Double knockout lung cancer cell strain as well as construction method and application thereof

Abstract

The invention discloses a double knockout lung cancer cell strain as well as a construction method and application thereof, and belongs to the technical field of cell engineering. The preservation number of the double-knockout lung cancer cell strain is GDMCC NO: 65041, the preservation center of the double-knockout lung cancer cell strain is Guangdong Microbial Culture Collection Center, the preservation address of the double-knockout lung cancer cell strain is the fifth floor of the building 59, No.100 Courtyard, Xianlie Middle Road, Guangzhou, and the preservation date of the double-knockout lung cancer cell strain is August 21, 2024 A corresponding plasmid vector is constructed by designing sgRNA aiming at ARID1A and ARID1B genes, cell infection is carried out by utilizing a lentiviral vector, and finally puromycin screening is carried out, so that the ARID1A and ARID1B recombinant plasmids are obtained. The double-knockout cell strain can be used for researching functions of ARID1A and ARID1B genes in lung cancer, and is particularly applied to tumor microenvironment, malignant clone evolution, pathogenesis, drug resistance mechanism and biological targeted drug research.

Description

Technical Field

[0001] The invention belongs to the technical field of cell engineering, and specifically relates to a double knockout lung cancer cell line and a construction method and application thereof. Background Art

[0002] Lung cancer is one of the most common and deadly malignant tumors in the world, posing a serious threat to human health. According to data from the National Cancer Center, in 2015, there were about 787,000 new cases of lung cancer in my country, accounting for nearly 1 / 3 of the new cases worldwide, and about 631,000 deaths. This data highlights the urgency and importance of lung cancer prevention and treatment. The treatment of lung cancer still faces major challenges, among which brain metastasis is one of the important causes of treatment failure and death in lung cancer patients. About 30%-50% of lung cancer patients will develop brain metastases during the course of the disease, which not only seriously affects the quality of life of patients, but also greatly shortens the survival of patients. The natural course of patients with brain metastases is only 1-3 months. Even after active treatment, the median survival time is only 3-6 months, the 1-year survival rate is 14%, and the 2-year survival rate is even lower. Therefore, in-depth research on the molecular mechanism of brain metastasis of lung cancer and the development of new treatment strategies are of great significance for improving the prognosis of lung cancer patients.

[0003] In recent years, with the rapid development of molecular biology and genomics, people have a deeper understanding of the molecular mechanisms of tumor occurrence and development. Among them, the role of the chromatin remodeling complex SWI / SNF in tumorigenesis has attracted widespread attention. ARID1A and ARID1B are the largest homologous subunits of the SWI / SNF complex cBAF subclass, and both are important tumor suppressor genes. The length of the proteins encoded by these two genes is more than 2000 amino acids, and mutations or deletions have been found in many tumors. The mutation frequency of the ARID1A gene is the highest among all subunits of the SWI / SNF complex, and the mutation rate varies greatly in different types of tumors, ranging from 1% to 60%. For example, the mutation rate of ARID1A in ovarian clear cell carcinoma is as high as 46.2%, and in endometrial cancer it is 30.3%. In addition, mutations or loss of expression of ARID1A have also been reported in a variety of tumors such as gastric cancer, liver cancer, pancreatic cancer and lung cancer. Most of these mutations are inactivating mutations, which lead to the loss of ARID1A protein expression, thereby affecting the normal function of the SWI / SNF complex. ARID1A plays a tumor suppressor role in the body mainly by participating in the ARID1A / BRG1 complex. This complex is involved in regulating multiple important cell biological processes, including glutathione metabolism, oxidative stress response, DNA replication and damage repair, cell cycle regulation, maintaining cell pluripotency or stem cell characteristics, and regulation of the PI3K signaling pathway. Gene expression analysis found that ARID1A's downstream target genes include important cell cycle regulators such as CDKN1A and SMAD3. In addition, the ARID1A / BRG1 complex can also directly interact with the well-known tumor suppressor gene TP53 to jointly regulate the transcription of downstream target genes. In many tumors, the silencing or loss of ARID1A leads to a series of molecular events that promote the occurrence and development of tumors. For example, in breast cancer and gastric cancer, the silencing of ARID1A can significantly increase cell proliferation and migration ability, while promoting the transcriptional enhancement of AURKA (Aurora kinase A). This further leads to the continuous activation of the cell cycle protein CDC25C, promotes G2 / M phase transition and mitosis, and ultimately accelerates the proliferation of tumor cells. ARI D1B has 60% homology with ARID1A, and the two are mutually exclusive in the SWI / SNF complex. Interestingly, although ARID1B is also an important tumor suppressor gene, its mutation rate in tumors is much lower than that of ARID1A. This phenomenon has triggered researchers to think deeply about the role of ARID1A and ARID1B in tumor development. A whole-genome synthetic lethal screening study found that ARID1B is an important specific action gene in ARID1A mutant cancer cell lines. This means that in ARID1A mutant tumors, cells may rely on ARID1B to maintain some functions of the SWI / SNF complex. This discovery provides new ideas for therapeutic strategies for ARID1A mutant tumors.

[0004] In the study of brain metastasis of lung cancer, it has been found that the ARID1A gene has inactivating mutations in 40.0% (6 / 15) of brain metastases, while no mutations were detected in paired primary lung cancer lesions. More notably, ARID1A mutations are positively correlated with high expression of PD-L1 and inflammatory cell infiltration. This finding is in stark contrast to another study that showed that ARID1A mutations were found in only 4.7% of 128 primary lung cancer patients. The enrichment of ARID1A mutations in brain metastases suggests that this gene may play an important role in regulating the occurrence and related molecular immune phenotypes of brain metastasis of lung cancer. Although a large number of studies have confirmed that ARID1A and ARID1B play a key role in multiple signaling pathways, especially in cell cycle regulation, tumor growth, proliferation and invasion, their exact roles and functions in the process of brain metastasis of lung cancer remain unclear. One of the main challenges facing research in this field is the lack of effective research models. At present, there is no effective method to construct lung cancer cell lines with simultaneous knockout of ARID1A and ARID1B genes, which limits the in-depth study of the role of these two genes in the occurrence and development of lung cancer. The establishment of double knockout cell lines of human lung cancer-related tumor cells ARID1A and ARID1B will provide an important tool for studying how these two genes perturb downstream signaling pathways. This cell model can help us better understand the specific roles of ARID1A and ARID1B in tumor growth and metastasis, and how they affect the development of lung cancer. In addition, the establishment of this cell model plays an important role in promoting the study of malignant clonal evolution, pathogenesis, drug resistance mechanism and the development of new biological targeted drugs of lung cancer.

