Genetically engineered bacterium for high-yield production of PET degrading enzyme by taking PET hydrolysate as raw material and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for high-yield production of PET degrading enzyme by taking PET hydrolysate as a raw material and application of the genetically engineered bacterium, and belongs to the technical field of microbial engineering. The invention provides a plasmid containing an EG metabolism and degrading enzyme synthesis expression unit, so that a host cell has the capability of metabolizing EG to synthesize degrading enzyme. The constructed recombinant plasmid can be used in common hosts such as escherichia coli and bacillus subtilis, the constructed recombinant strain can be used as a cell catalyst for metabolism of EG and synthesis of degrading enzyme, a new method is provided for recycling of PET, and the method has a wide application prospect.

Description

Technical Field

[0001] The invention relates to a genetic engineering bacterium for high-yielding PET degrading enzyme using PET hydrolyzate as a raw material and application thereof, belonging to the technical field of microbial engineering. Background Art

[0002] Polyethylene terephthalate (PET) is a type of plastic that has been widely used around the world due to its advantages such as high mechanical strength, low air permeability, light weight and low cost. A large amount of PET waste is difficult to degrade in nature, resulting in the accumulation of PET in the global ecosystem, causing the loss of nutrients in the land and soil compaction. In addition, a large amount of plastic drifting in the ocean will have an adverse impact on the marine ecosystem.

[0003] According to statistics, the global production of bottle-grade PET has jumped from 19.76 million tons in 2014 to 30.21 million tons in 2022. The continuous growth of global demand for PET and its continued negative impact on the environment have made the accumulation of PET plastics an issue of increasing concern. Therefore, it is urgent to develop new technologies to realize the circular economy of plastics.

[0004] Bio-recycling through microbial depolymerization is a hot research method at present and is currently considered the most promising degradation scheme. It uses microorganisms or enzymes for degradation to produce a hydrolyzate containing terephthalic acid (TPA) and ethylene glycol (EG). Among them, TPA monomer can be obtained by alkali dissolution and acid precipitation, which has a simple process and low cost. However, EG in the hydrolyzate needs to be obtained by distillation, and the separation cost is high. Therefore, the research on the high value of EG remaining in PET hydrolyzate has gradually attracted attention. If it is possible to obtain high value-added products using PET hydrolyzate as a raw material, it will produce huge economic and social benefits. At present, there are still difficulties in using EG as a fermentation raw material for microorganisms, and there are few engineered bacteria that can effectively metabolize EG. If an engineered strain that can efficiently utilize EG in the residual PET hydrolyzate as a carbon source for the expression of recombinant proteins such as PET degrading enzymes can be developed, the continuous process of PET-EG can be achieved. It can not only reduce the cost of purifying monomer products, but also further improve the utilization of PET degradation products. Summary of the invention

[0005] The invention is based on metabolic engineering, constructs a genetic engineering bacterium which uses PET hydrolyzate as a raw material to produce a high-yield PET degrading enzyme, and can produce the degrading enzyme by metabolizing EG.

[0006] The invention provides a polynucleotide sequence having an ethylene glycol metabolism gene and a PET degradation enzyme gene, which sequentially contains a promoter, an ethylene glycol metabolism gene and a PETase synthesis gene from the 5' end to the 3' end; the ethylene glycol metabolism gene is an L-1,2 propanediol oxidoreductase gene FucO and an aldehyde dehydrogenase gene AldA derived from Escherichia coli MG1655.

[0007] In one embodiment, the nucleotide sequence of the FucO gene is shown as SEQ ID NO.2, and the nucleotide sequence of the AldA gene is shown as SEQ ID NO.3.

[0008] In one embodiment, the PETase synthetic gene is the BhrPETase gene derived from bacteria HR29 (the nucleotide sequence is shown in SEQ ID NO.4), the PETase mutant FastPETase gene derived from Ideonella sakaiensis 201-F6 (the nucleotide sequence is shown in SEQ ID NO.8), the PETase mutant DuraPETase gene derived from Ideonella sakaiensis 201-F6 (the nucleotide sequence is shown in SEQ ID NO.9), or the cutinase Tfu_0883 mutant 4Mz gene derived from Thermobifida fusca (the nucleotide sequence is shown in SEQ ID NO.10).

[0009] In one embodiment, the promoter is P gyrA , P tac or P T7 .

[0010] In one embodiment, the promoter P gyrA The nucleotide sequence is shown in SEQ ID NO.1.

