Target tissue capturing device and method and application of target tissue capturing device and method in construction of spatial resolution transcriptome library

Abstract

The invention discloses a target tissue capturing device and method and application of the target tissue capturing device and method in construction of a spatial resolution transcriptome library, and the method specifically comprises the steps that frozen tissue slices are placed on a slide pasted with a PDMS film, the slide is taken out and placed on a refrigeration sheet, then trace target tissue obtained by cutting the frozen tissue slices is captured through a WuTibetan steel needle, and the trace target tissue is collected into a PCR tube cover; adding a lysis solution to completely cover the target tissue, and then transcriptionally establishing a library. Rapid degradation of the frozen tissue slice is prevented through gradient cooling and a refrigeration sheet, and then the sampled original tissue slice is imaged and measured to determine the spatial position. According to the target tissue capturing device and method, the gene number of a single sample of a space transcriptome can be remarkably increased, and the accuracy rate and the success rate are higher than those of a traditional sampling technology.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and relates to a target tissue capture device and method and application thereof in constructing a spatially resolved transcriptome library. Background Art

[0002] The most critical step in single-cell transcriptomic studies is to effectively capture the single cell of interest. The capture method usually relies on converting cell clusters or tissue blocks into single-cell suspensions by mechanical or enzymatic hydrolysis, but this method will result in the loss of the spatial position of single cells. The spatial transcriptome with single-cell resolution is obtained by sequencing cells with spatial information. Microneedle-based sampling technology is similar to laser capture microdissection (LCM) technology. It is a technology that can separate specific cell populations or histological regions from tissues while retaining spatial localization information. Its development makes it possible to perform spatially resolved transcriptomic studies specifically on one or a certain type of cell in a tissue sample. Frozen sections have less RNA degradation than paraffin sections and are more suitable for spatially resolved transcriptomic studies. In addition, frozen sections have become the main method for slice preparation in current single-cell spatial transcriptomic studies because of their simplicity and the lack of fixation. Before cell lysis to obtain RNA, single-cell brain tissue samples were obtained by steel needle sampling under microscopic visualization conditions. However, currently used LCM techniques can only extract transcriptome data from a small number of cells while preserving the original spatial information, and are expensive and require high operation.

[0003] Therefore, it is necessary to develop simple and low-cost capture methods for spatially resolved transcriptome studies, and steel needle-based sampling can capture target cells at low cost and accurately while preserving structural and spatial data. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a microneedle sampling device that can achieve precise tissue sampling.

[0005] The technical problem that the present invention also solves is to provide a single-cell level frozen tissue section target capture method suitable for spatially resolved transcriptomic research. The present invention adopts the method of micro-tissue capture using Musashi steel needles, which can significantly increase the number of genes in a single sample and increase the capture accuracy to 99%.

[0006] The final technical problem to be solved by the present invention is to provide the application of the microneedle sampling device and the frozen tissue section target tissue capture method in constructing a spatially resolved transcriptome library and / or quality control and data analysis.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a target tissue capture device, which includes, from bottom to top, a base, a movable bottom plate, a refrigerated stage arranged on the movable bottom plate, a liftable sampling device fixedly arranged on one side of the base, a detachable sampling microneedle on the sampling device, the sampling microneedle is located directly above the refrigerated stage, an upright microscope with a light source is arranged above the sampling microneedle, the upright microscope is fixedly connected to the other side of the base through a lifting device, and the X-axis and Y-axis directions on the movable bottom plate are respectively provided with scales with scales and knobs for controlling its movement in the X-axis and / or Y-axis directions.

[0008] Among them, the sampling microneedles include Musashi steel needles, 32G needles, 34G needles, 4-row needles or square 4 needles.

[0009] Wherein, the inner diameter of the Musashi steel needle is 10-160 μm.

[0010] The present invention also includes the application of the microneedle sampling device in tissue section sampling.