[0005] In recent years, the development of CRISPR / Cas9 gene editing technology has provided new possibilities for constructing gene knockout cell lines. For example, a study successfully constructed a lung EZH2 gene knockout mouse model using the CRISPR / Cas9 lentiviral system. This method achieves efficient gene knockout by designing specific sgRNA and introducing the CRISPR / Cas9 system into the target cells using a lentiviral vector. This technology provides a reference method for constructing ARID1A and ARID1B double knockout lung cancer cell lines. However, knocking out two genes at the same time still faces technical challenges. First, ARID1A and ARID1B are both large genes, and it may be difficult to design efficient and specific sgRNAs. Secondly, knocking out two genes at the same time may have a serious impact on cell survival, and it is necessary to optimize experimental conditions to obtain stable double knockout cell lines. In addition, potential off-target effects need to be considered to ensure the reliability of experimental results.

[0006] In conclusion, lung cancer, especially brain metastasis of lung cancer, remains a major challenge in current medical research. In-depth research on the role of two important tumor suppressor genes, ARID1A and ARID1B, in the occurrence and development of lung cancer is expected to provide new ideas and methods for the diagnosis, treatment and prognosis evaluation of lung cancer. The construction of ARID1A and ARID1B double knockout lung cancer cell lines will provide important experimental tools for research in this field, help reveal the molecular mechanism of brain metastasis of lung cancer, and lay the foundation for the development of new treatment strategies. Summary of the invention

[0007] 1. Problems to be solved

[0008] In view of the problems existing in the above-mentioned prior art, the present invention provides a double knockout lung cancer cell line and a construction method and application thereof. By designing a pair of single guide RNA (sgRNA) that can accurately knock out the ARID1A and ARID1B genes, accurate knockout of the ARID1A and ARID1B genes is achieved. These cell lines can stably maintain the gene knockout state, providing a reliable experimental model for long-term research. Compared with traditional RNA interference technology, CRISPR technology can achieve permanent gene knockout and avoid the trouble of frequent transfection.

[0009] 2. Technical solution

[0010] To solve the above problems, the present invention adopts the following technical solutions.

[0011] A double knockout lung cancer cell line, the double knockout lung cancer cell line has a preservation number of GDMCC NO: 65041, its preservation center is Guangdong Microbial Culture Collection Center, its preservation address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and its preservation date is August 21, 2024.

[0012] Furthermore, the taxonomic name of the double knockout lung cancer cell line is human lung cancer cell A549-ARID1A / ARID1B KO;

[0013] The drug-resistant bacterial strain includes two or more mutation sites, including at least the following two mutation sites: ARID1A and ARID1B.

[0014] The method for constructing a double knockout lung cancer cell line as described above comprises the following steps:

[0015] (1) Design sgRNA targeting the mutation site;

[0016] (2) Construction of sgRNA plasmid vector;

[0017] (3) packaging lentivirus containing sgRNA plasmid vector;

[0018] (4) Infecting target cells with a lentivirus containing a plasmid vector containing sgRNA targeting the ARID1B mutation site to obtain ARID1B mutation site knockout cells;

[0019] (5) Screening of ARID1B mutation site knockout cells using puromycin;

[0020] (6) Screening of single clones carrying ARID1B mutation sites;

[0021] (7) Infecting ARID1B mutation site knockout cells with a lentivirus containing a plasmid vector containing sgRNA targeting the ARID1A mutation site to obtain ARID1A mutation site and ARID1B mutation site double knockout cells;

[0022] (8) Using puromycin to screen the double knockout cell lines of ARID1A mutation site and ARID1B mutation site;

[0023] (9) Screening single clone cells carrying ARID1A mutation sites and ARID1B mutation sites.

[0024] Preferably, the mutation sites described in step (1) include at least the following two mutation sites: ARID1A and ARID1B.

[0025] Preferably, the forward primer of the sgRNA for the ARID1A mutation site is shown as SEQ ID NO.3, and the reverse primer is shown as SEQ ID NO.4.

[0026] Preferably, the forward primer of the sgRNA for the ARID1B mutation site is shown as SEQ ID NO.1, and the reverse primer is shown as SEQ ID NO.2.

[0027] Preferably, the concentration of puromycin in step (5) is 6.0 ug / ml of puromycin.

[0028] Preferably, the concentration of puromycin in step (8) is 6.0 ug / ml of puromycin.

[0029] The double knockout lung cancer cell line as described was used in the study of cellular and molecular mechanisms of action.

[0030] For the construction method, specifically,

[0031] Designing sgRNA: Designing specific single guide RNA (sgRNA) for ARID1A and ARID1B genes to ensure accurate knockout of genes. This process involves: Target identification: Using bioinformatics tools to design sgRNA to ensure its specificity and effectiveness and avoid off-target effects; Design optimization: Combining genomic information and existing CRISPR tools to optimize sgRNA sequences to improve editing efficiency; Successful gene knockout: Through the CRISPR-Cas9 system, the target gene region can be effectively identified and cut. In addition, ARID1A and ARID1B are important subunits of the SWI / SNF chromatin remodeling complex, which are involved in regulating key biological processes such as cell cycle and DNA damage repair. Its knockout is helpful for: Functional studies: Study the specific functions of ARID1A and ARID1B in lung cancer cells, especially their roles in cell proliferation, signal transduction and immune regulation. Mechanism exploration: Explore its molecular mechanism in the process of brain metastasis of lung cancer and understand its relationship with tumor growth, invasion and metastasis.