[0011] In one embodiment, there is an RBS sequence between the promoter and the FucO gene, and the nucleotide sequence of the RBS sequence is tttgtttaactttaagaaggaga (shown in SEQ ID NO.11).

[0012] In one embodiment, the EG metabolic gene has the function of converting EG into glycolic acid.

[0013] In one embodiment, the PET degrading enzyme is BhrPETase derived from bacteria HR29, and the nucleotide sequence is shown in SEQ ID NO.4.

[0014] In one embodiment, the PET degrading enzyme has a terminator downstream.

[0015] In one embodiment, the terminator is Teminator_1, Teminator_2 or Teminator_3.

[0016] In one embodiment, the Teminator_1 nucleotide sequence is shown as SEQ ID No.5; the Teminator_2 nucleotide sequence is shown as SEQ ID No.6; and the Teminator_3 nucleotide sequence is shown as SEQ ID No.7.

[0017] In one embodiment, the polynucleotide sequence has "P gyrA -RBS-FucO-AldA-PETase synthetic gene-Terminator" shown in the structure.

[0018] The invention also provides a recombinant expression vector containing the polynucleotide sequence.

[0019] In one embodiment, the expression vector uses pACYCDuet-1 as a plasmid backbone.

[0020] The invention provides a recombinant microbial cell containing the recombinant expression vector.

[0021] In one embodiment, the microbial cell comprises an Escherichia coli cell or a Bacillus subtilis cell.

[0022] In one embodiment, the Escherichia coli is E. coli BL21 (DE3), E. coli JM109, E. coli DH5α or E. coli TOP10.

[0023] In one embodiment, the Bacillus subtilis is Bacillus subtilis 168, Bacillus subtilis WS9 or Bacillus subtilis ATCC 6051a.

[0024] In one embodiment, the recombinant microbial cell uses pACYADuet-1 as a vector to express a PET degrading enzyme expression cassette; the PET degrading enzyme expression cassette contains "P gyrA +RBS+FucO+AldA+PETase synthetic gene+Terminator_1" shown in the sequence.

[0025] The present invention also provides a method for preparing PET degrading enzyme, which comprises culturing the recombinant microbial cells in a liquid environment containing ethylene glycol.

[0026] In one embodiment, the method comprises culturing the recombinant microbial cells in LB medium for a period of time, collecting the bacterial cells, and then transferring the bacterial cells to an environment containing ethylene glycol for culturing.

[0027] In one embodiment, the liquid environment containing ethylene glycol includes but is not limited to PET hydrolyzate.

[0028] In one embodiment, the liquid environment containing ethylene glycol includes but is not limited to M9 culture medium containing ethylene glycol.

[0029] In one embodiment, the liquid environment containing ethylene glycol is a mixture of PET hydrolyzate and M9 culture medium.

[0030] In one embodiment, the EG content in the liquid environment containing EG is 3-100 mg / mL.

[0031] In one embodiment, the PET hydrolyzate is a solution containing EG obtained by degrading PET products (beverage bottles, polyester fibers, etc.).

[0032] In one embodiment, the culturing is at ≥25°C for at least 48 hours.

[0033] In one embodiment, the culture temperature is 25-40°C.

[0034] In one embodiment, the inoculation amount is calculated as the mass volume percentage (wt%) of the wet weight of the bacteria to the volume of the solution, specifically 1-12%, or 2-12%, or 4-12%, or 6-12%, or 8-12%, or 1-6%, or 2-6%, or 4-6%.

[0035] In one embodiment, the method is to culture the genetically engineered bacteria in a seed culture medium for 6-12 hours, collect bacterial cells, and inoculate them into a reaction system containing EG or PET hydrolyzate at a transfer rate of 6wt%. The conversion process controls the pH at 7.0-8.0, the temperature at 25-30°C, and the conversion time is 48-72 hours.

[0036] The present invention also claims to protect the microbial preparation containing the genetically engineered bacteria.

[0037] In one embodiment, the microbial preparation contains living cells of the genetically engineered bacteria.

[0038] The present invention also claims to protect the use of the recombinant microbial cells in participating in biological cycles.

[0039] In one embodiment, the application includes but is not limited to the use of PET hydrolysate in preparing PET degrading enzyme or other recombinant proteins.

