate, the NC membrane is provided with a T line and a C line, and a conjugate of the capture probe and streptavidin is sprayed on the T line; a conjugate of a quality control probe and streptavidin is sprayed on the line C; and the DNA sequence of the quality control probe and the DNA sequence of the DNA1-AgInS2 / ZnS fluorescent probe are complementarily paired. According to the invention, the AgInS2 / ZnS quantum dots (AgInS2 / ZnS QDs) have the advantages of good biocompatibility, high fluorescence intensity, wide spectrum range and the like. Compared with a traditional test strip, the test strip based on the AgInS2 / ZnS quantum dots is higher in sensitivity and higher in quantitative capacity. Quantitative detection is carried out by detecting the fluorescence ratio of the T line to the C line through a fluorescence immunoassay analyzer, the fluorescence immunoassay analyzer can rapidly read numerical values, and the kit has the advantages of being rapid, easy to operate, low in sensitivity, good in selectivity and the like.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a nucleic acid test strip for detecting smut genes and a method for detecting smut using the nucleic acid test strip. Background Art

[0002] Sugarcane smut is caused by the sugarcane whip smut fungus and is a very serious sugarcane disease worldwide. The incidence of sugarcane smut in the field is between 10% and 20%, and in some areas it even exceeds 50%, causing huge economic losses. The characteristic manifestation of this disease is that the growth points of the sugarcane stems mutate to form black whip-like objects, which makes it the most easily recognizable of all sugarcane diseases. Although the symptoms of the disease are obvious and easy to diagnose in the later stages of development, its incubation period is long. For sugarcane seedlings or seed stems that are not yet symptom-free, traditional diagnostic methods are difficult to accurately determine whether they have been infected with sugarcane smut fungi. Therefore, exploring the early prediction and diagnosis of sugarcane smut disease is of great significance and promotion to improving the economic benefits of the sugarcane industry.

[0003] At present, the detection of sugarcane smut is mainly through visual observation of the disease or through PCR-related technology. However, when the lesions are observed by the naked eye, they have already caused significant damage to the growth of sugarcane, and PCR technology usually has the disadvantages of expensive instruments, requiring professional operation, and not being able to detect on-site. Therefore, it is necessary to develop a simple, fast, low-cost, and sensitive method for on-site detection of sugarcane smut. Summary of the invention

[0004] In view of this, in order to solve the above-mentioned deficiencies in the prior art, on the one hand, the present invention provides a nucleic acid test strip for detecting smut genes, which uses AgInS2 / ZnS quantum dots (AgInS2 / ZnS QDs) and has the advantages of good biocompatibility, high fluorescence intensity, and wide spectral range. The test strip based on AgInS2 / ZnS quantum dots has higher sensitivity and stronger quantitative ability than traditional test strips. Quantitative detection is performed by using a fluorescent immunoassay to detect the fluorescence ratio of the T line and the C line. The fluorescent immunoassay can quickly read out the value, which has the advantages of fast, simple operation, low sensitivity, and good selectivity.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] A nucleic acid test strip for detecting smut gene, comprising:

[0007] A base plate, on which an NC film is adhered;

[0008] A sample pad is adhered to one side of the bottom plate;

[0009] A water-absorbing pad is attached to the other side of the bottom plate;

[0010] The NC membrane is provided with a T line and a C line, the T line is close to the sample pad, the C line is close to the water absorbent pad, and the T line is sprayed with a conjugate of a capture probe and streptavidin; the 3' end of the capture probe is labeled with biotin;

[0011] The C line is sprayed with a conjugate of a quality control probe and streptavidin; the 5' end of the quality control probe is labeled with biotin; the quality control probe is complementary to the DNA sequence of the DNA1-AgInS2 / ZnS fluorescent probe;

[0012] The nucleotide sequence of the capture probe is TGGAGACGTAGG, and the nucleotide sequence of the quality control probe is ACTAACTTACGG;

[0013] The nucleotide sequence of DNA1 in the DNA1-AgInS2 / ZnS fluorescent probe is CCGTAAGTTAGT.

[0014] Preferably, the preparation method of the DNA1-AgInS2 / ZnS fluorescent probe comprises the following steps:

[0015] Step (1), mixing the AgInS2 / ZnS quantum dots with a PBS buffer solution containing EDC and NHS and activating the mixture to obtain activated AgInS2 / ZnS;

[0016] Step (2), mixing the activated AgInS2 / ZnS with DNA1 and vortexing at room temperature;

[0017] Step (3), adding BSA thereto, vortexing at room temperature, performing a sealing treatment, and finally obtaining a DNA1-AgInS2 / ZnS fluorescent probe.