[0032] Construction of sgRNA plasmid vector: Insert the designed sgRNA into the plasmid vector for subsequent lentiviral packaging.

[0033] Lentiviral packaging: The vector containing the sgRNA plasmid is packaged into lentivirus to infect the target cells.

[0034] Infect target cells: Use packaged lentivirus to infect lung cancer cell lines (such as A549, H1299, PC9, etc.) to ensure efficient viral transduction.

[0035] Puromycin screening: Puromycin is used to screen infected cells, remove uninfected cells, and retain resistant cell populations.

[0036] Monoclonal screening: Single clone cells carrying ARID1A and ARID1B gene mutations were screened by limiting dilution method, and then expanded and cultured to finally obtain double knockout cell lines.

[0037] In general, this method provides an important experimental model for studying the role of ARID1A and ARID1B in lung cancer and its brain metastasis through precise gene editing technology. At the same time, the innovation lies in:

[0038] High efficiency: This method can quickly and efficiently construct ARID1A and ARID1B double knockout lung cancer cell lines. Compared with traditional RNA interference technology, the CRISPR / Cas9 system provides higher specificity and stability.

[0039] Stability: The double knockout cell lines obtained through lentivirus-mediated gene editing can be stably propagated for a long time, providing a reliable experimental tool for subsequent research.

[0040] Versatility: This cell line can be used to study the functions of ARID1A and ARID1B in lung cancer cells, including effects on cell proliferation, signaling, and immune regulation.

[0041] By the method of the present invention, ARID1A and ARID1B double knockout lung cancer cell lines were successfully constructed. These cell lines have broad application prospects in basic and clinical research on malignant clonal evolution, pathogenesis, drug resistance mechanism and biological targeted drugs. This study not only helps to reveal the molecular mechanism of brain metastasis of lung cancer, but also may provide important basis for developing new treatment strategies and improving the prognosis of lung cancer patients.

[0042] 3. Beneficial effects

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] The present invention achieves the following objectives by constructing ARID1A and ARID1B double knockout lung cancer cell lines:

[0045] (1) Elucidate the molecular mechanism: In-depth study of the functions of ARID1A and ARID1B in lung cancer cells, including their effects on cell proliferation, apoptosis, invasion, and metastasis.

[0046] (2) Exploring signaling pathways: studying the interactions between ARID1A and ARID1B and the SWI / SNF chromatin remodeling complex, as well as their regulatory effects on the GSH metabolic pathway, DNA damage repair capacity, and the PI3K / AKT signaling pathway.

[0047] (3) Revealing immune regulatory mechanisms: exploring how ARID1A and ARID1B mutations affect PD-L1 expression and inflammatory cell infiltration in the tumor microenvironment.

[0048] (4) Develop treatment strategies: Based on the research results, explore personalized treatment strategies for lung cancer patients with ARID1A and ARID1B mutations, including possible targeted therapy and immunotherapy options.

[0049] At the same time, it brings the following potential application values:

[0050] Basic research tools: It provides an important cell model for studying the role of ARID1A and ARID1B in the occurrence, development and metastasis of lung cancer. Drug screening platform: It can be used to screen potential therapeutic drugs for ARID1A and ARID1B mutant lung cancer. Personalized treatment guidance: The research results may provide a theoretical basis for the personalized treatment of patients with ARID1A and ARID1B mutant lung cancer. Biomarker development: It helps to develop diagnostic and prognostic biomarkers based on the mutation status of ARID1A and ARID1B.

[0051] In summary, the present invention provides an important tool for in-depth study of the role of these two genes in the occurrence, development and brain metastasis of lung cancer by constructing ARID1A and ARID1B double knockout lung cancer cell lines. This study not only helps to reveal the molecular mechanism of brain metastasis of lung cancer, but also may provide an important basis for developing new treatment strategies and improving the prognosis of lung cancer patients. Through multi-angle and multi-level research, it is expected to make breakthrough progress in basic research and clinical translational application of lung cancer, and make important contributions to improving the survival rate and quality of life of lung cancer patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 This is the peak diagram of the sequencing of PCR products near the genomic DNA target site of the mixed A549 cell population with ARID1B knocked out after antibiotic selection;

[0053] Figure 2 This is the peak diagram of the sequencing of PCR products near the genomic DNA target site of the mixed A549 cell population with ARID1A knocked out after antibiotic selection;

[0054] Figure 3 This is the principle diagram of the limiting dilution method;

[0055] Figure 4 This is the sequencing peak diagram of the PCR product near the genomic DNA target site (ARID1A) of the ARID1A / ARID1B double knockout monoclonal cell line;

[0056] Figure 5 This is the sequencing peak diagram of the PCR product near the genomic DNA target site (ARID1B) of the ARID1A / ARID1B double knockout monoclonal cell line;

[0057] Figure 6 This is a picture of monoclonal A549 lung cancer cells that achieved ARID1A / ARID1B double knockout (10x); A: white light, B: fluorescence.

[0058] Figure 7 These are cell images of L26 fibroblasts infected with lentivirus and treated with different concentrations of puromycin 48 hours later; A: 0.5ug / ml puromycin treatment, B: 1.0ug / ml puromycin treatment, C: 2.0ug / ml puromycin treatment, D: 4.0ug / ml puromycin treatment, E: 6.0ug / ml puromycin treatment, and F: 8.0ug / ml puromycin treatment.

[0059] Figure 8The following are Western blot images of the expression of ARID1A / ARID1B in monoclonal cell lines; A: expression of ARID1A in A549-ARID1A / B KO, B: expression of ARID1B in A549-ARID1A / B KO.