[0040] Beneficial effects:

[0041] (1) The present invention provides a plasmid containing EG metabolism and PET degradation enzyme synthesis expression units, which can enable host cells to have the ability to metabolize EG and synthesize PET degradation enzymes, and achieve the effect of microbial cells converting EG into glycolic acid to enter central metabolism and express PET degradation enzymes. The recombinant plasmid constructed by the present invention can be used in common hosts such as Escherichia coli and Bacillus subtilis. The constructed recombinant strain can metabolize EG to synthesize PETase, which has more effective economic and social benefits compared to the traditional substrate glucose.

[0042] (2) The recombinant microorganism constructed by the present invention can be used for the decomposition of polyester plastic products. Since ethylene glycol is a potential substrate substitute in PET hydrolysate, the strain constructed by the present invention can utilize PET hydrolysate for the expression of PETase in the key link of PET recycling, which helps to achieve the biodegradation of plastics and convert plastic degradation products into PETase for further use in PET degradation.

[0043] (3) The present invention optimizes the fermentation conditions of the recombinant strain that metabolizes EG to synthesize PETase, and verifies the industrial application effect of the strain at the 3-ton fermentation tank level. At 108 hours of fermentation, the PET degradation enzyme activity can reach 1542.2U / mL, and the protein concentration reaches 9.6g / L, which has a good prospect for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The figure shows the changes of EG content in the culture medium of the recombinant bacteria and the control bacteria.

[0045] Figure 2 The figure shows the changes in bacterial concentration of the recombinant bacteria and the control bacteria during the culture process.

[0046] Figure 3 The figure shows the changes in PET degradation enzyme activity in the fermentation broth of the recombinant bacteria and the control bacteria.

[0047] Figure 4 The figure shows the changes in the production of PET-degrading enzyme in the fermentation broth of the recombinant bacteria and the control bacteria.

[0048] Figure 5 This is the fermentation process curve of the recombinant bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase in a ton-level tank. DETAILED DESCRIPTION

[0049] As used herein, the terms "comprising", "including", "having", and "containing" mean "including but not limited to", "including but not limited to", "having but not limited to", and "containing but not limited to", and can be used interchangeably with the corresponding phrases. Unless the context clearly indicates otherwise, the term "or" used herein is used herein to mean the term "and / or" and can be used interchangeably with it. Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention belongs. Although methods and materials similar or equivalent to the methods and materials described herein can be used in the practice or testing of the present invention, the examples of suitable methods and materials described below are illustrative only and do not limit the present invention in any way.

[0050] The invention constructs a recombinant expression plasmid pCDFDuet-1_FucO-AldA-BhrPETase which can metabolize EG to produce PETase in microbial cells (especially Escherichia coli or Bacillus subtilis).

[0051] Specifically, the core units of the pCDFDuet-1_FucO-AldA-BhrPETase expression plasmid are constructed in the following order from 5' to 3': constitutive promoter (P trc )+protein translation RBS sequence (RBS)+EG metabolism transgenes FucO and AldA+PET degrading enzyme BhrPETase+protein expression terminator (Teminator_1).

[0052] In the above recombinant expression plasmid, the constitutive promoter (P trc ) can also be replaced by P tac or P T7 .

[0053] In the above recombinant expression plasmid, the protein expression terminator can be selected from Teminator_1 shown in SEQ ID NO.5, Teminator_2 shown in SEQ ID NO.6 or Teminator_3 shown in SEQ ID NO.7. Unless otherwise specified, the recombinant expression plasmid constructed with the above terminator has a considerable level of expression effect.

[0054] Furthermore, the recombinant plasmid pCDFDuet-1_FucO-AldA-BhrPETase is introduced into a host cell, thereby obtaining a recombinant microbial cell capable of utilizing PET hydrolysate to produce PET degrading enzyme.

[0055] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The present invention is described below in conjunction with specific examples to better understand the present invention, but the scope of protection of the present invention is not limited to the following description.

[0056] (I) Reagents

[0057] The ethylene glycol (EG) involved in the following examples was purchased from Sigma. The PCR enzyme involved in the following examples was purchased from Baoriyi Biotechnology Co., Ltd. The gene sequencing involved in the following examples was undertaken by Jinweizhi Biotechnology Co., Ltd. The ethylene glycol (EG) and p-nitrophenylbutyrate (pNPB) involved in the following examples were purchased from Sigma. The Escherichia coli involved in the following examples was E.coli BL21 (DE3) and the Bacillus subtilis was Bacillus subtilis ATCC6051a.

