Tumor specific exosome adsorbent, immunoadsorption column and immunoadsorption device

Abstract

The invention belongs to the technical field of medical instruments, and particularly relates to a tumor specific exosome adsorbent, an immunoadsorption column and an immunoadsorption device. According to the tumor-specific exosome adsorbent provided by the invention, the molecular sieve adsorption effect of the super-macroporous polymer microspheres in the tumor-specific exosome adsorbent, the affinity adsorption effect of the anti-PD-L1 nano-antibody, and the promotion of the coupling of the anti-PD-L1 nano-antibody and the improvement of the capturing ability of the anti-PD-L1 nano-antibody of the self-assembled polypeptide are mutually cooperated; the adsorption and purification effects on tumor specific exosomes can be greatly improved; meanwhile, the super-macroporous polymer microspheres with specific pore diameters and the anti-PD-L1 nano antibody connected in series are selected, so that the adsorption and purification effects of the tumor specific exosome can be further improved, and the technical problem that a high-performance adsorbent is lacked in the prior art is solved.

Description

Technical Field

[0001] The present application belongs to the field of medical device technology, and in particular relates to a tumor-specific exosome adsorbent, an immunoadsorption column, and an immunoadsorption device. Background Art

[0002] Currently, surgery, radiotherapy and chemotherapy are commonly used to treat malignant tumors. Surgical treatment carries the risk of surgical complexity, postoperative infection, bleeding and other surgical and postoperative complications. Radiotherapy and chemotherapy using radioactive or chemical agents, in addition to killing malignant tumor cells, can also damage normal cells, easily causing nausea, vomiting, hair loss, indigestion, bone marrow suppression, liver and kidney damage and other adverse reactions.

[0003] Different from traditional treatments such as surgery, radiotherapy and chemotherapy, tumor immunotherapy is to activate or enhance the body's immune response and use the body's own immune system to identify, attack and eliminate malignant tumor cells, thereby achieving the purpose of curing or controlling malignant tumors. However, at present, tumor immunotherapy mainly focuses on the research of immune cells, while ignoring the treatment of substances that suppress immunity during the occurrence of tumors. Exosomes are small vesicles secreted by cells that can circulate in body fluids. Exosomes carry cellular proteins, lipids and nucleic acids, can interact with other cells, and transmit information and substances. Exosomes are considered to be an important medium for cell-to-cell communication and are involved in a variety of physiological and pathological processes. Malignant tumors Tumors also secrete exosomes. The exosomes secreted by malignant tumors can mediate the occurrence and development of tumors through the responsible network of the tumor microenvironment (TME), affecting the growth, invasion, metastasis and treatment response of tumors. For example, exosomes secreted by breast cancer cells can inhibit ZEB1 and ZEB2 of target cells through the miR-200 family members they carry, thereby inducing the occurrence of epithelial-mesenchymal transition EMT4. The rapid metastasis of exosomes in tumors is also manifested in their participation in the formation of blood vessels. Tumor cells in hypoxic areas will release exosomes containing angiogenic factors such as VEGF, PDGF, and FGF, which stimulate the proliferation and migration of surrounding endothelial cells, promote tumor angiogenesis, and thus promote tumor invasion and metastasis.

[0004] Malignant tumors secrete exosomes containing PD-L1. Exosomes containing PD-L1 are transmitted to distant lymph nodes or other immune organs through the blood or lymphatic system, and bind to PD-1 on the surface of immune cells such as T cells, inhibiting the activation and proliferation of immune cells, inhibiting the immune response, and allowing tumor cells to escape immune attacks. Exosomes containing PD-L1 secreted by malignant tumors are immune-suppressing substances. Purifying exosomes containing PD-L1 in tumor patients will help improve the efficacy of immunotherapy.

[0005] Blood purification therapy has achieved good clinical treatment effects in rheumatic diseases, allergic diseases, nephritis and other diseases; immunoadsorption is a type of blood purification therapy and belongs to extracorporeal blood purification technology. Immunoadsorption uses peristaltic pumps, drainage tubes and other drainage components in the immunoadsorption device to introduce blood into an adsorption column filled with adsorbents. Relying on the adsorbents on the adsorption columns (such as antibodies, antigens or ligands with specific affinity for target molecules), specific substances in the blood can be removed in a targeted manner, such as inflammatory factors, free radicals, immune complexes, tumor markers, etc., without affecting the beneficial components in the blood, such as albumin, coagulation factors, etc.; however, there are currently few studies on the purification of exosomes containing PD-L1 in tumor patients, and there is a lack of high-performance adsorbents, which is not conducive to improving the efficacy of immunotherapy. Summary of the invention

[0006] In view of this, the present application provides a tumor-specific exosome adsorbent, an immunoadsorption column and an immunoadsorption device to solve the technical problem of the lack of high-performance adsorbents in the prior art.

[0007] In a first aspect, the present application provides a tumor-specific exosome adsorbent, comprising ultra-macroporous polymer microspheres coated with self-assembling polypeptides and anti-PD-L1 nanoantibodies;

[0008] The ultra-macroporous polymer microspheres coated with self-assembling polypeptides are coupled to the anti-PD-L1 nanobody.

[0009] Preferably, the pore size of the supermacroporous polymer microspheres is 180-600 nm.