[0018] Preferably, the preparation method of the DNA1-AgInS2 / ZnS fluorescent probe is specifically as follows:

[0019] Step (1), activating 1-5 μL of AgInS2 / ZnS quantum dots with 20-50 μL of PBS buffer containing 10-20 mM EDC and NHS to obtain activated AgInS2 / ZnS;

[0020] Step (2), mixing the activated AgInS2 / ZnS with DNA1, and vortexing for 1-4h at room temperature;

[0021] Step (3), adding 30-50 μL of 0.5-5% BSA, vortexing for 0.5-3 h at room temperature, and performing a blocking treatment to finally obtain a DNA1-AgInS2 / ZnS fluorescent probe.

[0022] Preferably, the method for preparing the AgInS2 / ZnS quantum dots comprises the following steps:

[0023] Step (11), adding water, silver nitrate, thioglycolic acid, and ammonium hydroxide into a volumetric flask, stirring evenly to obtain a first mixed solution;

[0024] Step (12), adding InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0025] Step (13), adding Na2S·9H2O to the second mixed solution to obtain a third mixed solution, and heating the mixture;

[0026] Step (14), adding thioglycolic acid and Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat to form a ZnS shell;

[0027] Step (15), after rotary evaporation of the fourth mixed solution, add isopropanol to induce quantum dot aggregation, then centrifuge, add isopropanol again, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in water, and store it in a dark environment.

[0028] Preferably, the preparation method of the AgInS2 / ZnS quantum dots is specifically as follows:

[0029] Step (11), add 90-120 mL of water, 1-3 mL of 0.5-3 M silver nitrate, 2-3 mL of 0.5-3 M thioglycolic acid, and 0.5-2 mL of 3-6 M ammonium hydroxide into a volumetric flask, stir evenly, and obtain a first mixed solution;

[0030] Step (12), adding 0.5-1 mL of 1-3 M InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0031] Step (13), adding 0.5-3 mL of 1-3 M Na2S·9H2O to the second mixed solution to obtain a third mixed solution, heating the mixture to 90-95° C. for 30-60 min;

[0032] Step (14), adding 0.5-3 mL of 0.5-3 M thioglycolic acid and 0.5-3 mL of 0.5-3 M Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat for 30-60 min to form a ZnS shell;

[0033] Step (15), after rotary evaporating the fourth mixed solution at 30-60° C., add 2-5 mL of isopropanol to induce quantum dot aggregation, then centrifuge at 4500 rpm for 5-10 min, add isopropanol, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in 0.5-3 mL of water, and store in a dark environment.

[0034] Preferably, the method for preparing the conjugate of the capture probe and streptavidin comprises the following steps:

[0035] The capture probe and the streptavidin aqueous solution are mixed, incubated, and coupled to obtain;

[0036] The method for preparing the conjugate of the quality control probe and streptavidin comprises the following steps:

[0037] The quality control probe and the streptavidin aqueous solution are mixed and incubated for coupling to obtain the product.

[0038] On the other hand, the present invention also provides a method for detecting smut genes, using the above-mentioned nucleic acid test strip for detecting smut genes for detection, comprising the following steps:

[0039] The DNA amplification solution containing the target and the mixed solution of the DNA1-AgInS2 / ZnS fluorescent probe are dropped onto the T line and the C line respectively. If the T line is colored, it is a positive result, and if the T line is not colored, it is a negative result.

[0040] Preferably, the method for preparing the DNA amplification solution comprises the following steps:

[0041] Preparation of a logic device: after mixing the S chain and the N chain, heating and cooling to obtain the SN double chain, incubating the magnetic beads and the SN double chain to obtain the a logic device;

[0042] Among them, the nucleotide sequence of the S chain is:

[0043] ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAA AA;

[0044] The nucleotide sequence of the N strand is: GGTTCATCAACGAGTCGATGGAAGGTGT;

[0045] Preparation of b logic device: R, P, Q chains are mixed, heated, and cooled to obtain RPQ double chains, and magnetic beads and RPQ are incubated to obtain b logic device;

[0046] Among them, the nucleotide sequence of the R chain is: CCTACGTCTCCAACTAACTTACGG;

[0047] The nucleotide sequence of the P strand is:

[0048] AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC;

[0049] The nucleotide sequence of the Q strand is:

[0050] CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG;

[0051] Preparation of c-logic device: heating and cooling the F chain, incubating the magnetic beads and the F chain to obtain the c-logic device;

[0052] Among them, the nucleotide sequence of the F chain is:

[0053] AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG;

[0054] The target object and logic devices a, b, and c are mixed and incubated, and the DNA amplification solution is obtained after magnetic separation of the solution.

[0055] Preferably, when preparing the a-logic device, the molar ratio of the S chain to the N chain is 1:1;

[0056] When preparing the b-logic device, the molar ratio of the R, P, and Q chains is 1:1:1.