[0058] (II) Culture medium formula (g / L):

[0059] LB liquid medium: peptone 10, molecular grade yeast powder 5, NaCl 10.

[0060] LB solid medium: Add 1.5-2.0 g agar to every 100 mL LB liquid medium.

[0061] M9 medium: Na2HPO4 6.78, KH2PO4 3.0, NaCl 0.5, NH4Cl 1.0, MgSO4 7H2O 0.493, CaCl2 0.011.

[0062] (III) Detection methods

[0063] EG concentration determination:

[0064] Standard treatment: Weigh the EG standard and dissolve it in ddH2O to make a mother solution. Use sterile water to dilute the mother solution to a 0.1 mg / mL standard solution, filter it with a 0.22 μM filter head, and inject it into a liquid phase bottle with a syringe for HPLC detection. Draw the standard curve of EG with EG concentration as the horizontal axis and peak area as the vertical axis.

[0065] Sample treatment: 1 mL of culture medium was centrifuged at 12000 rpm for 5 min, filtered with a 0.22 μM filter, injected into a liquid phase bottle with a syringe, and HPLC detection was performed. The specific detection method was: Agilent 1260 high-performance liquid chromatograph, refractive index detector (RID), using Aminex column (HPX-87H, 300×7.8 mm, Bio-Rad); high-performance liquid chromatography conditions: mobile phase: 5 mM sulfuric acid; flow rate 0.6 mL / min; injection volume 5 μL, column temperature 60°C.

[0066] Calculation of EG utilization:

[0067] EG utilization = ([(C0-C1) / C0]*100%;

[0068] C0:: The content of ethylene glycol in the solution before the reaction (mg / mL). C1: The content of ethylene glycol in the solution after the reaction (mg / mL).

[0069] PET degradation enzyme activity assay

[0070] 1. Drawing of p-nitrophenol pNP standard curve:

[0071] Weigh an appropriate amount of p-nitrophenol, dilute to 1000 mL with 10 mM pH 8.0 KH2PO4-K2HPO4 buffer to prepare a 100 μmol / L p-nitrophenol stock solution, and then dilute to 0, 20, 40, 60, 80, 100 μmol / L with KH2PO4-K2HPO4 buffer. Determine the absorbance at a wavelength of 405 nm, plot the standard curve A=a*C+b with the p-nitrophenol concentration C as the abscissa and the absorbance value A as the ordinate.

[0072] 2. Preparation of enzyme activity assay substrate:

[0073] Accurately weigh an appropriate amount of p-nitrophenylbutyrate (pNPB, Sigma, CAS2635-84-9) and dilute to a concentration of 50 mmol / L with acetonitrile. -1 of pNPB solution.

[0074] 3. Preparation of enzyme solution to be tested:

[0075] After the fermentation broth was centrifuged at 8000rpm and 4°C for 15 minutes, the supernatant was harvested. After the ammonium sulfate precipitation step, it was then re-dissolved with 10mM pH 8.0 KH2PO4-K2HPO4 buffer, placed at 60°C, warmed for 1h for heat treatment, and centrifuged at 8000rpm for 15min to remove impurities and obtain the purified enzyme solution. The purified enzyme solution was appropriately diluted, and the dilution multiple was preferably controlled to control the A value at 0.2-0.8. The PET degradation enzyme activity was determined at 37°C. Take 1.5ml of KH2PO4-K2HPO4 buffer to a 0.5cm glass cuvette and adjust to zero at the absorption wavelength of 405nm. Take 1.44 mL of preheated 10 mM pH 8.0 KH2PO4-K2HPO4 buffer into a quartz cuvette, use a pipette to transfer 30 μL of the diluted sample to be tested, add it to the above quartz cuvette, then add 30 μL of substrate solution, shake well and immediately put it into a visible spectrophotometer, and measure the A value at an absorption wavelength of 405 nm. Record the A value every 5 seconds, and the reaction time is 1 minute. Enzyme activity definition: The amount of enzyme required to catalyze the substrate to generate 1 μmol pNP per unit time is defined as one enzyme activity unit.

[0076] calculate:

[0077] Enzyme activity (U / mL) = [[(Kb)V1] / [a V2×1000]]×N;

[0078] Where: K: the slope of the curve of A value and time (min) measured at different times of enzyme reaction;

[0079] V1: reaction volume (mL);

[0080] V2: enzyme addition amount (mL);

[0081] N: dilution multiple.