[0060] Fig. 9 It is a picture of ARID1A / ARID1B double knockout monoclonal lung cancer cells (10x); wherein A: A549-ARID1A / B KO white light, B: A549-ARID1A / B KO fluorescence, C: PC9-ARID1A / B KO white light, D: PC9-ARID 1A / B KO fluorescence, E: AMT-ARID1A / B KO white light, F: AMT-ARID1A / B KO fluorescence. DETAILED DESCRIPTION

[0061] The present invention is further described below in conjunction with specific embodiments.

[0062] This patent provides a method with great value in the research and treatment of brain metastasis of lung cancer through innovative gene editing technology. By constructing ARID1A and ARID1B double knockout lung cancer cell lines, it is expected to gain a deeper understanding of their role and function in the process of brain metastasis of lung cancer, bringing new opportunities and potential for the treatment and research of brain metastasis of lung cancer. This not only provides new tools for basic research, but also provides important theoretical support for the development of clinical applications and treatment strategies.

[0063] The specific steps include:

[0064] Design sgRNA: Design specific sgRNA for ARID1A and ARID1B genes.

[0065] Construct a plasmid vector: Insert the designed sgRNA into the plasmid vector.

[0066] Lentivirus packaging: Use plasmid vectors to package lentivirus.

[0067] Cell infection and screening:

[0068] First, the target lung cancer cells were infected with lentivirus containing ARID1B sgRNA, and ARID1B knockout cells were selected by 6.0 μg / ml puromycin.

[0069] Then, ARID1B knockout cells were re-infected with lentivirus containing ARID1A sgRNA and double knockout screening was performed by the same concentration of puromycin.

[0070] Monoclonal screening: single clone cells carrying ARID1A and ARID1B double knockout mutations were screened.

[0071] This double knockout cell line can be used to study the role of ARID1A and ARID1B in the evolution of malignant clones, pathogenesis, drug resistance mechanisms, and development of biological targeted drugs in lung cancer. This method provides an important tool for a deeper understanding of the molecular mechanisms of lung cancer and a new research platform for related basic and clinical research. By constructing and applying this double knockout cell line, it is expected to reveal the specific functions of ARID1A and ARID1B in tumor growth, proliferation, and metastasis, and provide new ideas and potential targets for the development of treatment strategies for lung cancer.

[0072] Example 1

[0073] sgRNA design

[0074] Design according to the design process on the sgRNA design website: https: / / portals.broadinstitute.org / gppx / crispick / public. The specific steps are as follows:

[0075] Enter the target gene information: Enter the name or sequence of the target gene in the search box of the website, such as ARID1A and ARID1B, to obtain the corresponding gene information.

[0076] Select sgRNA design parameters: Select appropriate sgRNA design parameters according to experimental requirements, such as target region, GC content, off-target score, etc., to ensure the specificity and effectiveness of sgRNA.

[0077] Generate sgRNA sequences: The website will generate a series of candidate sgRNA sequences based on the input information and selected parameters. Users can view detailed information of these sequences, including target location, off-target score, etc.

[0078] Screening for the best sgRNA: Select the sgRNA that best suits your experimental needs from the generated candidate sequences. Typically, select an sgRNA with a low off-target score and a suitable targeting region.

[0079] Verify and synthesize sgRNA: Once the appropriate sgRNA sequence is selected, these sgRNAs can be ordered through synthesis companies for subsequent experiments.

[0080] During the design process, the specific sgRNA sequence information for ARID1A and ARID1B is listed in Table 1. These sgRNAs were optimized to ensure high efficiency and specificity in double knockout experiments. The sgRNAs designed in this way provide the basis for subsequent gene editing experiments and ensure accurate knockout of ARID1A and ARID1B genes.

[0081] sgRNAs targeting ARID1A and ARID1B are shown in Table 1.

[0082] Table 1 sgRNA design

[0083] ARID1B Top(5'-3')SEQ ID NO.1 Bottom (5'-3') SEQ ID NO.2 CACCGCAGCAGAGCAGTCCGTACCC AAACGGGTACGGACTGCTCTGCTGC ARID1A Top(5'-3')SEQ ID NO.3 Bottom (5'-3') SEQ ID NO.4 CACCGCCTCCGTCAGGACCGCAGCA AAACTGCTGCGGTCCTGACGGAGGC

[0084] Example 2

[0085] The construction of sgRNA plasmid vector includes the following steps: (1) phosphorylation and annealing of each pair of oligonucleotides:

[0086] The reaction system is as follows:

[0087] 1ul Oligo 1 (100μM) Top;

[0088] 1ul Oligo 2 (100μM) Bottom;

[0089] 1ul 10X T4 Ligation Buffer(NEB);

[0090] 6.5ul ddH2O;

[0091] 0.5ul T4 PNK (NEB M0201S);

[0092] 10ul total;

[0093] Use T4 ligation buffer, as the buffer provided by T4 PNK enzyme does not contain ATP (or supplemented with 1 mM ATP). Perform the following phosphorylation / annealing reaction in a thermal cycler: 37°C for 30 min; 95°C for 5 min; then cool to 25°C at a rate of 5°C / min.

[0094] (2) Plasmid empty vector for restriction endonuclease reaction

[0095] Endonuclease: BsmBI-v2 (Brand: NEB Catalog No.: R0739S);

[0096] Empty: lentiGuide-Puro (Addgene catalog number: 52963).

[0097] Restriction endonuclease reactions were performed according to Table 3 below:

[0098] Table 2 Reaction system

[0099] RestrictionEnzyme 10unitsissufficient,generally1ulisused DNA 1ug 10×NEBuffer 5ul(1×) TotalReactionvolume 50ul IncubationTime 1hour IncubationTemperature Enzymedependent

[0100] (3) Gel purification of the enzyme-cut empty plasmid using a gel extraction kit

[0101] Gel Extraction Kit: Gel Extraction Kit D2500 (brand: Omega; product number D2500-02).