[0057] Preferably, the preparation of the a logic device: after mixing the S chain and the N chain, heat to 80-95°C, keep for 5-15 minutes, and then naturally cool to room temperature to obtain the SN double chain, and incubate the magnetic beads and the SN double chain on a shaker for 1-4 hours to obtain the a logic device;

[0058] Preparation of b logic device: R, P, Q chains were mixed, heated to 80-95°C, maintained for 5-15 min, and then naturally cooled to room temperature to obtain RPQ double chains, and the magnetic beads and RPQ were shaken and incubated on a shaker for 1-4 h to obtain b logic device;

[0059] Preparation of c-logic: Heat the F chain to 80-95°C, maintain for 5-15 minutes, then cool naturally to room temperature, incubate the magnetic beads and F chain on a shaker for 1-4 hours to obtain the c-logic.

[0060] Compared with the prior art, the present invention has the following beneficial effects:

[0061] The nucleic acid test strip for detecting smut gene provided by the present invention has a detection probe which is different from the traditional colloidal gold test strip, which can only obtain qualitative or semi-quantitative results and has low sensitivity. The present invention utilizes AgInS2 / ZnS quantum dots (AgInS2 / ZnS QDs) with the advantages of good biocompatibility, high fluorescence intensity, wide spectral range, etc. The fluorescent material with good biocompatibility can be quantified, and the programmable nucleic acid technology can achieve signal amplification, thus constructing a fast, simple, highly accurate and highly sensitive detection and analysis technology.

[0062] The test strip based on AgInS2 / ZnS quantum dots has higher sensitivity and stronger quantitative ability than traditional test strips. It can be observed under 365nm ultraviolet light and judged by naked eyes to achieve preliminary qualitative analysis, and quantitative detection can be performed by using a fluorescent immunoassay to detect the fluorescence ratio of the T line and the C line. The fluorescent immunoassay can quickly read the value and has the advantages of fast, simple operation, low sensitivity, and good selectivity. The nucleic acid test strip has low cost, simple instrument, no need for professional operation, and is easy to realize production.

[0063] The detection method of the present invention uses DNA logic, entropy-driven amplification, and fluorescent quantum dots to enhance the signal, amplify a small amount of target, effectively amplify the detection signal, and has a lower detection limit for the gene detection of smut. By introducing a dual-primer driven strategy, the smut gene can be detected more accurately. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 This is a schematic diagram of the test strip assembly of the present invention;

[0065] Figure 2 The schematic diagram of the principle of the test strip of the present invention for identifying smut, wherein part A is a schematic diagram of the entropy-driven amplification process, part B is a schematic diagram of the working principle of the test strip, and part C is a schematic diagram of the detection result of the presence or absence of the target object;

[0066] Figure 3 The test strip of the present invention is a test result diagram in the presence or absence of a target sequence (observed under 365 nm ultraviolet light), wherein Part A is a physical diagram when no smut primer is added, Part B is a physical diagram when only smut Target1 gene primer is added, Part C is a physical diagram when only smut Target2 gene primer is added, and Part D is a physical diagram when both primers are added;

[0067] Figure 4 The result diagram of the test strip of the present invention detecting target gene sequences of different concentrations;

[0068] Figure 5 The standard curve diagram of the test strip of the present invention for detecting target gene sequences of different concentrations and T / C signal intensity ratios. DETAILED DESCRIPTION

[0069] like Figure 1 As shown, the present invention provides a nucleic acid test strip for detecting smut gene, comprising:

[0070] A base plate, on which the NC film is adhered, wherein the base plate is preferably a PVC (polyvinyl chloride) base plate;

[0071] The sample pad is attached to one side of the bottom plate, wherein the sample pad is preferably pre-treated, and the pre-treatment is preferably:

[0072] The sample pad was soaked in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose, and 1% Triton for 1 h, then dried in an oven at 60°C for 12 h, and sealed and stored for later use;

[0073] A water-absorbing pad is attached to the other side of the bottom plate;

[0074] Among them, the connection between the sample pad and the absorbent pad overlaps by 2 mm;

[0075] The NC membrane is provided with a T line (detection limit) and a C line (quality control line), the T line is close to the sample pad, the C line is close to the absorbent pad, and the T line is sprayed with a conjugate of a capture probe and streptavidin (SA); the 3' end of the capture probe is labeled with biotin;

[0076] The C line is sprayed with a conjugate of a control probe and streptavidin; the 5' end of the control probe is labeled with biotin; the control probe is complementary to the DNA sequence of the DNA1-AgInS2 / ZnS fluorescent probe (DNA1-AgInS2 / ZnSprobe);

[0077] The nucleotide sequence of the capture probe is TGGAGACGTAGG, and the nucleotide sequence of the quality control probe is ACTAACTTACGG;

[0078] The nucleotide sequence of DNA1 in the DNA1-AgInS2 / ZnS fluorescent probe is CCGTAAGTTAGT.

[0079] In order to fix the probes on the T line and the C line on the NC membrane, streptavidin was selected as an intermediate, and the capture probe and the quality control probe labeled with biotin were incubated with streptavidin respectively.