[0011] The present invention also includes a method for capturing target tissue in frozen tissue sections, comprising the following steps:

[0012] (1) placing a frozen tissue section on a refrigerated stage of the target tissue capture device;

[0013] (2) Controlling the moving directions of the X-axis and the Y-axis by means of knobs, after determining the spatial position information (x, y) coordinates of the X-axis and the Y-axis, the liftable sampling device is moved vertically downward to physically cut and sample the target tissue; the (x, y) coordinates are (1-10 cm, 1-10 cm);

[0014] (3) After sampling to the needle tip, pipette and collect the sample onto the cap of the PCR tube.

[0015] Wherein, the thickness of the frozen tissue section described in step (1) is 10-35 μm.

[0016] Wherein, the (x, y) coordinates in step (2) are (1 cm, 1 cm), (2 cm, 2 cm) or (3 cm, 3 cm).

[0017] The present invention also includes the application of the microneedle sampling device and the frozen tissue section target tissue capture method in constructing a spatially resolved transcriptome library and / or quality control and data analysis.

[0018] The application includes dropping a single cell lysis solution onto the obtained target tissue until the target tissue is completely covered, lysing the solution at room temperature for 5-10 minutes, collecting the solution at the bottom of a PCR tube by centrifugation, and constructing a transcriptome library using the RNA solution obtained by lysis.

[0019] The transcriptome library was constructed using the Smart-seq2 library construction method.

[0020] Beneficial effects: Compared with existing spatial transcriptome sampling methods such as LCM, the advantages of the present invention are that the spatially resolved steel needle sampling method can not only significantly increase the number of genes in a single sample of the spatial transcriptome, but also has higher accuracy and success rates than traditional sampling techniques. In addition, gradient cooling of frozen sections and staining and fading with ethanol can prevent the cracking of tissue sections. The method is simple and low-cost, does not require expensive equipment or very difficult technical operations, and is easy to implement and widely used in various laboratories. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a schematic diagram of the device of the present invention.

[0022] Figure 2 This is a real picture of the actual equipment of the present invention.

[0023] Figure 3 This is a comparison chart of different needle types.

[0024] Figure 4 It is a flow chart of the spatially resolved transcriptomics method based on steel needle sampling of the present invention.

[0025] Figure 5 This is a comparison diagram of the needle tip before and after the Musashi steel needle sampling in Example 1 of the present invention.

[0026] Figure 6 This is a comparison diagram of the 32G needle before and after sampling in Example 1 of the present invention.

[0027] Figure 7 This is a comparison diagram of the 34G needle before and after sampling in Example 1 of the present invention.

[0028] Figure 8 This is a comparison diagram of the needles before and after sampling with four rows of needles in Example 1 of the present invention.

[0029] Fig. 9 This is a comparison diagram of the needles before and after the square 4-needle sampling in Example 1 of the present invention.

[0030] Fig.10 The number of genes obtained after sampling and library construction with different needle types in Example 1 of the present invention and the comparison results of LCM.

[0031] Fig.11The results of mouse GAPDH verification after sampling with different needle types in Example 1 of the present invention are shown.

[0032] Fig.12 This is the result of mouse GAPDH verification after Musashi steel needle sampling in Example 2 of the present invention.

[0033] Fig.13 It is a schematic diagram of a frozen section of mouse brain tissue after cresyl violet staining captured by Musashi steel needles in Example 2 of the present invention.

[0034] Fig.14 This is a comparison chart of the number of genes obtained by sampling with Musashi steel needles and by LCM in Example 2 of the present invention. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is described in detail below in conjunction with the accompanying drawings and embodiments.