[0010] Preferably, the pore size of the supermacroporous polymer microspheres is 280-350 nm.

[0011] Preferably, the ultra-macroporous polymer microspheres are at least one selected from polystyrene microspheres, polymethyl methacrylate microspheres, agarose microspheres, chitosan microspheres, cellulose microspheres, and dextran microspheres.

[0012] Preferably, the self-assembling polypeptide is selected from at least one of ion-complementary polypeptides, surfactant polypeptides, and chemical group-modified polypeptides.

[0013] Preferably, the amino acid sequence KFKFEFEFKFKC of the self-assembling polypeptide is: Lys-Phe-Lys-Phe-Glu-Phe-Glu-Phe-Lys-Phe--Lys-Cys; as shown in SEQ ID No.1.

[0014] Preferably, the amino acid sequence KFKFEFSDVK of the self-assembling polypeptide is: Lys-Phe-Lys-Phe-Glu-Phe-Ser-Asp-Val-Lys-Phe; as shown in SEQ ID No.2.

[0015] Preferably, the amino acid sequence KFKFEFHKWKC of the self-assembling polypeptide is: Lys-Phe-Lys-Phe-Glu-Phe-His-Lys-Trp-Lys-Cys as shown in SEQ ID No.3.

[0016] Preferably, the anti-PD-L1 Nanobody is selected from a single anti-PD-L1 Nanobody or at least two anti-PD-L1 Nanobodies in series.

[0017] Preferably, the anti-PD-L1 nanobody is selected from three anti-PD-L1 nanobodies in series.

[0018] Preferably, the nucleotide sequence of the anti-PD-L1 Nanobody is CCATGGTGCAGCTGCAGGAAAGCGGCGGCGGCAGCGTGCAGGCGGGCGGCAGCCTGCGCCTGAGCTGCGCGGCGAGCCGCTTTACCGCGAGCATGGGCTGGTTTCGCCAGGCGCCGGGCAAAGAACGCGAAGGCATTGCGACCGTGAGCGGCGCGGCGAGCACCAACTATGCGGATAGCGTGCGCGGCCGCTTTACATTAGCAAA GATAACGCGAAAAACACCCTGTATCTGCAGATTAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGCGCGGCGAGCAGCACCAGCACCTATGCGTATTATTGCGCGGCGCGCGATAACTATTATGCGTTTCTGAGCCGCGGCGCGCCGATTTTCGCTATTGGGGCCAGGGCACCCAGGTGACCGTGAGCAGCCACCACCACCACCACCACTGACTCGAG; such as SEQ Shown as ID No.4.

[0019] Preferably, the connecting peptide used in series for two anti-PD-L1 nanobodies is a flexible connecting peptide or a rigid connecting peptide.

[0020] Preferably, the amino acid sequence of the flexible connecting peptide (GS)x, (GGS)x, (GGGS)x or (GGGGS)x, x=1-5 is: (Gly-Ser)x, (Gly-Gly-Ser)x, (Gly-Gly-Gly-Ser)x or (Gly-Gly-Gly-Gly-Ser)x, x=1-5.

[0021] The amino acid sequence of the rigid linking peptide is (PX)n P, where n is an integer of 2 to 10, P is proline, and X is selected from alanine, histidine, leucine, proline, threonine, glutamine, arginine or valine.

[0022] The second aspect of the present application provides an immunoadsorption column, the interior of which is filled with the tumor-specific exosome adsorbent described in the first aspect.

[0023] The third aspect of the present application provides an immunoadsorption device, comprising an immunoadsorption column and a drainage component as described in the second aspect;

[0024] The outlet of the drainage component is communicated with the inlet of the immunoadsorption column.

[0025] The fourth aspect of the present application provides an exosome diagnostic kit, comprising the tumor-specific exosome adsorbent described in the first aspect.

[0026] The fifth aspect of the present application provides an exosome separation and purification device, wherein the exosome separation and purification device is filled with the tumor-specific exosome adsorbent described in the first aspect.

[0027] In summary, the present application provides a tumor-specific exosome adsorbent, an immunoadsorption column and an immunoadsorption device; the provided tumor-specific exosome adsorbent includes ultra-macroporous polymer microspheres coated with self-assembling polypeptides and anti-PD-L1 nanoantibodies; and the ultra-macroporous polymer microspheres coated with self-assembling polypeptides and anti-PD-L1 nanoantibodies are coupled, and the molecular sieve adsorption effect of the ultra-macroporous polymer microspheres in the tumor-specific exosome adsorbent, the affinity adsorption effect of the anti-PD-L1 nanoantibody, and the self-assembling polypeptides promote the coupling of anti-PD-L1 nanoantibodies and enhance the capture ability of anti-PD-L1 nanoantibodies. The adsorption and purification effects of tumor-specific exosomes can be greatly improved, thereby solving the technical problem of the lack of high-performance adsorbents in the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 This is an electrophoresis diagram of the purified anti-PD-L1 nanoantibody in a tumor-specific exosome adsorbent provided in Example 1 of the present application. DETAILED DESCRIPTION

[0030] The present application provides a tumor-specific exosome adsorbent, an immunoadsorption column and an immunoadsorption device, which are used to solve the technical problem of the lack of high-performance adsorbents in the prior art.