[0080] Use a dispensing machine (preferably with a flow rate of 30 μL / s) to draw the prepared solution on the T line and C line areas of the NC membrane respectively, dry (preferably dry at 37°C for 12 h), cut it into test strips with a strip cutter (preferably cut into test strips with a width of 4 mm), and seal and store it for future use (preferably seal and store it at 4°C for future use).

[0081] In the present invention, the preparation method of the DNA1-AgInS2 / ZnS fluorescent probe comprises the following steps:

[0082] Step (1), mixing the AgInS2 / ZnS quantum dots with a PBS buffer solution containing EDC and NHS and activating the mixture to obtain activated AgInS2 / ZnS;

[0083] Step (2), mixing the activated AgInS2 / ZnS with DNA1 and vortexing at room temperature;

[0084] Step (3), adding BSA thereto, vortexing at room temperature, performing a sealing treatment, and finally obtaining a DNA1-AgInS2 / ZnS fluorescent probe.

[0085] The preparation method of the DNA1-AgInS2 / ZnS fluorescent probe is specifically as follows:

[0086] Step (1), mixing 1-5 μL of AgInS2 / ZnS quantum dots with 20-50 μL of PBS buffer containing 10-20 mM EDC and NHS, and activating the mixture by shaking on a shaker at 37°C for 0.5-2 h to obtain activated AgInS2 / ZnS;

[0087] Step (2), mixing the activated AgInS2 / ZnS with DNA1, and vortexing for 1-4h at room temperature;

[0088] Step (3), adding 30-50 μL of 0.5-5% BSA, vortexing for 0.5-3 h at room temperature, and performing a blocking treatment to finally obtain a DNA1-AgInS2 / ZnS fluorescent probe.

[0089] In the present invention, the preparation method of the AgInS2 / ZnS quantum dots comprises the following steps:

[0090] Step (11), adding water, silver nitrate, thioglycolic acid, and ammonium hydroxide into a volumetric flask, stirring evenly to obtain a first mixed solution;

[0091] Step (12), adding InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0092] Step (13), adding Na2S·9H2O to the second mixed solution to obtain a third mixed solution, and heating the mixture;

[0093] Step (14), adding thioglycolic acid and Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat to form a ZnS shell;

[0094] Step (15), after rotary evaporation of the fourth mixed solution, add isopropanol to induce quantum dot aggregation, then centrifuge, add isopropanol again, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in water, and store it in a dark environment.

[0095] The preparation method of the AgInS2 / ZnS quantum dots is specifically as follows:

[0096] Step (11), add 90-120 mL of water, 1-3 mL of 0.5-3 M silver nitrate, 2-3 mL of 0.5-3 M thioglycolic acid, and 0.5-2 mL of 3-6 M ammonium hydroxide into a volumetric flask, stir evenly, and obtain a first mixed solution;

[0097] Step (12), adding 0.5-1 mL of 1-3 M InCl3·4H2O to the first mixed solution to obtain a second mixed solution;

[0098] Step (13), adding 0.5-3 mL of 1-3 M Na2S·9H2O to the second mixed solution to obtain a third mixed solution, heating the mixture to 90-95° C. for 30-60 min;

[0099] Step (14), adding 0.5-3 mL of 0.5-3 M thioglycolic acid and 0.5-3 mL of 0.5-3 M Zn(CH3COO)2 to the third mixed solution and stirring vigorously to obtain a fourth mixed solution, and continuing heating for 30-60 min to form a ZnS shell;

[0100] Step (15), after the fourth mixed solution is rotary evaporated at 30-60° C. until the final volume is 10-20 mL, 2-5 mL of isopropanol is added to induce quantum dot aggregation, and then centrifuged at 4500 rpm for 5-10 min, isopropanol is added, and the same steps are repeated twice to collect the precipitate, and the collected precipitate is dissolved in 0.5-3 mL of water and stored in a dark environment at 4° C.

[0101] In the present invention, the method for preparing the conjugate of the capture probe and streptavidin comprises the following steps:

[0102] The capture probe and the streptavidin aqueous solution are mixed, incubated, and coupled to obtain:

[0103] Mix 30-60 μL of 10-15 μM capture probe and 40-60 μL of 2-6 mg / mL streptavidin aqueous solution, incubate in a refrigerator at 4° C. for 1-3 h for coupling, and obtain a coupling reaction solution;

[0104] The method for preparing the conjugate of the quality control probe and streptavidin comprises the following steps:

[0105] The quality control probe and the streptavidin aqueous solution are mixed and incubated for coupling to obtain:

[0106] Mix 30-60 μL of 10-15 μM quality control probe and 40-60 μL of 2-6 mg / mL streptavidin aqueous solution, incubate in a refrigerator at 4° C. for 1-3 h for coupling, and obtain a coupling reaction solution.