[0036] Example 1

[0037] 1. Obtaining Mouse Brain Tissue Slices

[0038] Mice (SPF healthy male C57BL / 6J mice, 12 weeks old, weighing 23-25 ​​g, all purchased from Shanghai Yaokang Biotechnology Co., Ltd.) were anesthetized with tribromoethanol (500 mg / kg) (Sigma, USA) and then killed by cervical dissection. The brain was peeled off from the skull, and the brain sample was washed with 0.9% pre-cooled saline. The whole brain of the mouse was fixed with OCT compound (OCT embedding agent English full name: optimal cutting temperature compound, a water-soluble mixture of polyethylene glycol and polyvinyl alcohol) and quickly frozen in liquid nitrogen or dry ice. The mouse brain tissue was cut into a thickness of 15-35 μm by a freezing microtome, and then sampled using a steel needle under a microscope.

[0039] 2. Construction and sampling of microneedle sampling device

[0040] like Figure 1 and Figure 2As shown, a target tissue capture device of the present invention includes, from bottom to top, a base, a movable bottom plate, a refrigerated stage arranged on the movable bottom plate, a sampling device that can be raised and lowered is fixedly arranged on one side of the base, and a detachable sampling microneedle is arranged on the sampling device, the sampling microneedle is located directly above the refrigerated stage, and an upright microscope with a light source is arranged above the sampling microneedle, and the upright microscope is fixedly connected to the other side of the base through a lifting device, and the X-axis and Y-axis directions on the movable bottom plate are respectively provided with scales with scales and knobs for controlling its movement in the X-axis and / or Y-axis directions. The sampling microneedles include Musashi steel needles, 32G needles, 34G needles, 4-row needles or square 4 needles. The inner diameter of the Musashi steel needle is 10-160μm.

[0041] A method for capturing target tissue in frozen tissue sections comprises the following steps:

[0042] (1) placing a frozen tissue section with a thickness of 10-35 μm on a refrigerated stage of a target tissue capture device;

[0043] (2) Control the moving directions of the X-axis and the Y-axis by using knobs to determine that the spatial position information of the X-axis and the Y-axis is (1 cm, 1 cm), (2 cm, 2 cm) or (3 cm, 3 cm), respectively, and move the liftable sampling device vertically downward to perform physical cutting and sampling to obtain the target tissue;

[0044] (3) After sampling to the needle tip, pipette and collect the sample onto the cap of the PCR tube.

[0045] (4) The target tissue can be obtained by sampling with different needle types. The inner diameters of different needle types range from 10 to 160 μm. The specific parameters are shown in Table 1. The comparison results of different needle types are shown in Figure 3 .

[0046] Table 1. Comparison of different needle types

[0047]

[0048]

[0049] 3. Comparison of sampling results

[0050] (1) PCR verification;

[0051] The sampling success rate is calculated by sampling and reverse transcription to obtain cDNA for PCR amplification. Fig.11The electrophoresis bands after sampling with various needle types shown are used to judge whether the sampling is successful. Lanes 1-6 correspond to the successful sampling results of Musashi steel needle repeat 1, Musashi steel needle repeat 2, 32G needle, 34G needle, 4-row needle, and square 4-needle, respectively, and lane 7 is a blank control. The specific steps are: sample verification is performed using the mouse GAPDH internal reference (upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3'; downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3), the RNA solution obtained by cleavage is reverse transcribed, and finally the cDNA obtained by reverse transcription is subjected to PCR verification of the mouse internal reference. PCR parameters are: 98℃2min; (98℃10s; 58℃15s; 72℃20s)*30 cycles; 72℃5min. As Fig.12 Lanes 1-6 are the results of 6 repetitions of the Musashi steel needle, and lane 7 is a blank control. The electrophoresis results show that the target band of mouse GAPDH is obvious, indicating that the sample has obtained frozen mouse tissue. The statistical results of 100 repetitions of sampling are shown in Table 1. Sampling success rate = (number of samples successfully sampled / sample size). The highest is the Musashi steel needle, and its sampling success rate can reach 99%, as shown in Example 2.