[0082] Determination of PET-degrading enzyme production:

[0083] The fermentation broth was centrifuged at 4°C and 8000 rpm for 15 minutes, and the supernatant was harvested. After an 80% (w / v) ammonium sulfate precipitation step, it was then re-dissolved with 10 mM pH 8.0 KH2PO4-K2HPO4 buffer, placed at 60°C, heated for 1 h, and centrifuged at 8000 rpm for 15 min to remove impurities and obtain the purified enzyme solution. The protein concentration was measured using a Bradford assay kit (P0006, Beyotime, Shanghai, China).

[0084] Determination of recombinant bacterial concentration

[0085] First, use distilled water as a blank control and adjust the spectrophotometer to zero. Take a certain volume of fermentation broth and dilute it appropriately to ensure that the bacterial broth is within the detection range of the spectrophotometer. Transfer the appropriately diluted fermentation broth to a 1 cm cuvette and place it in the spectrophotometer. Measure the absorbance of the sample at 600 nm and use OD 600 The value was used to estimate the recombinant bacterial concentration.

[0086] Example 1 Preparation of PET hydrolyzate

[0087] With reference to the previous research results of the inventor team, the enzyme protein of PET degrading enzyme (4Mz) was prepared according to the method of the paper "Directional-path modifications strategy enhances PET hydrolase catalysis of plastic degradation". 1L 100mM pH 8 potassium phosphate buffer, 200g PET powder and 0.2g 4Mz enzyme protein were added to a 3L reactor and reacted at 60°C and 200rpm for 96h. During the reaction, 6M NaOH was used to maintain the pH value of 8. The reaction solution was filtered to remove impurities, and the PET hydrolyzate was obtained and diluted with 100mM pH 8 potassium phosphate buffer to obtain PET hydrolyzate with different dilution multiples (Table 1).

[0088] Table 1 PET hydrolyzate at different dilution ratios

[0089]

[0090] Example 2 Preparation of residual PET hydrolyzate after removal of TPA

[0091] The PET hydrolyzate was obtained by referring to the method described in Example 1. 6M NaOH solution was added to 1L of PET hydrolyzate to adjust the pH of the PET hydrolyzate system to 9.0, so that TPA in the PET hydrolyzate was dissolved in the alkaline solution, and then the impurities were filtered to obtain a supernatant. 6M HCl solution was added dropwise to the supernatant, and the pH was gradually adjusted to 4.0 to allow TPA to reprecipitate in an acidic environment and allowed to stand overnight. Centrifugal filtration was performed, the precipitate was discarded, and the pH of the supernatant was adjusted back to 7.0, which was the residual PET hydrolyzate containing only EG. Subsequently, 100mM potassium phosphate buffer with pH 8 was added for dilution to obtain residual PET hydrolyzate with different dilution multiples (Table 2).

[0092] Table 2 Residual PET hydrolyzate at different dilution multiples

[0093]

[0094] Example 3 Preparation of competent Escherichia coli BL21

[0095] Competent solution A: 1.47 g potassium acetate, 4.44 g calcium chloride in 500 mL deionized water, adjust pH to 5.8 with 1 M acetic acid (glacial acetic acid)

[0096] Competent solution B: 1.47 g potassium acetate, 4.44 g calcium chloride, 75 mL, and glycerol were diluted to 500 mL of deionized water, and the pH was adjusted to 5.8 with 1 M acetic acid (glacial acetic acid).

[0097] The competent cell preparation method is as follows:

[0098] (1) Streak the competent E. coli BL21 strain from the glycerol tube onto a non-antibiotic plate and culture at 37°C for 10.5 h.

[0099] (2) Pick a single colony from the streaked plate and place it in 10 mL of LB medium. Culture at 37°C and 200 rpm for 10 h.

[0100] (3) Inoculate 1% of the transferred volume into 50 mL LB medium and culture at 37°C and 200 rpm for 2-2.5 hours.

[0101] (4) The fermentation broth was cooled in ice for 30 min, transferred to two pre-cooled 50 mL centrifuge tubes, and centrifuged at 4°C, 3500 r / min for 10 min. The supernatant was discarded.

[0102] (5) Take an appropriate amount of competent A solution (pre-cooled in advance) and slowly blow it to resuspend the bacteria. Place it on ice for 30 min, then centrifuge it at 3500 rpm and 4°C for 10 min, and discard the supernatant.

[0103] (6) Repeat step (5) once.