[0107] On the other hand, the present invention also provides a method for detecting smut genes, using the above-mentioned nucleic acid test strip for detecting smut genes for detection, comprising the following steps:

[0108] The DNA amplification solution containing the target and the mixed solution of the DNA1-AgInS2 / ZnS fluorescent probe are dropped onto the T line and the C line respectively. If the T line is colored, it is a positive result, and if the T line is not colored, it is a negative result.

[0109] In the present invention, the method for preparing the DNA amplification solution comprises the following steps:

[0110] Preparation of a logic device: after mixing the S chain and the N chain, heating, cooling, obtaining the SN double chain, incubating the magnetic beads and the SN double chain to obtain the a logic device;

[0111] Among them, the nucleotide sequence of the S chain is:

[0112] ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAA AA;

[0113] The nucleotide sequence of the N strand is: GGTTCATCAACGAGTCGATGGAAGGTGT;

[0114] Preparation of b logic device: R, P, Q chains are mixed, heated, and cooled to obtain RPQ double chains, and magnetic beads and RPQ are incubated to obtain b logic device;

[0115] Among them, the nucleotide sequence of the R chain is: CCTACGTCTCCAACTAACTTACGG;

[0116] The nucleotide sequence of the P strand is:

[0117] AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC;

[0118] The nucleotide sequence of the Q strand is:

[0119] CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG;

[0120] Preparation of c-logic device: heating and cooling the F chain, incubating the magnetic beads and the F chain to obtain the c-logic device;

[0121] Among them, the nucleotide sequence of the F chain is:

[0122] AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG;

[0123] The target object and logic devices a, b, and c are mixed and incubated, and the DNA amplification solution is obtained after magnetic separation of the solution.

[0124] Preferably, when preparing the a-logic device, the molar ratio of the S chain to the N chain is 1:1;

[0125] When preparing the b-logic device, the molar ratio of the R, P, and Q chains is 1:1:1.

[0126] In the present invention, the preparation of the a logic device is as follows: the S chain and the N chain are mixed, heated to 80-95°C (, maintained for 5-15 minutes, and then naturally cooled to room temperature to obtain a SN double chain, and the magnetic beads and the SN double chain are shaken and incubated on a shaker for 1-4 hours to obtain an a logic device;

[0127] Preparation of b logic device: R, P, Q chains were mixed, heated to 80-95°C, maintained for 5-15 min, and then naturally cooled to room temperature to obtain RPQ double chains, and the magnetic beads and RPQ were shaken and incubated on a shaker for 1-4 h to obtain b logic device;

[0128] Preparation of c-logic: Heat the F chain to 80-95°C, maintain for 5-15 minutes, then cool naturally to room temperature, incubate the magnetic beads and F chain on a shaker for 1-4 hours to obtain the c-logic.

[0129] The above nucleotide sequence is shown in Table 1:

[0130] Table 1 Nucleotide sequence table

[0131]

[0132] The technical solution of the present invention is explained in detail below in conjunction with specific embodiments.

[0133] Example 1

[0134] 1. Preparation of a test strip for detecting sugarcane smut, comprising the following steps:

[0135] 1. Sample pad pretreatment

[0136] The sample pad was soaked in a mixed solution of 1% NaCl, 0.5% Tween, 1% BSA, 2% sucrose, and 1% Triton for 1 h, then dried in an oven at 60° C. for 12 h, and sealed and stored for later use.

[0137] 2. Preparation of test strips

[0138] Paste the NC membrane (no pretreatment required) onto the PVC base plate, with the absorbent pad on one side of the NC membrane and the treated sample pad on the other side, with each part overlapping by 2 mm. The T line and C line are located between the sample pad and the absorbent pad, with the T line close to the sample pad and the C line close to the absorbent pad. Figure 1 shown.

[0139] (1) In order to fix the probes on the T line and C line on the NC membrane, streptavidin was selected as an intermediate, and 50 μL of 12 μM biotin-labeled capture probe and quality control line probe were incubated with 50 μL of 4 mg / mL streptavidin at 4°C for 1 h.

[0140] (2) Use a dispensing machine (flow rate of 30 μL / s) to draw the prepared solution on the T-line and C-line areas of the NC membrane respectively. After drying at 37°C for 12 h, use a strip cutter to cut into test strips with a width of 4 mm, seal them and store them at 4°C for later use.

[0141] 3. Preparation of AgInS2 / ZnS QDs

[0142] (1) Add 96 mL of water to a volumetric flask, and add 1.0 mL of 0.1 M silver nitrate, 2.0 mL of 1.0 M thioglycolic acid, and 0.65 mL of 5.0 M ammonium hydroxide while stirring.

[0143] (2) After stirring evenly, add 0.7 mL of 1.0 M InCl3·4H2O (dissolved in 0.2 M nitric acid).

[0144] (3) Add 1 mL of 1.0 M Na2S·9H2O to the above solution, continue stirring, and heat the solution to 95°C for 30 min.