[0031] The technical solution of the present application will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0032] In view of the fact that there are few studies on purifying exosomes containing PD-L1 in tumor patients and the lack of high-performance adsorbents, the present application provides a tumor-specific exosome adsorbent, which comprises ultra-macroporous polymer microspheres coated with self-assembling polypeptides on the surface and anti-PD-L1 nanoantibodies, wherein the anti-PD-L1 nanoantibodies are connected to the ultra-macroporous polymer microspheres coated with self-assembling polypeptides on the surface by coupling, and the coupling connection can improve the connection stability, and the anti-PD-L1 nanoantibodies are not easy to fall off;

[0033] At the same time, in the tumor-specific exosome adsorbent provided by the present application, the anti-PD-L1 nanoantibody can effectively and specifically identify tumor exosomes containing PD-L1, and has a strong affinity adsorption effect on tumor exosomes containing PD-L1, thereby purifying tumor-specific exosomes; at the same time, the tumor-specific exosome adsorbent provided by the present application also includes ultra-macroporous polymer microspheres coated with self-assembling polypeptides on the surface. The self-assembling polypeptides coated on the surface of the ultra-macroporous polymer microspheres can, on the one hand, effectively promote the coupling of the anti-PD-L1 nanoantibody to the ultra-large pore size microspheres, and on the other hand, the longer spacer arms expose more antigen binding sites to improve the capture ability of the anti-PD-L1 nanoantibody, thereby improving the effect of the tumor-specific exosome adsorbent in purifying tumor-specific exosomes; and in the tumor-specific exosome adsorbent provided by the present application, the solid phase carrier loaded with the self-assembling polypeptide and the anti-PD-L1 nanoantibody is an ultra-macroporous polymer microsphere, and the pore size distribution of most of the polymer microspheres is usually between 2nm and 100nm. The pore size does not match the size of tumor-specific exosomes, and the pore size is too small, making it difficult to utilize the molecular sieving effect to adsorb tumor-specific exosomes into the interior of the polymer microspheres, so that the tumor-specific exosomes specifically recognized and adsorbed by the self-assembling polypeptide and the anti-PD-L1 nanoantibody are easily covered on the surface of the polymer microspheres, which is not conducive to the adsorption and purification of tumor-specific exosomes by the self-assembling polypeptide and the anti-PD-L1 nanoantibody. In the tumor-specific exosome adsorbent provided in the present application, the selected ultra-large pore polymer microspheres match the size of the tumor-specific exosomes, and the molecular sieving effect can be utilized to adsorb tumor-specific exosomes into the interior of the polymer microspheres, avoiding the defect that tumor-specific exosomes are easily covered on the surface of the polymer microspheres, which reduces the purification effect of tumor-specific exosomes, thereby further improving the effect of the tumor-specific exosome adsorbent in purifying tumor-specific exosomes, overcoming the current lack of high-performance adsorbents, and can improve the clinical efficacy of immunotherapy, which is conducive to the promotion of immunotherapy.

[0034] Preferably, in the tumor-specific exosome adsorbent provided in the present application, the supermacroporous polymer microspheres are selected from polymer microspheres with an average pore size of 180 to 600 nm. Polymer microspheres of this size can better adsorb tumor-specific exosomes into the interior of the polymer microspheres.

[0035] Taking into account that too large polymer microspheres will affect the specific surface area of ​​the polymer microspheres and reduce the adsorption amount, the present application further prefers polymer microspheres with an average pore size of 280~350nm. On the one hand, polymer microspheres of this size can better adsorb tumor-specific exosomes into the interior of the polymer microspheres, and on the other hand, they also have a large tumor-specific exosome adsorption amount.

[0036] At the same time, in the tumor-specific exosome adsorbent provided by the present application, the type of super-macroporous polymer microspheres is selected from polymer microspheres such as polystyrene microspheres, polymethyl methacrylate microspheres, agarose microspheres, chitosan microspheres, cellulose microspheres, and dextran microspheres; wherein the polystyrene microspheres can be selected from the microspheres of the Giga PST series, and the agarose microspheres can be selected from the microspheres of the GigaAP, Giga DEAE-AP or Giga SP-AP series; and the type of self-assembling polypeptide coated on the surface of the super-macroporous polymer microspheres is selected from the self-assembling polypeptide selected from the self-assembling polypeptide selected from the self-assembling polypeptide of the ion-complementary polypeptide, the surfactant polypeptide, the chemical group-modified polypeptide, and the like. In the self-assembling polypeptide provided by the present application, (S (serine) and D (aspartic acid) are introduced to increase the formation of hydrogen bonds, enhance the stability of the self-assembly and the solubility in the aqueous phase; and H (histidine) and W (tryptophan) are added to provide good charge and hydrophobicity, enhance the self-assembly ability of the peptide and the interaction with other biological molecules.

[0037] Preferably, in the tumor-specific exosome adsorbent provided in the present application, the anti-PD-L1 nanoantibody coupled to the superporous polymer microspheres can be a single anti-PD-L1 nanoantibody or at least two anti-PD-L1 nanoantibodies connected in series. When three anti-PD-L1 nanoantibodies connected in series are coupled to the superporous polymer microspheres, the adsorption effect of the tumor-specific exosome adsorbent can be further enhanced.