[0102] (4) Dilute the annealed oligomers from step (1) into EB buffer at 1:200.

[0103] (5) The purified plasmid was connected to the annealed oligo:

[0104] Ligase: T4 DNA Ligase (Brand: NEB; Catalog No.: M0202V);

[0105] Configure the connection system according to the following table:

[0106] Table 3 Connection system

[0107] COMPONENT 20uIREACTION T4 DNA Ligase Buffer (10X)* 2ul VectorDNA(4kb) 50ng(0.020pmol) InsertDNA(1kb) 37.5ng(0.060pmol) Nuclease-freewater to20ul T4DNALigase 1ul

[0108] Complete the reaction on ice as described above (T4 DNA ligase should be added last).

[0109] The operation is as follows: T4 DNA ligase buffer should be thawed and resuspended at room temperature. The reactants should be gently mixed by repeatedly blowing with a pipette. For sticky ends, incubate at room temperature for 10 minutes. For blunt ends or single-base repeat sequences, incubate at 16°C for 2 hours and heat inactivate at 65°C for 10 minutes. After the reaction is completed, cool on ice and transform 5ul of the reactant into 50ul of competent cells.

[0110] (6) Transformation of plasmid into Stbl3 competent cells

[0111] Stbl3 competent cells (Brand: Genesand Catalog No.: XK002-01);

[0112] The specific operations are as follows:

[0113] Take out the corresponding competent cells from the -80℃ freezer, place them on an ice box to thaw, and mark them;

[0114] Take 10 μl of plasmid and add it to 100 μl of competent medium and incubate on ice for 30 min;

[0115] Heat shock at 42°C for 90 seconds, followed by an ice bath for 2 minutes;

[0116] Add 900 μl of antibiotic-free LB liquid medium and culture at 180 rpm for 45 min;

[0117] Centrifuge at 6000 rpm for 5 min, leaving only 100 μl of supernatant to mix with bacterial pellet;

[0118] Add the mixed bacterial solution to the LB plate with the corresponding resistance, pour in an appropriate amount of glass beads, and spread the liquid evenly;

[0119] The plate was incubated in the upright position for 1 h and then inverted for 16 h;

[0120] Pick a single clone colony and place it in LB liquid culture medium with corresponding resistance, shake and culture for 12 hours, preserve the seeds, and extract the plasmid according to experimental needs.

[0121] In summary, the steps for constructing sgRNA plasmid vectors include:

[0122] Phosphorylation and annealing of oligonucleotides: Phosphorylation and annealing reactions were performed using T4 ligation buffer and T4 PNK enzyme. Restriction endonuclease reactions: Restriction endonuclease reactions were performed using BsmBI-v2 endonuclease and lentiGuide-Puro empty vector. Gel purification: Gel purification of the digested empty vector plasmid was performed using a gel extraction kit. Dilute annealed oligomers: Dilute the annealed oligomers 1:200 into EB buffer. Ligation reaction: Ligate the annealed oligomers using T4 DNA ligase and the purified plasmid empty vector. Plasmid transformation: Transform the ligation product into Stbl3 competent cells. These steps describe in detail the experimental process of constructing the sgRNA plasmid vector, including phosphorylation and annealing of oligonucleotides, restriction endonuclease reactions, gel purification, dilution of annealed oligomers, ligation reactions, and plasmid transformation.

[0123] Example 3

[0124] The steps of lentiviral packaging are as follows:

[0125] (1) 293T cells were plated in 6-well plates with DMEM without antibiotics + 10% FBS (fetal bovine serum), 2 ml / well, at 37°C 5% CO2 overnight, ensuring that the cell density reached 90% confluence the next day.

[0126] (2) Replace the medium in each well with Opti-MEM reduced serum medium.

[0127] (3) Prepare Mix: The Mix required for each well of a 6-well plate is as follows:

[0128] Mix1: target plasmid (1.25 μg) + psPAX2 (packaging plasmid) (0.937 μg) + pMD2.G (envelope plasmid) (0.3125 μg) + 250 μl opti-MEM + 5 μl P3000TM enhancer (P3000TM is Lipofectamine TM Enhancer provided in 3000Transfection Reagent);

[0129] Mix2:Lipo3000 7.5μl+opti-MEM 250μl.

[0130] psPAX2 (Brand: Addgene, Catalog Number: #12260), pMD2.G (Brand: Addgene, Catalog Number: #12259), opti-MEM: Opti-MEM TM I Reduced Serum Medium (Thermo Fisher Scientific, Catalog No. 31985070), Lipofectamine TM 3000 Transfection Reagent (which contains two reagents: P3000TM Enhancer and Lipo3000) (Cat. No.: L3000015, Brand: Thermo Fisher).

[0131] (4) Incubate the two mixes above for 5 min each.

[0132] (5) Mix the two solutions and incubate for 15 min.

[0133] (6) Add the mixture from step 5 to the Opti-MEM cell culture medium in a 6-well plate and place in a 37°C 5% CO2 incubator. TM I reduced serum culture medium (brand: Thermo Fisher, catalog number: 31985070).

[0134] (7) 24 hours after transfection, observe the transfection efficiency under a fluorescence microscope, which should be above 70% (if there is no fluorescent protein, observe the survival status of 293T cells).

[0135] (8) 48 hours after transfection, the virus-containing supernatant was harvested in a 50 ml centrifuge tube, and the remaining cells were added with DMEM + 10% FBS (without double antibody) and continued to be cultured. After 72 hours, the supernatant containing virus particles was collected.

[0136] (9) The collected viral supernatant was centrifuged at 1000 rpm for 5 min to remove cell debris, and filtered through a 0.45 μm filter membrane into a new 50 ml centrifuge tube to remove the cell precipitate.

[0137] (10) Titer determination: qPCR Lentivirus Titration Kit (Company: ABM, Catalog No. LV900).