[0052] (2) Observation after sampling;

[0053] The results before and after sampling using Musashi steel needle, 32G needle, 34G needle, 4-row needle, and square 4-needle needle correspond to Figures 5 to 9 All types of steel needles had no tissue samples on the needles before sampling. After sampling, the collected tissue samples were observed on the needles, and the stained tissue was more obvious. Comparison before and after sampling showed that the edge of the Musashi steel needle was the sharpest in physical cutting, and a relatively complete sampling result could be obtained. Other needles were not sharp in cutting, and were easy to collect unnecessary surrounding tissues, and the sampling success rate was relatively low (no samples were collected).

[0054] Example 2

[0055] (1) placing a 15 μm thick frozen tissue section processed in Example 1 on a glass slide with a 300 μm thick PDMS film attached;

[0056] (2) After being taken out, the sample was placed on a refrigeration stage of the microneedle sampling device of Example 1 equipped with a refrigeration sheet to cool down to 4 degrees;

[0057] (3) The moving directions of the X-axis and the Y-axis are controlled by the knobs, and the spatial position information of the X-axis and the Y-axis is determined to be (2 cm, 2 cm). The inner diameter of the liftable sampling device is 100 μm, and the Musashi steel is vertically cut downward to obtain the target tissue; then the sample is blown onto the PCR tube cap; before sampling, the needle tip can be observed under a microscope. Figure 5On the left, after sampling, the needle tip can be observed through a microscope. Figure 5 The right side shows that the sampling was successful; the electron microscopy image of the frozen section of mouse brain tissue stained with cresyl violet captured by the Musashi steel needle with an inner diameter of 100 μm is shown in Fig.13 As shown, the Musashi steel needle with an inner diameter of 100 μm is able to capture the target tissue.

[0058] (4) Add 5 μL of single-cell lysis solution to the target mouse brain tissue captured by the Musashi steel needle with an inner diameter of 100 μm in step (3), and lyse it at room temperature (25°C) for 5-10 minutes until the target tissue is completely covered. Centrifuge and collect it to the bottom of the PCR tube; verify the sample using the mouse GAPDH internal reference (upstream primer: 5'-GGAGCGAGATCCCTCCAAAAT-3'; downstream primer: 5'-GGCTGTTGTCATACTTCTCATGG-3), reverse transcribe the RNA solution obtained by lysis, and finally perform PCR verification of the cDNA obtained by reverse transcription with the mouse internal reference. Fig.12 The results showed that the bands were obvious, indicating that the sample obtained frozen mouse tissue. The single cell lysate in the embodiment of the present invention is: Single Cell Lysis Solution for RNA Single Cell Lysis Solution (for RNA only), Jiangsu Tianjingsha Gene Diagnostic Technology Co., Ltd., No.: 220107.

[0059] (5) The RNA solution obtained by lysis in step (4) is used to construct a transcriptome library using the Smart-seq2 library construction method; specifically, the Smart-seq2 library construction method is as follows:

[0060] 5.1 RNA Reverse Transcription

[0061] Mix the following reaction system in Table 2 on ice:

[0062] Table 2

[0063]

[0064] After mixing, the reaction system was marked as S1, and then the PCR tube was placed in a PCR instrument, the temperature of the hot cover was set to 105°C, and the reaction was carried out at 72°C for 3 min.

[0065] Then prepare the reaction system of Table 3 on ice in the following order and name it S2:

[0066] Table 3

[0067]

[0068]

[0069] Reaction procedure: 42°C, 90 min; (50°C, 2 min; 42°C, 2 min) 10 cycles; 85°C, 5 min; and finally storage at 4°C.

[0070] 5.2 cDNA pre-amplification

[0071] Mix the following reaction system in Table 4 on ice:

[0072] Table 4

[0073]

[0074] The primer used was ISPCR-TSO (10 μm) sequence: AAGCAGTGGTATCAACGCAGAGT.

[0075] IS PCR-oligo (10 μm) sequence:

[0076] AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTVN.