[0038] Regarding the specific application of tumor-specific exosome adsorbents, the present application provides tumor-specific exosome adsorbents as filling components in immunoadsorption columns of medical devices, and further arranges the immunoadsorption columns filled with tumor-specific exosome adsorbents in medical device immunoadsorption devices, and uses drainage components such as peristaltic pumps and drainage tubes to drain blood containing tumor-specific exosomes through the outlet to the inlet of the immunoadsorption column, and uses the immunoadsorption column to purify tumor-specific exosomes.

[0039] In addition, the present application also provides a medical device exosome diagnostic kit, which is equipped with a tumor-specific exosome adsorbent to sample tumor-specific exosomes using its specific adsorption properties.

[0040] At the same time, the present application also provides a medical device exosome separation and purification device; traditional laboratories use ultrafiltration membranes, microfiltration membranes and other filter membranes or centrifuges and other equipment to separate and purify exosomes for various medical purposes, but it is difficult to separate and purify specific exosomes by means of filter membranes or centrifugation, and the resulting mixture is composed of multiple types of exosomes; the medical device exosome separation and purification device provided in the present application, because it is filled with tumor-specific exosome adsorbents, can separate and purify specific PD-L1-containing exosomes.

[0041] The following is a detailed description of a tumor-specific exosome adsorbent, an immunoadsorption column, and an immunoadsorption device provided in the present application in combination with embodiments and experimental examples.

[0042] Example 1

[0043] Example 1 of the present application provides a method for preparing a tumor-specific exosome adsorbent, the preparation method comprising: a synthesis step of an anti-PD-L1 nanobody, a modification step of a polymer microsphere, a coating step of a self-assembling polypeptide, and a coupling step of an anti-PD-L1 nanobody.

[0044] The synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No. 4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C for 45s, and coating it in a culture dish overnight; picking out a single colony for expansion culture the next day, collecting the bacterial precipitate and ultrasonically disrupting it (on for 1s, stop for 2s, working time for 20min), collecting the supernatant and filtering it with a 0.45μm polyethersulfone filter membrane, purifying the protein through a nickel column, and obtaining the expressed and purified anti-PD-L1 nanobody after elution. The expression level of the nanobody was measured to be 40mg / L, and the electrophoresis diagram is shown in the attached figure. Figure 1 shown.

[0045] The modification steps of the polymer microspheres include: taking 5 mL of Giga PST microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified Giga PST microspheres.

[0046] The coating step of the self-assembling polypeptide includes: replacing the buffer of the self-assembling polypeptide (amino acid sequence as shown in SEQ ID No. 1) with a carbonate buffer of pH=8.3, adding 10 mg / mL to the modified Giga PST microspheres, and reacting at 37°C and 120 rpm for 2 hours; after the reaction is completed, adding 10 mL of glutaraldehyde solution, reacting at 25°C and 120 rpm for 2 hours, and washing the filler with ten times the volume of purified water to wash away the residual solution, thereby obtaining Giga PST microspheres with self-assembling polypeptides coated on the surface.

[0047] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the Giga PST microspheres coated with self-assembling polypeptides and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS at a molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0048] Example 2

[0049] Example 2 of the present application provides a method for preparing a tumor-specific exosome adsorbent. The difference between the preparation method and Example 1 is that the polymer microspheres and the self-assembling polypeptide sequences are replaced; the preparation method includes: an anti-PD-L1 nanoantibody synthesis step, a polymer microsphere modification step, a self-assembling polypeptide coating step, and an anti-PD-L1 nanoantibody coupling step.

[0050] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0051] The modification steps of the polymer microspheres include: taking 5 mL of Giga DEAE-AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified GigaDEAE-AP microspheres.

[0052] The coating step of the self-assembling polypeptide includes: replacing the buffer of the self-assembling polypeptide (amino acid sequence as shown in SEQ ID No. 2) with a carbonate buffer of pH=8.3, adding 10 mg / mL to the modified Giga DEAE-AP microspheres, and reacting at 37°C and 120 rpm for 2 hours; after the reaction is completed, adding 10 mL of glutaraldehyde solution, reacting at 25°C and 120 rpm for 2 hours, and washing the filler with ten times the volume of purified water to wash away the residual solution, thereby obtaining Giga DEAE-AP microspheres with self-assembling polypeptides coated on the surface.

[0053] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the Giga DEAE-AP microspheres coated with self-assembling polypeptides and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS at a molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0054] Example 3

[0055] Example 3 of the present application provides a method for preparing a tumor-specific exosome adsorbent. The difference between the preparation method and Example 1 is that the polymer microspheres are replaced; the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of the polymer microspheres, a coating step of a self-assembling polypeptide, and a coupling step of an anti-PD-L1 nanobody.

[0056] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0057] The modification steps of the polymer microspheres include: taking 5 mL of Giga AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified Giga AP microspheres.

[0058] The coating step of the self-assembling polypeptide includes: replacing the buffer of the self-assembling polypeptide (amino acid sequence as shown in SEQ ID No. 1) with a carbonate buffer of pH=8.3, adding 10 mg / mL to the modified Giga AP microspheres, and reacting at 37°C and 120 rpm for 2 hours; after the reaction is completed, adding 10 mL of glutaraldehyde solution, reacting at 25°C and 120 rpm for 2 hours, and washing the filler with ten times the volume of purified water to wash away the residual solution, thereby obtaining Giga AP microspheres with self-assembling polypeptides coated on the surface.