[0145] (4) After adding 1.0 mL of 1.0 M thioglycolic acid and 1.0 mL of 1.0 M Zn(CH3COO)2 (dissolved in 0.01 M nitric acid) and stirring vigorously, the resulting solution was heated for 30 min to form a ZnS shell.

[0146] (5) The above solution was rotary evaporated at 40°C until the final volume was 10 mL. 2.5 mL of isopropanol was added thereto to induce quantum dot aggregation, and then centrifuged at 4500 rpm for 5 min.

[0147] (6) Add a small amount of isopropanol and repeat the same steps twice to collect the precipitate. Finally, dissolve the collected precipitate in 1 mL of water and store it in a dark environment at 4°C.

[0148] 4. Preparation of DNA1-AgInS2 / ZnS QDs

[0149] (1) 3 μL AgInS2 / ZnS QDs were mixed with 37 μL PBS containing 10 mM EDC and 20 mM NHS and activated at 37 °C for 1 h.

[0150] (2) The activated AgInS2 / ZnS QDs were mixed with DNA1 and vortexed at room temperature for 2 h.

[0151] (3) Add 30 μL 1% BSA and mediate at room temperature for 1 hour to seal the material and obtain DNA1-AgInS2 / ZnSQDs.

[0152] 5. Preparation of DNA Amplification Solution

[0153] (1) Preparation of a logic device: After mixing the S chain and the N chain in a ratio of 1:1, heat to 95°C for 5 min, and then cool naturally to room temperature to obtain a SN double chain. Incubate the magnetic beads and the SN double chain on a shaker for 2 h to obtain a logic device;

[0154] (2) Preparation of b-logic device: R, P, and Q chains were mixed in a ratio of 1:1:1, heated to 95°C, maintained for 5 min, and then naturally cooled to room temperature to obtain RPQ double chains. The magnetic beads and RPQ were incubated on a shaker for 2 h to obtain b-logic device;

[0155] (3) Preparation of c-logic device: heat the F chain to 95°C for 5 min, then cool naturally to room temperature, and incubate the magnetic beads and F chain on a shaker for 2 h to obtain the c-logic device;

[0156] 6. Detection method

[0157] (1) Mix different concentrations of the target and the prepared 6 μL a logic device, 20 μL b logic device, and 20 μL c logic device, and then shake and incubate for 3.5 h. After magnetic separation of the solution, 50 μL supernatant (DNA amplification solution) is obtained;

[0158] (2) Mix the supernatant obtained in step (1) and 15 μL of DNA1-AgInS2 / ZnS QDs probe and incubate at 37°C for 1 h;

[0159] (3) Drop 65 μL of the mixed solution onto the sample pad and drive it onto the absorption pad through capillary action. Through complementary base pairing, the DNA1-AgInS2 / ZnS QDs amplified chain can be captured by the detection probe on the test line. Excess DNA1-AgInS2 / ZnS QDs are captured by the quality control probe on the quality control line, so two red bands can be produced. Wait for about 5-20 minutes, and then add 100 μL of 5% Tween rinse. Reduce the background color, and the test line and quality control line will be clearer.

[0160] (4) Insert the test strip into the fluorescent immunoassay analyzer to read the signal intensity of the test line / quality control line to obtain the quantitative analysis of the sugarcane smut gene.

[0161] 2. Use of the test strip of the present invention for detection of sugarcane smut gene

[0162] 1. Construction principle of test strips for sugarcane smut gene

[0163] like Figure 2 As shown in the A part: through the entropy-driven principle, the addition of sugarcane smut gene primers (such as Target1 and Target2 in Table 1) will trigger the a logic device to release the N chain, and the N chain will complement the P chain base of the b logic device to trigger the b logic device; the NPR double chain obtained from the b logic device can trigger the c logic device, and the c logic device will release the R and N chains after completing its work, and the N chain can continue to participate in the cyclic reaction, thereby amplifying more R chains.

[0164] like Figure 2 As shown in part B: After magnetic separation of part A, the supernatant was aspirated, the supernatant was incubated with the DNA1-AgInS2 / ZnSQDs probe on a shaker for 1 hour, and then dropped onto the test strip.

[0165] T-line color development principle: The T-line is fixed with a capture probe that can specifically identify the R chain. The amplified R chain bases can bind to the DNA1 of the DNA1-AgInS2 / ZnS QDs probe through base complementary pairing. When the formed complex flows to the T-line with the liquid, it can also complementarily pair with the capture probe on the T-line, thereby being captured by the capture probe on the T-line and aggregating and coloring at the T-line, indicating the presence of the target in the sample;

[0166] Principle of C-line color development: Quality control probes that are complementary to the DNA1-AgInS2 / ZnS QDs probes are fixed at the C-line. Even if there is no target in the sample, these DNA1-AgInS2 / ZnS QDs probes will flow to the C-line with the liquid and be captured by the quality control probes on the C-line, causing the C-line to develop color. The surface test strip functions normally and the detection process is effective.