[0138] (11) The virus solution was stored in a -80°C refrigerator.

[0139] These steps describe in detail the experimental process of lentiviral packaging, including cell culture, medium change, mix preparation, incubation, transfection, observation of transfection efficiency, virus harvesting, removal of cell debris, titer determination and storage, etc.

[0140] Lentiviral packaging is a commonly used gene transfection method that uses lentivirus to transfer the target gene into cells. The lentiviral packaging process includes the entire process from cell culture to virus harvesting and storage. Through these steps, high-titer lentivirus can be successfully packaged for subsequent gene transfection experiments.

[0141] During the lentiviral packaging process, several key points need to be noted:

[0142] Cell density: Ensure that the cell density reaches 90% confluence to ensure transfection efficiency.

[0143] Transfection time: 24 hours after transfection, observe the transfection efficiency, which should reach more than 70%.

[0144] Virus harvesting: 48 h after transfection, harvest the virus-containing supernatant and continue to culture the cells to collect more virus particles.

[0145] Titer determination: Virus titer was determined using the qPCR Lentivirus Titration Kit to determine the virus concentration.

[0146] Through these steps and precautions, high-titer lentivirus can be successfully packaged for subsequent gene transfection experiments.

[0147] Example 4

[0148] The steps for lentiviral infection of target cells are as follows:

[0149] a. Cell preparation: Inoculate A549, H1299, and PC9 cells in a 24-well plate until the well reaches 80%;

[0150] b. Add lentivirus: Take out the virus from the refrigerator and slowly thaw it on ice, remove the original culture medium of the cells, add 1 ml of the virus stock solution (per well of the 6-well plate) to the cells, mix gently, and add polybrene to make the final concentration 5ug / ml. After 4 hours, add 1 ml of serum-free culture medium;

[0151] c. Medium change: On the third day after infection (about 48 hours), remove the culture medium containing the virus and replace it with fresh complete culture medium, and continue to culture at 37°C;

[0152] d. Subculture and expansion: Continue to subculture and expand the overgrown cells.

[0153] These steps describe in detail the experimental process of lentiviral infection of target cells, including cell preparation, addition of lentivirus, medium replacement, and subculture amplification. Through these steps, the target cells can be successfully infected and stable transfected cell lines can be obtained.

[0154] Example 5

[0155] The steps of puromycin screening are as follows:

[0156] Since the lentiGuide-Puro (Addgene catalog number: 52963) vector carries puromycin resistance, the target cells (A549, H1299, PC9 cell lines) also have puromycin resistance after being infected with the lentivirus, so puromycin can be used to purify the target cells.

[0157] a. Determine the optimal concentration of puromycin: Plate the target cells that have not been transfected with lentivirus into a 24-well plate, so that the fusion rate is about 70-80% on the second day, and replace the complete culture medium containing different concentrations of puromycin (Beyotime, #ST551) after 24 hours. The puromycin gradient can be set to 0.5, 1.0, 2.0, 4.0, 6.0, 8.0ug / ml for 48 hours, and select the lowest concentration that can kill more than 90% of empty cells for subsequent experiments.

[0158] b. Puromycin screening: Antibiotic screening was performed one week after the virus infected the cells. An empty cell control group that was not infected with the virus and an experimental group that was infected with the virus were set up in a 6-well plate, and puromycin of equal concentration was added. The death of the empty cells in the control group was observed for about 48 hours after the addition of the drug. If the cell death rate of the empty cell group reached more than 90%, and some cells in the experimental group survived, the virus infection was successful, and the cells screened by puromycin were expanded and cultured.

[0159] Puromycin is an aminonucleoside antibiotic that inhibits protein synthesis by binding to the A site of the ribosome, leading to premature termination of the peptide chain. Its structure is similar to aminoacylated tRNA and can be incorporated into the growing peptide chain, preventing further protein synthesis.

[0160] Selectivity: Since the lentiGuide-Puro vector carries a puromycin resistance gene, cells infected with this vector can survive in the presence of puromycin, while uninfected cells die due to blocked protein synthesis.

[0161] Optimizing concentration: By determining the optimal concentration of puromycin, you can ensure that only those successfully transfected or infected cells survive during the screening process, thereby improving the accuracy and efficiency of the experiment.

[0162] Wide application: This method can be used to screen a variety of cell lines, especially in gene editing and cell line construction, to obtain cell lines that stably express the target gene.

[0163] Through the above steps and principles, researchers can effectively screen out cells carrying target genes and provide reliable cell models for subsequent biological research and applications.

[0164] Example 6

[0165] Screening of single clones carrying target site mutations:

[0166] (1) After 2-3 days of puromycin selection, the cells were expanded and cultured, a T25 cell pellet was collected, and the cell genomic DNA was extracted using the QIAampDNA Mini Kit (brand: QIAGEN; catalog number: 51304). At the same time, primers were designed for PCR amplification of the knockout region.

[0167] The identification primer sequences are shown in Table 4 below:

[0168] Table 4 Sequence primers

[0169] ARID1BForward(5'-3') ARID1BReverse(5'-3') CTTTAATGTCTTGCTGGATGTTTTGTCAGG TTCTGTCCACTTTAAGAAGCTCACCTTTTCC ARID1AForward(5'-3') ARID1AReverse(5'-3') TGACAAAATTAGGGTTCTGAGGCGG GAACGGTGCCTATAGCTTTGGCTTT

[0170] PCR amplification of the knockout region: HSDNA Polymerase (brand: TaKaRa; product number: R010A).

[0171] The composition of the PCR reaction solution (50ul) is shown in Table 5:

[0172] Table 5 Reaction system

[0173] Volume / Amount Finalconc. 5xPrimeSTAR Buffer (Mg2+Plus) 10ul 1× dNTP Mixture (2.5 mM each) 4ul 200uMeach Primer1 10-15 pmol 0.2-0.3uM Primer2 10-15 pmol 0.2-0.3uM Template <200ng PrimeSTARHSDNAPolymerase(2.5U / ul) 0.5ul 1.25U / 50ul Sterilized water up to 50ul

[0174] PCR reactions can be prepared at room temperature. However, when preparing the reactions, keep the components on ice.