[0059] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the Giga AP microspheres coated with self-assembling polypeptides and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS at a molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0060] Example 4

[0061] Example 4 of the present application provides a method for preparing a tumor-specific exosome adsorbent. The difference between the preparation method and Example 1 is that the polymer microspheres and the self-assembling polypeptide sequences are replaced; the preparation method includes: an anti-PD-L1 nanoantibody synthesis step, a polymer microsphere modification step, a self-assembling polypeptide coating step, and an anti-PD-L1 nanoantibody coupling step.

[0062] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0063] The modification steps of the polymer microspheres include: taking 5 mL of Giga SP-AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified GigaSP-AP microspheres.

[0064] The coating step of the self-assembling polypeptide includes: replacing the buffer of the self-assembling polypeptide (amino acid sequence as shown in SEQ ID No. 3) with a carbonate buffer of pH=8.3, adding 10 mg / mL to the modified Giga SP-AP microspheres, and reacting at 37°C and 120 rpm for 2 hours; after the reaction is completed, adding 10 mL of glutaraldehyde solution, reacting at 25°C and 120 rpm for 2 hours, and washing the filler with ten times the volume of purified water to wash away the residual solution, thereby obtaining Giga SP-AP microspheres with self-assembling polypeptides coated on the surface.

[0065] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the Giga SP-AP microspheres coated with self-assembling polypeptides on the surface and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC: NHS: protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0066] Example 5

[0067] Example 5 of the present application provides a method for preparing a tumor-specific exosome adsorbent. The difference between the preparation method and Example 1 is that the polymer microspheres are replaced; the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of the polymer microspheres, a coating step of a self-assembling polypeptide, and a coupling step of an anti-PD-L1 nanobody.

[0068] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0069] The modification steps of the polymer microspheres include: taking 5 mL of PMMA microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified PMMA microspheres.

[0070] The coating step of the self-assembling polypeptide includes: replacing the buffer of the self-assembling polypeptide (amino acid sequence as shown in SEQ ID No. 1) with a carbonate buffer of pH=8.3, adding 10 mg / mL to the modified PMMA microspheres, and reacting at 37°C and 120 rpm for 2 hours; after the reaction is completed, adding 10 mL of glutaraldehyde solution, reacting at 25°C and 120 rpm for 2 hours, and washing the filler with ten times the volume of purified water to wash away the residual solution, thereby obtaining PMMA microspheres with the surface coated with the self-assembling polypeptide.

[0071] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the PMMA microspheres coated with self-assembling polypeptides and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0072] Example 6

[0073] Example 6 of the present application provides a method for preparing a tumor-specific exosome adsorbent, which is used as a comparative example of Example 1. The difference between the preparation method and Example 1 is that there is no coating step of the self-assembling polypeptide, and the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of polymer microspheres, and a coupling step of an anti-PD-L1 nanobody.

[0074] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0075] The modification steps of the polymer microspheres include: taking 5 mL of Giga PST microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified Giga PST microspheres.

[0076] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the modified Giga PST microspheres and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0077] Example 7

[0078] Example 7 of the present application provides a method for preparing a tumor-specific exosome adsorbent, which is used as a comparative example of Example 2. The difference between the preparation method and Example 2 is that there is no coating step of the self-assembling polypeptide, and the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of polymer microspheres, and a coupling step of an anti-PD-L1 nanobody.

[0079] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0080] The modification steps of the polymer microspheres include: taking 5 mL of Giga DEAE-AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified GigaDEAE-AP microspheres.

[0081] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the modified Giga DEAE-AP microspheres and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0082] Example 8

[0083] Example 8 of the present application provides a method for preparing a tumor-specific exosome adsorbent, which is used as a comparative example of Example 3. The difference between the preparation method and Example 3 is that there is no coating step of the self-assembling polypeptide, and the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of polymer microspheres, and a coupling step of an anti-PD-L1 nanobody.

[0084] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0085] The modification steps of the polymer microspheres include: taking 5 mL of Giga AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified Giga AP microspheres.

[0086] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the modified Giga AP microspheres and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, and rinsing the filler with ten times the volume of purified water to wash away the residual solution to obtain a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0087] Example 9

[0088] Example 9 of the present application provides a method for preparing a tumor-specific exosome adsorbent, which is used as a comparative example of Example 4. The difference between the preparation method and Example 4 is that there is no coating step of the self-assembling polypeptide, and the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of polymer microspheres, and a coupling step of an anti-PD-L1 nanobody.

[0089] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0090] The modification steps of the polymer microspheres include: taking 5 mL of Giga SP-AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified GigaSP-AP microspheres.

[0091] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the modified Giga SP-AP microspheres and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0092] Example 10

[0093] Example 10 of the present application provides a method for preparing a tumor-specific exosome adsorbent, which is used as a comparative example of Example 5. The difference between the preparation method and Example 5 is that there is no coating step of the self-assembling polypeptide, and the preparation method includes: a synthesis step of an anti-PD-L1 nanobody, a modification step of polymer microspheres, and a coupling step of an anti-PD-L1 nanobody.