[0077] The amplification reaction procedure is as follows in Table 5:

[0078] Table 5

[0079]

[0080]

[0081] Then use 0.7× Ampure XP (Company: Beckman; Catalog Number: A63882) for magnetic bead purification. Equilibrate the DNA magnetic beads at room temperature in advance, then add enzyme-free water to each sample to a total volume of 40μL, then add 28μL magnetic beads (0.7×), pipette 10 times to mix, and let stand at room temperature for 8min. Place the magnetic bead mixture on a magnetic stand and leave for 5min until clear. Remove the supernatant and wash twice with 200μL 80% ethanol, 30s each time. Discard the ethanol and dry the magnetic beads. Add 12μL of enzyme-free water to dissolve, pipette 10 times to mix, and let stand for 2min. Place on a magnetic stand until clear, and pipette 10μL into a new PCR tube. Finally, use Qubit to determine the cDNA concentration of 1ng / uL.

[0082] 5.3 cDNA digestion

[0083] Prepare the following reaction system in Table 6 on ice:

[0084] Table 6

[0085]

[0086] The reaction procedure is: the PCR instrument hot cover is set to 75℃; the reaction is 55℃, 5min; then stored at 12℃. After the reaction is completed, add 10μL 6×Termination Buffer (Company: ABclonal; Product Number: RK20265), leave it at room temperature for 5min, and stop the reaction. Then purify it with magnetic beads. After stopping the reaction, add 60μL magnetic beads (1.0×) to the PCR tube, blow it 10 times with a pipette to mix it, and leave it at room temperature for 8min. Place the magnetic bead mixture on the magnetic stand and leave it for 5min until it is clear. After removing the supernatant, wash the magnetic beads twice with 200μL 80% ethanol, each time for 30s. Discard the ethanol and dry the magnetic beads. Add 22μL of enzyme-free water to dissolve, blow it 10 times with a pipette to mix it, and let it stand for 2min. Place it on the magnetic stand until it is clear, and draw 20μL into a new PCR tube. Low melting point agarose was isolated by extraction of purified cDNA according to a 1:1 DNA magnetic bead adsorption step.

[0087] 5.4. Add other Smart-seq library construction reagents to construct Illumina library;

[0088] Prepare the following reaction system in Table 7 on ice:

[0089] Table 7

[0090]

[0091] The amplification reaction program is as follows in Table 8:

[0092] Table 8

[0093]

[0094] Use 0.7× DNA magnetic beads for magnetic bead purification. Equilibrate the DNA magnetic beads at room temperature in advance, then add enzyme-free water to each sample to a total volume of 50μL, then add 35μL magnetic beads (0.7×), pipette 10 times to mix, and let stand at room temperature for 8min. Place the magnetic bead mixture on a magnetic stand and leave it for 5min until clear. Remove the supernatant and wash twice with 200μL 80% ethanol, 30s each time. Discard the ethanol and dry the magnetic beads. Add 18μL of enzyme-free water to dissolve, pipette 10 times to mix, and let stand for 2min. Place on a magnetic stand until clear, and pipette 15μL into a new PCR tube.

[0095] Primer I5: AATGATACGGCGACCACCGAGATCTACACGACCTGTATCGTCGGCAGCGTC; Primer I7-1: CAAGCAGAAGACGGCATACGAGAT TAAGGCGA GTCTCGTGGGCTCGG. (All primers were ordered from Bio-Tech (Shanghai) Co., Ltd.)

[0096] (6) The transcriptome library obtained in step (5) was subjected to second-generation sequencing on the Illumina NovaSeq6000S4 PE150 machine, and quality control and data analysis were performed. The second-generation sequencing data was used for transcriptome gene alignment using Hisat2. Quality control comparison was performed using Qualimap. Data conversion was performed using Samtools. FeatureCounts was used to calculate the number of reads mapped to each gene. Based on the length of the gene and the number of reads mapped to the gene, the number of fragments per million transcripts of each gene was calculated. The obtained data was partitioned at different sequencing depths, and then the analysis was rerun to obtain the number of reads obtained at the same sequencing depth.