[0175] The three-step PCR reaction conditions are shown in Table 6:

[0176] Table 6 Reaction conditions

[0177]

[0178] (2) Sequencing of PCR products from mixed cell populations:

[0179] Generally, in the sequencing of sequences near the gRNA target site, positive samples will have overlapping peaks in the target position and the subsequent sequences. However, if the knockout efficiency is low, the overlapping peaks may not be obvious, affecting the judgment. Figure 1 , Figure 2As shown, the accuracy of the product was confirmed.

[0180] (3) Limiting dilution method to screen single clone cells:

[0181] If there are obvious overlapping peaks in the sequencing results of the mixed cell population, the following limiting dilution method steps are performed. The principle is referenced Figure 3 :

[0182] a. Wash the selected cells with PBS. Carefully aspirate and discard the PBS, add Tripsin to the cells and incubate at 37°C for 5 min.

[0183] b. Add an equal volume of complete medium to the cells to neutralize the dissociation reagent as Tripsin.

[0184] c. Use the pipette tip to blow the cells to disperse them and ensure that the cells are well separated.

[0185] d. Centrifuge the cells at 300 g for 5 minutes.

[0186] e. Discard the supernatant, resuspend the cell pellet with an appropriate volume of culture medium, and then count the cells.

[0187] f. After counting, take the required number of cells in the cell suspension.

[0188] NOTE: Serial dilutions can also be performed to obtain a better estimate of cell density.

[0189] To sum up, the principles of the steps are as follows:

[0190] Puromycin selection: Using a vector carrying the puromycin resistance gene, successfully infected cells can survive in a culture medium containing puromycin, while uninfected cells will be eliminated.

[0191] PCR amplification and sequencing: PCR amplifies the knockout region and sequences the product to detect the mutation of the target site. The appearance of overlapping peaks is a sign of successful gene editing.

[0192] Limiting dilution method: used to screen and culture single cell clones to ensure that each clone originates from a single cell, thereby ensuring the purity and consistency of the clone.

[0193] Genotype identification and protein verification: The success of gene knockout was verified by sequencing and Western blot to ensure that the expression of ARID1A and ARID1B genes in cells was completely silenced.

[0194] Through these steps, researchers were able to successfully screen and verify single cloned cells carrying target site mutations, providing a stable cell model for subsequent biological research.

[0195] g. Transfer 100 μL of cell suspension to each well of a 96-well culture plate until the desired number of plates are inoculated.

[0196] The number of plates to be seeded depends on the editing efficiency of the mixed cell population and the cell viability after single cell isolation.

[0197] h. Incubate the culture plate in a 37°C, 5% CO2 incubator.

[0198] i. When small cell aggregates are seen under a 4X microscope, inspect the entire 96-well plate for single cell colonies (usually after the first week, depending on the growth rate of the cell line).

[0199] j. Continue culturing for 2 weeks to expand the clone population. After 2 weeks, digest the grown single clone and divide it into two to continue culturing.

[0200] k. When the cell confluence reaches 60%, the cells can be taken out for single clone identification.

[0201] (4) Monoclonal screening and identification:

[0202] Using EZ-editor TM The monoclonal genotype identification kit (brand: Yuanjing Bio; catalog number: YK-MVH-100) is operated as follows:

[0203] a. Cell treatment

[0204] Adherent cells: Carefully aspirate the cell supernatant, and try to aspirate as cleanly as possible.

[0205] Optional: Wash the cells with PBS and centrifuge at 3000 rpm for 10 min at room temperature. This step can reduce impurities in the sample, but if the number of cells is small, this step can be omitted.

[0206] b. Cell Lysis

[0207] ① Add 90 μl MicroCell DNA Lysis Buffer A to each cell sample and mix by pipetting 15 times.

[0208] ② Transfer the samples from the previous step to a 96-well PCR plate and cover it with a silicone membrane; or transfer it to an 8-well tube strip and seal it with a cap.

[0209] ③Set the PCR instrument to 95℃, 10min, and load the samples.

[0210] c. Stop lysis

[0211] Remove the lysed sample from the PCR instrument, add 10 μl MicroCell DNA Lysis Buffer B, and mix by pipetting. The sample is directly used for downstream PCR reaction.

[0212] d.PCR identification

[0213] Take out CloneAmpTaq Mix (+Dye) and CloneAmp Ctrl from the -20°C refrigerator, place them in an ice box to thaw, and prepare the PCR system according to Table 7 below:

[0214] Table 7 PCR system

[0215] Reagents Volume (per reaction) CloneAmpTaqMix(+Dye), 2x 12.5μL Monoclonal cell lysate 2μL Identification primer F (10 μM) 1μL Identification primer R (10 μM) 1μL <![CDATA[ddH2O]]> 8.5μL Total volume 25μL

[0216] The PCR reaction program is shown in Table 8 below:

[0217] Table 8 Reaction system

[0218]

[0219] PCR products can be directly spotted on agarose gel (without adding Loading Buffer) or sent for Sanger sequencing.

[0220] e. PCR product sequencing, knockout results from sequencing analysis:

[0221] ① If the sequencing result has no overlapping peaks and is consistent with the wild type, the clone is an unsuccessfully edited clone;

[0222] ② If there is no overlapping peak in the sequencing result and the indel is not 3 times, the clone is a successful knockout clone, and the mutation of each allele is the same;

[0223] ③If there are overlapping peaks in the sequencing results, the clone may be a heterozygote, or a positive clone with different allele indel situations.

[0224] The clones in ③ were rescreened, and the PCR products were subjected to TA cloning and then sent for sequencing to determine the mutation status of each allele.