[0094] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and spreading it on a culture dish overnight; the next day, a single colony was picked out for expansion culture, the bacterial precipitate was collected and ultrasonically disrupted (on 1s, stop 2s, working time 20min), the supernatant was collected and filtered using a 0.45μm polyethersulfone filter membrane, and the protein was purified through a nickel column. After elution, the expressed and purified anti-PD-L1 nanobody was obtained.

[0095] The modification steps of the polymer microspheres include: taking 5 mL of PMMA microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified PMMA microspheres.

[0096] The anti-PD-L1 nanoantibody coupling step includes: adding the anti-PD-L1 nanoantibody solution to the modified PMMA microspheres and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS according to the molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use.

[0097] Embodiment 11

[0098] Example 11 of the present application provides a method for preparing a tumor-specific exosome adsorbent, the preparation method comprising: a synthesis step of an anti-PD-L1 nanobody, a modification step of a polymer microsphere, a coating step of a self-assembling polypeptide, and a coupling step of an anti-PD-L1 nanobody.

[0099] Among them, the synthesis steps of the anti-PD-L1 nanobody include: connecting the nucleotide sequence shown in SEQ ID No.4 to the pET-28a plasmid by a chemical method, transforming it into Escherichia coli BL21 (DE3) for expression at 42°C and 45s, and coating it on a culture dish overnight; the next day, picking out a single colony for expansion culture, collecting the bacterial precipitate and ultrasonically disrupting it (on 1s, stop 2s, working time 20min), collecting the supernatant and filtering it with a 0.45μm polyethersulfone filter membrane, purifying the protein through a nickel column, and obtaining the expressed and purified anti-PD-L1 nanobody after elution; then, a part of the anti-PD-L1 nanobody is connected to two anti-PD-L1 nanoantibodies in series through a flexible connecting peptide with an amino acid sequence of GGS, and a part of the anti-PD-L1 nanoantibody is connected to three anti-PD-L1 nanoantibodies in series through a flexible connecting peptide with an amino acid sequence of GGGGS.

[0100] The modification steps of the polymer microspheres include: taking 5 mL of Giga DEAE-AP microspheres, adding 20 mL of 0.01 M sodium hydroxide and 3.0 mL of epichlorohydrin solution, reacting at 37° C. and 120 rpm for 1 hour, and after the reaction is completed, using ten times the volume of purified water to rinse the filler to wash away the residual solution; then adding 5 mL of 1X PBS solution, adding 5 mL of glutaraldehyde solution, reacting at 37° C. and 120 rpm for 2 hours, and then using ten times the volume of purified water to rinse the filler to wash away the residual solution to obtain modified GigaDEAE-AP microspheres.

[0101] The coating step of the self-assembling polypeptide includes: replacing the buffer of the self-assembling polypeptide (amino acid sequence as shown in SEQ ID No. 1) with a carbonate buffer of pH=8.3, adding 10 mg / mL to the modified Giga DEAE-AP microspheres, and reacting at 37°C and 120 rpm for 2 hours; after the reaction is completed, adding 10 mL of glutaraldehyde solution, reacting at 25°C and 120 rpm for 2 hours, and washing the filler with ten times the volume of purified water to wash away the residual solution, thereby obtaining Giga DEAE-AP microspheres with self-assembling polypeptides coated on the surface.

[0102] The anti-PD-L1 nanobody coupling step includes: adding the anti-PD-L1 nanobody solution to the Giga DEAE-AP microspheres coated with self-assembling polypeptides and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS at a molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining the first tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use and recorded as tumor-specific exosome sample 1.

[0103] The anti-PD-L1 nanobody coupling step includes: adding two anti-PD-L1 nanobody solutions in series to Giga DEAE-AP microspheres coated with self-assembling polypeptides on the surface and gently mixing them, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS at a molar ratio of EDC:NHS:protein of 1:1:10, mixing and reacting at room temperature for 2 hours, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a second tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use and recorded as tumor-specific exosome sample 2.

[0104] The anti-PD-L1 nanobody coupling step includes: adding an anti-PD-L1 nanobody solution of three anti-PD-L1 nanobodies in series to Giga DEAE-AP microspheres coated with self-assembling polypeptides on the surface and gently mixing, using carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for cross-linking reaction, adding EDC and NHS at a molar ratio of EDC:NHS:protein of 1:1:10, reacting at room temperature for 2 hours after mixing, rinsing the filler with ten times the volume of purified water to wash away the residual solution, and obtaining a third tumor-specific exosome adsorbent, which was stored in 20% ethanol for later use and recorded as tumor-specific exosome sample 3.

[0105] Experimental Example 1

[0106] Experimental Example 1 of the present application performs an adsorption performance test on the tumor-specific exosome adsorbent provided in Examples 1-10; the adsorption performance test includes a PD-L1 adsorption performance test and a tumor exosome adsorption performance test.