[0104] (7) Add an appropriate amount of solution B as needed to slowly suspend the bacteria. Use a pre-cooled pipette tip to pipette 0.1 mL of the bacteria into a pre-cooled 1.5 mL EP tube and store it at -80°C.

[0105] Example 4 Construction and verification of recombinant bacteria with high PET degradation enzyme production

[0106] Using the genome of Escherichia coli MG1655DE3 strain as a template, the fucO gene (nucleotide sequence shown in SEQ ID NO.2) and the aldA gene (shown in SEQ ID NO.3) were cloned and constructed on the pACYCDuet-1 vector. At the same time, the BhrPETase gene (shown in SEQ ID NO.4) was connected to the plasmid to obtain a plasmid containing "P gyrA+RBS+FucO+AldA+BhrPETase+Terminator_1" is the expression frame pACYADuet-1_FucO-aldA-BhrPETase.

[0107] The specific structure is described as follows:

[0108] (1)P gyrA : constitutive promoter, the nucleotide sequence is shown in SEQ ID NO.1;

[0109] (2) RBS: protein translation RBS sequence, the nucleotide sequence is tttgtttaactttaagaaggaga (SEQ ID NO.11);

[0110] (3) FucO and AldAEG to glycolate pathway genes, the fucO and aldA genes are derived from EscherichiacoliMG1655, the nucleotide sequence of the FucO gene is shown in SEQ ID NO.2, and the nucleotide sequence of the AldA gene is shown in SEQ ID NO.3;

[0111] (4) BhrPETase: degradation enzyme synthesis gene. The BhrPETase gene is derived from bacteria HR29. The nucleotide sequence of the BhrPETase gene is shown in SEQ ID NO.4.

[0112] (6) Teminator_1: protein expression terminator, the nucleotide sequence is shown in SEQ ID NO.5.

[0113] Furthermore, the recombinant plasmid was introduced into Escherichia coli BL21 by electroporation, and after chloramphenicol resistance screening, colony PCR verification, and sequencing, the Escherichia coli engineered bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase was obtained.

[0114] The constructed E. coli engineered bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase was inoculated into LB liquid seed medium, cultured at 30°C for 6-12h, and centrifuged at 4000r / min and 4°C for 10min to collect the engineered bacteria. The inoculation amount was 2wt% and inoculated into the transformation liquid for culture (so that the OD of the inoculated bacteria reached 0.95±0.5), and the transformation liquid was M9 medium containing 5mg / mL EG. During the fermentation process, the pH was controlled at 7.0, the temperature was 30°C, and the fermentation was carried out at 150rpm for 72h. gyrAThe recombinant plasmid pACYADuet-1_PETase containing the recombinant plasmid pACYADuet-1_PETase (+RBS+BhrPETase+Terminator_1) was transformed into E. coli to construct the recombinant bacteria BL21_pACYADuet-1_BhrPETase as the control bacteria. Figures 1 to 4 As shown in the figure, the utilization rate of EG by the recombinant bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase was much higher than that of the control bacteria. After 72 hours, the residual EG content in the culture medium of the recombinant bacteria was 1.3 mg / mL; after 48 hours, the density of the recombinant bacteria (OD 600 ) can reach 4.3; after 72h, the PET degradation enzyme produced by the recombinant bacteria had the highest activity, about 105U / mL, and the output was 0.59mg / mL.

[0115] Example 5 Effect of different EG concentrations on the production of PET-degrading enzyme by recombinant bacteria

[0116] The recombinant Escherichia coli BL21_pACYADuet-1_FucO-aldA-BhrPETase constructed in Example 4 was inoculated into LB liquid seed culture medium, cultured at 30°C for 6-12h, and centrifuged at 4000r / min and 4°C for 10min to collect the engineered bacteria. According to the 2wt% inoculation amount, it was inoculated into M9 culture medium containing different concentrations of EG (1mg / mL, 5mg / mL, 10mg / mL, 20mg / mL, 40mg / mL, 60mg / mL, 100mg / mL) for culture (so that the OD of the inoculated bacteria reached 0.95±0.5). During the fermentation process, the pH was controlled at 7.0, the temperature was 30°C, and the fermentation was carried out for 48h. The results are shown in Table 3. As the EG concentration increased, the density, degradation enzyme activity and yield of the recombinant bacteria first increased and then decreased. When the EG concentration reached 20mg / mL, the degradation enzyme activity and yield were the highest, 119.6U / mL and 0.67mg / mL, respectively.