[0097] (7) Set up a control group to construct a transcriptome library after sampling using the LCM method, and the steps are as follows:

[0098] 7.1 Preparation of tissue sections: First, frozen sections of mouse brain tissue need to be prepared, following the same steps as above.

[0099] 7.2 Positioning of the target area: Use an inverted microscope, select the appropriate mode according to the specimen, and adjust the microscope to accurately position the target area.

[0100] 7.3 Laser capture: Place a collection cap with an EVA film (ethylene vinyl acetate film) on the target tissue or cell. Then, apply a low-energy near-infrared laser to irradiate its bottom to soften the EVA film and generate adhesion, so that the target tissue or cell adheres to the EVA film and separates it from the surrounding tissue or cells.

[0101] 7.4 Sample transfer and extraction: The cut tissue or cells are transferred to a centrifuge tube with extraction solution to extract RNA. The subsequent library construction steps also use Smart-seq2, and the specific steps are the same as step 5.

[0102] (8) Fig.14 As shown, the number of genes obtained by the spatial transcriptome construction method based on Musashi steel needle sampling is significantly higher than that obtained by LCM. The present invention can be widely used in various frozen tissue sections and is not limited to mouse brain tissue.

Claims

1. A target tissue capture device, characterized in that: The target tissue capture device includes, from bottom to top, a base, a movable bottom plate, a refrigerated stage arranged on the movable bottom plate, a liftable sampling device fixedly arranged on one side of the base, a detachable sampling microneedle on the sampling device, the sampling microneedle is located directly above the refrigerated stage, an upright microscope with a light source is arranged above the sampling microneedle, the upright microscope is fixedly connected to the other side of the base through a lifting device, and the X-axis and Y-axis directions on the movable bottom plate are respectively provided with scales with scales and knobs for controlling its movement in the X-axis and / or Y-axis directions.

2. The target tissue capture device according to claim 1, characterized in that: The sampling microneedles include Musashi steel needles, 32G needles, 34G needles, 4-row needles or square 4 needles.

3. The target tissue capture device according to claim 2, characterized in that: The inner diameter of the Musashi steel needle is 10-160 μm.

4. Use of the target tissue capture device according to any one of claims 1 to 3 in tissue section sampling.

5. A method for capturing target tissue in frozen tissue sections, characterized in that: The following steps are involved: (1) Placing a frozen tissue section on a refrigerated stage of the target tissue capture device according to any one of claims 1 to 3; (2) Controlling the moving directions of the X-axis and the Y-axis by means of knobs, after determining the spatial position information (x, y) coordinates of the X-axis and the Y-axis, the liftable sampling device is moved vertically downward to physically cut and sample the target tissue; the (x, y) coordinates are (1-10 cm, 1-10 cm); (3) After sampling to the needle tip, pipette and collect the sample onto the cap of the PCR tube.

6. A method for capturing target tissue in frozen tissue sections according to claim 5, characterized in that: The thickness of the frozen tissue sections described in step (1) is 10-35 μm.

7. A method for capturing target tissue in frozen tissue sections according to claim 5, characterized in that: The (x, y) coordinates in step (2) are (1 cm, 1 cm), (2 cm, 2 cm), or (3 cm, 3 cm).

8. Application of the target tissue capture device according to any one of claims 1 to 3 and the frozen tissue section target tissue capture method according to any one of claims 5 to 7 in constructing a spatially resolved transcriptome library and / or quality control and data analysis.

9. The use according to claim 8, characterized in that: The application includes dropping a single cell lysis solution onto the obtained target tissue until the target tissue is completely covered, lysing the solution at room temperature for 5-10 minutes, collecting the solution at the bottom of a PCR tube by centrifugation, and constructing a transcriptome library using the RNA solution obtained by lysis.

10. The use according to claim 8 or 9, characterized in that: The transcriptome library was constructed using the Smart-seq2 library construction method.

Images