[0107] Among them, the process of PD-L1 adsorption performance test includes: using a disposable affinity chromatography column tube to load 1 mL of the tumor-specific exosome adsorbent provided in Example 1-10 and 2 mL of the PD-L1 protein solution, respectively, reacting at 28°C and 100 rpm for 1 hour, and then draining the filler; using the PD-L1 Human ProcartaPlex™ Simplex Kit to detect the change in the PD-L1 content in the supernatant before and after adsorption, and obtaining the adsorption rate of PD-L1. The adsorption rate of PD-L1 is shown in Table 1; for comparison, PD-L1 adsorption performance tests of Giga PST blank microspheres, Giga AP blank microspheres, Giga DEAE-AP blank microspheres, Giga SP-AP blank microspheres and PMMA blank microspheres were also set up.

[0108] The process of tumor exosome adsorption performance testing includes:

[0109] Blood samples from patients with lung cancer, breast cancer, and gastric cancer were taken, and plasma samples were separated after passing through a blood separator. Impurities were removed by centrifugation at 2000xg for 30 minutes at room temperature. The supernatant was taken to a new centrifuge tube, and impurities were removed again by centrifugation at 10,000xg for 30 minutes at room temperature. The supernatant was taken to a 500kD ultrafiltration tube for ultrafiltration concentration. The concentrated sample was transferred to a new centrifuge tube and 0.5 times the volume of 1XPBS was added to mix. After mixing, 0.2 times the total solution volume of the tumor-specific exosome adsorbent provided in Example 1 was added, mixed and incubated at room temperature for 10 minutes, and the mixed solution was placed in a chromatography column. After draining the liquid, 1XPBS was used for balance, PBS with pH=3.0 was added for elution, and the pH of the eluate solution was quickly adjusted to 7.4 to obtain plasma exosome solutions of patients with lung cancer, breast cancer, and gastric cancer, with a concentration of 2×10 9 Pieces / mL;

[0110] A disposable affinity chromatography column was respectively loaded with 1 mL of the tumor-specific exosome adsorbent provided in Examples 1-10 and 2 mL of plasma exosome solution from patients with lung cancer, breast cancer and gastric cancer. After reacting at 28°C and 100 rpm for 1 hour, the filler was drained to obtain; the exosome concentration in the supernatant before and after adsorption was detected by nanoparticle tracer analysis to obtain the adsorption rate of plasma exosomes from patients with lung cancer, breast cancer and gastric cancer. The adsorption rate of plasma exosomes from patients with lung cancer, breast cancer and gastric cancer is shown in Table 1; as a comparison, Giga PST blank microspheres, Giga AP blank microspheres, Giga DEAE-AP blank microspheres, GigaSP-AP blank microspheres and PMMA blank microspheres were also set up for adsorption performance tests of exosomes from plasma of patients with lung cancer, breast cancer and gastric cancer.

[0111] Table 1: Results of PD-L1 adsorption performance test and tumor exosome adsorption performance test

[0112]

[0113] From the test results shown in Table 1, it can be seen that the super-macroporous polymer microspheres such as Giga PST blank microspheres, Giga AP blank microspheres, Giga DEAE-AP blank microspheres, Giga SP-AP blank microspheres and PMMA blank microspheres have poor adsorption effects on PD-L1 and plasma exosomes from patients with lung cancer, breast cancer and gastric cancer due to the lack of affinity adsorption of self-assembled peptides and anti-PD-L1 nanoantibodies on tumor-specific exosomes. However, by utilizing the molecular sieve effect, they still have a certain adsorption effect on PD-L1 and plasma exosomes from patients with lung cancer, breast cancer and gastric cancer.

[0114] The immunoadsorbents provided in Examples 6-10 have anti-PD-L1 nanoantibodies coupled to the surface of the superporous polymer microspheres, thereby improving the adsorption and purification effects on PD-L1 and plasma exosomes of patients with lung cancer, breast cancer and gastric cancer. The immunoadsorbents provided in Examples 1-5 are pre-coated with self-assembling peptides before coupling the anti-PD-L1 nanoantibodies, and more binding sites provided by the self-assembling peptides are utilized to effectively increase the coupling rate of the anti-PD-L1 nanoantibodies to the superporous polymer microspheres. The longer spacer arms expose more antigen binding sites to improve the capture ability of the anti-PD-L1 nanoantibodies, thereby showing better adsorption and purification effects on PD-L1 and tumor exosomes.

[0115] At the same time, by comparing the superporous polymer microspheres coated with self-assembling peptides and coupled with anti-PD-L1 nanoantibodies, it can be seen that superporous polymer microspheres with different pore sizes have different adsorption and purification effects on PD-L1 and tumor exosomes. The adsorption and purification effects of superporous polymer microspheres with an average pore size of 180-250nm and 400-600nm are lower than those of superporous polymer microspheres with an average pore size of 280-350nm. This is because the pore size is too small, which is not conducive to the molecular sieve effect to adsorb PD-L1 and tumor-specific exosomes to the polymer. The inside of the material microspheres and the surface covered reduce the adsorption and purification effects of the polymer microspheres; the large pore size leads to a decrease in the specific surface area of ​​the polymer microspheres and limited internal space, which reduces the adsorption of PD-L1 and tumor-specific exosomes, reducing the adsorption and purification effects of the polymer microspheres; the ultra-large porous polymer microspheres with an average pore size of 280-350nm can, on the one hand, better adsorb tumor-specific exosomes into the interior of the polymer microspheres, and on the other hand, have a larger tumor-specific exosome adsorption capacity, thereby having better adsorption and purification effects.