[0225] (5) Positive clone amplification and protein level verification by WB:

[0226] For the positive clones identified as successfully knocked out, continue to subculture and expand. When the number of cells is sufficient, collect the cell pellet for WB verification.

[0227] (6) Verify successful positive clone expansion and cryopreservation

[0228] For the positive clones that were successfully knocked out, continue to subculture and expand. When the cell number is sufficient, freeze them for backup.

[0229] like Figure 4 and Figure 5 As shown, ARID1A / ARID1B double knockout lung cancer cell line was successfully constructed:

[0230] The lung cancer cell line was infected with lentivirus containing sgRNA plasmids targeting ARID1B and ARID1A genes, and then screened and cultured with 4.0ug / ml puromycin. Single clones carrying target site mutations were screened to successfully construct an ARID1A / ARID1B double knockout lung cancer cell line ( Figure 6 ).

[0231] Puromycin at a concentration of 6.0 ug / ml can be used to screen fibroblasts after successful lentiviral infection. Empty cells that are not infected with the virus are treated with puromycin at concentrations of 0.5, 1.0, 2.0, 4.0, 6.0, and 8.0 ug / ml for 48 h (see Figure 7 ), according to the results, the lowest concentration of 6.0ug / ml that can kill more than 90% of the empty cells was selected for subsequent screening experiments. The cells infected with the lentivirus were screened with puromycin at a concentration of 6.0ug / ml, and the ARID1A / ARID1B double knockout lung cancer cell line was successfully obtained.

[0232] In addition, nucleic acid was extracted from the cell lines with ARID1A / ARID1B knockout after antibiotic screening for identification and PCR amplification. The Sanger sequencing results of the products showed that ARID1A / ARID1B gene knockout had been achieved in the mixed cell population ( Figure 1 and Figure 2 ).

[0233] The ARID1A / ARID1B gene of the ARID1A / ARID1B double knockout cell line amplified after limited dilution monoclonal cell screening was completely silenced; the nucleic acid extracted from the ARID1A / ARID1B double knockout cell line after limited dilution monoclonal cell screening was identified by PCR amplification. The Sanger sequencing results of the product showed that there was no overlapping peak and the indel was not 3 times, indicating that the cloned cell line was a clone that successfully knocked out ARID1A / ARID1B, and the mutation of each cell allele was the same ( Figure 4 and Figure 5 );

[0234] The limiting dilution method ( Figure 3 ) After monoclonal cell screening, the ARID1A / ARID1B double knockout cell line amplified was extracted for total protein Western blot experiment. The results showed that the expression level of ARID1A / ARID1B protein in this cloned cell line was 0, indicating that the ARID1A / ARID1B genes had been successfully knocked out (see Figure 8 ).

[0235] In this example, three different lung cancer cell lines, A549, PC9, and CMT, were selected and constructed according to the method of Example 1, and three ARID1A and ARID1B double knockout cell lines were successfully constructed, namely A549-ARID1A / B KO, PC9-ARID1A / B KO, AMT-ARID1A / B KO ( Fig. 9 ). The operation steps and conditions of the implementation method in this case are basically the same as the application steps of the above-mentioned method for establishing ARID1A / ARID1B double knockout cell line, the only difference is that the target cells are different.

[0236] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0237] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A double knockout lung cancer cell line, characterized in that: The double knockout lung cancer cell line has a preservation number of GDMCC NO: 65041, and its preservation center is Guangdong Microbial Culture Collection Center. Its preservation address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and its preservation date is August 21, 2024.

2. The double knockout lung cancer cell line according to claim 1, characterized in that: The taxonomic name of the double knockout lung cancer cell line is human lung cancer cell A549-ARID1A / ARID1B KO; The drug-resistant bacterial strain includes two or more mutation sites, including at least the following two mutation sites: ARID1A and ARID1B.

3. A method for constructing a double knockout lung cancer cell line according to any one of claims 1 to 2, comprising the following steps: (1) Design sgRNA targeting the mutation site; (2) Construction of sgRNA plasmid vector; (3) packaging lentivirus containing sgRNA plasmid vector; (4) Infecting target cells with a lentivirus containing a plasmid vector containing sgRNA targeting the ARID1B mutation site to obtain ARID1B mutation site knockout cells; (5) Screening of ARID1B mutation site knockout cells using puromycin; (6) Screening of single clones carrying ARID1B mutation sites; (7) Infecting ARID1B mutation site knockout cells with a lentivirus containing a plasmid vector containing sgRNA targeting the ARID1A mutation site to obtain ARID1A mutation site and ARID1B mutation site double knockout cells; (8) Using puromycin to screen the double knockout cell lines of ARID1A mutation site and ARID1B mutation site; (9) Screening single clone cells carrying ARID1A mutation sites and ARID1B mutation sites.

4. The method for constructing a double knockout lung cancer cell line according to claim 3, characterized in that: The mutation sites described in step (1) include at least the following two mutation sites: ARID1A and ARID1B.

5. The method for constructing a double knockout lung cancer cell line according to claim 3, characterized in that: The forward primer of the sgRNA at the ARID1A mutation site is shown in SEQ ID NO.3, and the reverse primer is shown in SEQ ID NO.

4.

6. The method for constructing a double knockout lung cancer cell line according to claim 3, characterized in that: The forward primer of the sgRNA for the ARID1B mutation site is shown in SEQ ID NO.1, and the reverse primer is shown in SEQ ID NO.

2.

7. The method for constructing a double knockout lung cancer cell line according to claim 3, characterized in that: The concentration of puromycin in step (5) is 6.0 ug / ml of puromycin.

8. The method for constructing a double knockout lung cancer cell line according to claim 3, characterized in that: The concentration of puromycin in step (8) is 6.0 ug / ml of puromycin.

9. Use of the double knockout lung cancer cell line according to any one of claims 1 to 2 in the study of cell molecular action mechanisms.

Images