[0167] like Figure 2 As shown in the C part of the figure: the logic amplification initiated by the double primers, when the sugarcane smut specific gene primers are not added, the amplification reaction cannot proceed, and only the C line is colored on the test strip. The test results are as follows Figure 3 When only one of the gene primers (Target1 or Target2) is added, the amplification reaction cannot proceed, and only line C is colored on the test strip. The test results are as follows: Figure 3 Only when the two primers are present at the same time, the T and C lines of the test strip will show color at the same time. The test results are as follows: Figure 3 Section D of the .

[0168] 2. Test strip detection

[0169] The test strip is loaded into the cartridge and inserted into the fluorescence analyzer to read the data. The fluorescence intensity of the T and C lines can be quickly read. In order to eliminate the errors caused by the differences in the samples to be tested and the differences in the batches and processing of the test strips, we choose to use the ratio of the fluorescence intensity of the T line to the fluorescence intensity of the C line (T / C value) as the parameter for the content of the target analyte to be tested for the quantitative detection of the smut-specific gene primers. According to the read values, a linear regression equation is established with the logarithm of the smut gene concentration as the horizontal axis and the T / C ratio as the vertical axis, thereby completing the quantitative analysis of sugarcane smut. Figure 4 and Figure 5 As shown in Figure 2, the T / C signal ratio is related to the sugarcane smut gene concentration at 10 -15 -10 -6 There is a good linear relationship within the range of M, and the linear regression equation is T / CValue=0.126lg C Target / M+2.019(R 2 =0.992, M = mol / L), and the detection limit was 289aM (S / N = 3).

Claims

1. A nucleic acid test strip for detecting smut gene, characterized in that: include: A base plate, on which an NC film is adhered; A sample pad is adhered to one side of the bottom plate; A water-absorbing pad is attached to the other side of the bottom plate; The NC membrane is provided with a T line and a C line, the T line is close to the sample pad, the C line is close to the water absorbent pad, and the T line is sprayed with a conjugate of a capture probe and streptavidin; the 3' end of the capture probe is labeled with biotin; The C line is sprayed with a conjugate of a quality control probe and streptavidin; the 5' end of the quality control probe is labeled with biotin; the quality control probe is complementary to the DNA sequence of the DNA1-AgInS2 / ZnS fluorescent probe; The nucleotide sequence of the capture probe is TGGAGACGTAGG, and the nucleotide sequence of the quality control probe is ACTAACTTACGG; The nucleotide sequence of DNA1 in the DNA1-AgInS2 / ZnS fluorescent probe is CCGTAAGTTAGT.

2. A nucleic acid test strip for detecting smut gene according to claim 1, characterized in that: The preparation method of the DNA1-AgInS2 / ZnS fluorescent probe comprises the following steps: Step (1), mixing the AgInS2 / ZnS quantum dots with a PBS buffer solution containing EDC and NHS and activating the mixture to obtain activated AgInS2 / ZnS; Step (2), mixing the activated AgInS2 / ZnS with DNA1 and vortexing at room temperature; Step (3), adding BSA thereto, vortexing at room temperature, performing a sealing treatment, and finally obtaining a DNA1-AgInS2 / ZnS fluorescent probe.

3. A nucleic acid test strip for detecting smut gene according to claim 2, characterized in that: The preparation method of the DNA1-AgInS2 / ZnS fluorescent probe is specifically as follows: Step (1), activating 1-5 μL of AgInS2 / ZnS quantum dots with 20-50 μL of PBS buffer containing 10-20 mM EDC and NHS to obtain activated AgInS2 / ZnS; Step (2), mixing the activated AgInS2 / ZnS with DNA1, and vortexing for 1-4h at room temperature; Step (3), adding 30-50 μL of 0.5-5% BSA, vortexing for 0.5-3 h at room temperature, and performing a blocking treatment to finally obtain a DNA1-AgInS2 / ZnS fluorescent probe.

4. A nucleic acid test strip for detecting smut gene according to claim 2, characterized in that: The preparation method of the AgInS2 / ZnS quantum dots comprises the following steps: Step (11), adding water, silver nitrate, thioglycolic acid, and ammonium hydroxide into a volumetric flask, stirring evenly to obtain a first mixed solution; Step (12), adding InCl3·4H2O to the first mixed solution to obtain a second mixed solution; Step (13), adding Na2S·9H2O to the second mixed solution to obtain a third mixed solution, and heating the mixture; Step (14), adding thioglycolic acid and Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat to form a ZnS shell; Step (15), after rotary evaporation of the fourth mixed solution, add isopropanol to induce quantum dot aggregation, then centrifuge, add isopropanol again, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in water, and store it in a dark environment.