[0116] Experimental Example 2

[0117] Experimental Example 2 of the present application conducted an adsorption performance test on the tumor-specific exosome adsorbent provided in Example 11; the adsorption performance test included a PD-L1 adsorption performance test and a tumor exosome adsorption performance test.

[0118] The process of testing the PD-L1 adsorption performance includes: using a disposable affinity chromatography column tube to respectively load 1 mL of the tumor-specific exosome adsorbent sample 1-3 provided in Example 11 and 2 mL of the PD-L1 protein solution, reacting at 28°C and 100 rpm for 1 hour, and then draining the filler; using the PD-L1 Human ProcartaPlex™ Simplex Kit to detect the change in the PD-L1 content in the supernatant before and after adsorption to obtain the adsorption rate of PD-L1. The adsorption rate of PD-L1 is shown in Table 2.

[0119] The process of tumor exosome adsorption performance testing includes:

[0120] Blood samples from patients with lung cancer, breast cancer, and gastric cancer were taken, and plasma samples were separated after passing through a blood separator. Impurities were removed by centrifugation at 2000xg for 30 minutes at room temperature. The supernatant was taken to a new centrifuge tube, and impurities were removed again by centrifugation at 10,000xg for 30 minutes at room temperature. The supernatant was taken to a 500kD ultrafiltration tube for ultrafiltration concentration. The concentrated sample was transferred to a new centrifuge tube and 0.5 times the volume of 1XPBS was added to mix. After mixing, 0.2 times the total solution volume of the tumor-specific exosome adsorbent provided in Example 1 was added, mixed and incubated at room temperature for 10 minutes, and the mixed solution was placed in a chromatography column. After draining the liquid, 1XPBS was used for balance, PBS with pH=3.0 was added for elution, and the pH of the eluate solution was quickly adjusted to 7.4 to obtain plasma exosome solutions of patients with lung cancer, breast cancer, and gastric cancer, with a concentration of 2×10 9 Pieces / mL;

[0121] A disposable affinity chromatography column was loaded with 1 mL of the tumor-specific exosome adsorbent sample 1-3 provided in Example 11 and 2 mL of the plasma exosome solution of lung cancer, breast cancer and gastric cancer patients, respectively. After reacting at 28°C and 100 rpm for 1 hour, the filler was drained to obtain; the exosome concentration in the supernatant before and after adsorption was detected by nanoparticle tracer analysis to obtain the adsorption rate of the plasma exosomes of lung cancer, breast cancer and gastric cancer patients. The adsorption rate of the plasma exosomes of lung cancer, breast cancer and gastric cancer patients is shown in Table 2.

[0122] Table 2: Results of PD-L1 adsorption performance test and tumor exosome adsorption performance test

[0123]

[0124] As can be seen from Table 2, the coupling of two anti-PD-L1 nanoantibodies in series with superporous polymer microspheres coated with self-assembling polypeptides does not significantly improve the adsorption and purification effects of PD-L1 and tumor exosomes. However, the coupling of three anti-PD-L1 nanoantibodies in series with superporous polymer microspheres coated with self-assembling polypeptides can further enhance the adsorption effect of tumor-specific exosome adsorbents.

[0125] The above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, a person skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some or all of the technical features thereof may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A tumor-specific exosome adsorbent, characterized in that: Including ultra-macroporous polymer microspheres coated with self-assembling peptides and anti-PD-L1 nanoantibodies; The ultra-macroporous polymer microspheres coated with self-assembling polypeptides are coupled to the anti-PD-L1 nanobody.

2. A tumor-specific exosome adsorbent according to claim 1, characterized in that: The pore size of the super-macroporous polymer microspheres is 180-600 nm.

3. The tumor-specific exosome adsorbent according to claim 1, characterized in that: The pore size of the super-macroporous polymer microspheres is 280-350 nm.

4. The tumor-specific exosome adsorbent according to claim 1, characterized in that: The ultra-macroporous polymer microspheres are selected from at least one of polystyrene microspheres, polymethyl methacrylate microspheres, agarose microspheres, chitosan microspheres, cellulose microspheres, and dextran microspheres.

5. The tumor-specific exosome adsorbent according to claim 1, characterized in that: The self-assembling polypeptide is selected from at least one of ion-complementary polypeptides, surfactant polypeptides, and chemical group-modified polypeptides.

6. The tumor-specific exosome adsorbent according to claim 1, characterized in that: The anti-PD-L1 nanobody is selected from a single anti-PD-L1 nanobody, two tandem anti-PD-L1 nanobodies, three tandem anti-PD-L1 nanobodies, or three or more tandem anti-PD-L1 nanobodies.

7. An immunoadsorption column, characterized in that: The interior of the immunoadsorption column is filled with a tumor-specific exosome adsorbent according to any one of claims 1 to 6.

8. An immunoadsorption device, characterized in that: It comprises an immunoadsorption column and a drainage component as described in claim 7; the outlet of the drainage component is connected to the inlet of the immunoadsorption column.

9. An exosome diagnostic kit, characterized in that: A tumor-specific exosome adsorbent comprising any one of claims 1 to 6.

10. An exosome separation and purification device, characterized in that: The interior of the exosome separation and purification device is filled with a tumor-specific exosome adsorbent according to any one of claims 1 to 6.

Images