5. A nucleic acid test strip for detecting smut gene according to claim 4, characterized in that: The preparation method of the AgInS2 / ZnS quantum dots is specifically as follows: Step (11), add 90-120 mL of water, 1-3 mL of 0.5-3 M silver nitrate, 2-3 mL of 0.5-3 M thioglycolic acid, and 0.5-2 mL of 3-6 M ammonium hydroxide into a volumetric flask, stir evenly, and obtain a first mixed solution; Step (12), adding 0.5-1 mL of 1-3 M InCl3·4H2O to the first mixed solution to obtain a second mixed solution; Step (13), adding 0.5-3 mL of 1-3 M Na2S·9H2O to the second mixed solution to obtain a third mixed solution, heating the mixture to 90-95° C. for 30-60 min; Step (14), adding 0.5-3 mL of 0.5-3 M thioglycolic acid and 0.5-3 mL of 0.5-3 M Zn(CH3COO)2 to the third mixed solution to obtain a fourth mixed solution, and continuing to heat for 30-60 min to form a ZnS shell; Step (15), after rotary evaporating the fourth mixed solution at 30-60° C., add 2-5 mL of isopropanol to induce quantum dot aggregation, then centrifuge at 4500 rpm for 5-10 min, add isopropanol, repeat the same steps twice to collect the precipitate, dissolve the collected precipitate in 0.5-3 mL of water, and store in a dark environment.

6. A nucleic acid test strip for detecting smut gene according to any one of claims 1 to 5, characterized in that: The preparation method of the conjugate of the capture probe and streptavidin comprises the following steps: The capture probe and the streptavidin aqueous solution are mixed, incubated, and coupled to obtain; The method for preparing the conjugate of the quality control probe and streptavidin comprises the following steps: The quality control probe and the streptavidin aqueous solution are mixed and incubated for coupling to obtain the product.

7. A method for detecting smut gene, characterized in that: Detection using the nucleic acid test strip for detecting smut gene according to any one of claims 1 to 6 comprises the following steps: The DNA amplification solution containing the target and the mixed solution of the DNA1-AgInS2 / ZnS fluorescent probe are dropped onto the T line and the C line respectively. If the T line is colored, it is a positive result, and if the T line is not colored, it is a negative result.

8. The method for detecting a smut gene according to claim 7, characterized in that: The method for preparing the DNA amplification solution comprises the following steps: Preparation of a logic device: after mixing the S chain and the N chain, heating, cooling, obtaining the SN double chain, incubating the magnetic beads and the SN double chain to obtain the a logic device; Among them, the nucleotide sequence of the S chain is: ACACCTTCCATCGACAGCACGTTGATGAACCAGAGCGAAAAAAAAAA AA; The nucleotide sequence of the N strand is: GGTTCATCAACGAGTCGATGGAAGGTGT; Preparation of b logic device: R, P, Q chains are mixed, heated, and cooled to obtain RPQ double chains, and magnetic beads and RPQ are incubated to obtain b logic device; Among them, the nucleotide sequence of the R chain is: CCTACGTCTCCAACTAACTTACGG; The nucleotide sequence of the P strand is: AAAAAAAAAAAAAAACCCAGGTTCATCAACGAGTC; The nucleotide sequence of the Q strand is: CCTTCCATCGACTCGTTGATGAACCTGGGCCGTAAGTTAGTTGGAGAC GTAGG; Preparation of c-logic device: heating and cooling the F chain, incubating the magnetic beads and the F chain to obtain the c-logic device; Among them, the nucleotide sequence of the F chain is: AAAAAAAAACCTACGTCTCCAACTAACTTACGGCCCAGGTTCATCAA CGAGTCG; The target object and logic devices a, b, and c are mixed and incubated, and the DNA amplification solution is obtained after magnetic separation of the solution.

9. A method for detecting smut gene according to claim 8, characterized in that: When preparing a logic device, the molar ratio of S chain to N chain is 1:1; When preparing the b-logic device, the molar ratio of the R, P, and Q chains is 1:1:

1.

10. A method for detecting smut gene according to claims 8-9, characterized in that: Preparation of a logic device: After mixing the S chain and the N chain, heat to 80-95°C, keep for 5-15 minutes, and then cool naturally to room temperature to obtain SN double chains, and incubate the magnetic beads and SN double chains on a shaker for 1-4 hours to obtain a logic device; Preparation of b logic device: R, P, Q chains were mixed, heated to 80-95°C, maintained for 5-15 min, and then naturally cooled to room temperature to obtain RPQ double chains, and the magnetic beads and RPQ were shaken and incubated on a shaker for 1-4 h to obtain b logic device; Preparation of c-logic: Heat the F chain to 80-95°C, maintain for 5-15 minutes, then cool naturally to room temperature, incubate the magnetic beads and F chain on a shaker for 1-4 hours to obtain the c-logic.

Images