[0117] Table 3 Effect of different EG concentrations on the production of degradation enzymes by engineered E. coli

[0118]

[0119] Example 6 Effect of different temperatures on the production of PET degrading enzyme by engineered Escherichia coli

[0120] The recombinant bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase constructed in Example 5 was inoculated into LB liquid medium, cultured at 30°C for 6-12h, and centrifuged at 4000r / min and 4°C for 10min to collect the engineered bacteria. The inoculum was inoculated into M9 medium containing 20mg / mL EG at a 2wt% inoculum (so that the bacterial concentration after inoculation reached OD 600=1.0) for cultivation. During the fermentation process, pH was controlled at 7.0, and the temperature was different (15°C, 25°C, 30°C, 35°C, 40°C) for 48h. The results are shown in Table 4. As the reaction temperature increased, the density of the recombinant bacteria, the activity of the degradation enzyme and the yield first increased and then decreased slightly. When the temperature reached 25°C, the activity and yield of the degradation enzyme were the highest, which were 129.3U / mL and 0.72mg / mL, respectively.

[0121] Table 4 Effect of different temperatures on the production of PET-degrading enzyme by recombinant Escherichia coli

[0122]

[0123]

[0124] Example 7 Effect of different inoculation amounts on the production of PET degrading enzyme by engineered Escherichia coli

[0125] The recombinant bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase constructed in Example 5 was inoculated into LB liquid seed medium and cultured for 6-12 hours, and the engineered bacteria were collected by centrifugation at 4000r / min and 4°C for 10 minutes. Different inoculation amounts (1wt%, 2wt%, 4wt%, 6wt%, 8wt%, 10wt%, 12wt%) were inoculated into M9 medium containing 20mg / mL EG and cultured to the corresponding OD 600 The results are shown in Table 5. With the increase of inoculation amount, the density of recombinant bacteria, the activity of degradation enzyme and the yield gradually increased and remained unchanged. When the inoculation amount was 8wt%, the activity and yield of degradation enzyme were the highest, which were 161.0U / mL and 0.89mg / mL respectively.

[0126] Table 5 Effect of different inoculation amounts on the production of PET-degrading enzyme by recombinant E. coli

[0127]

[0128] Example 8 Production of PET-degrading enzyme by recombinant Escherichia coli using PET hydrolysate

[0129] The recombinant bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase constructed in Example 5 was inoculated into LB liquid seed culture medium, cultured at 30°C for 6-12h, and centrifuged at 4000r / min and 4°C for 10min to collect the engineered bacteria. The inoculation amount of 6wt% was inoculated into the PET hydrolysate prepared according to the method of Example 1 and the residual PET hydrolysate after removing TPA prepared according to the method of Example 2 for culture. During the fermentation process, the pH was controlled at 7.0, the temperature was 25°C, and the fermentation was carried out for 48h. As shown in Table 6, the utilization rate of the recombinant bacteria for the residual PET hydrolysate after removing TPA was much higher than that of the PET hydrolysate. When the PET hydrolysate was used as the raw material, the degradation enzyme activity of the recombinant bacteria in ×15PET hydrolysate could reach 51.2U / mL, and the PET degradation enzyme yield was 0.28mg / mL. When residual PET hydrolysate was used as raw material, the degradation enzyme activity of the recombinant bacteria in ×10 residual PET hydrolysate could reach 109.7U / mL, and the PET degradation enzyme production was 0.60mg / mL.

[0130] Table 6 Analysis of PET-degrading enzyme produced by recombinant E. coli

[0131]

[0132]

[0133] Example 9 Testing of different PET degradation enzyme expression cassettes introduced into Escherichia coli

[0134] The expression cassettes of different PET degrading enzymes were constructed according to the method of Example 4, except that the BhrPETase gene in the recombinant plasmid pACYADuet-1_FucO-aldA-BhrPETase in Example 4 was replaced with the FastPETase gene (nucleotide sequence as shown in SEQ ID NO.8), the DuraPETase gene (nucleotide sequence as shown in SEQ ID NO.9), and the 4Mz gene (nucleotide sequence as shown in SEQ ID NO.10), respectively, to obtain recombinant plasmids pACYADuet-1_FucO-aldA-FastPETase, pACYADuet-1_FucO-aldA-DuraPETase, and pACYADuet-1_FucO-aldA-4Mz, respectively.

[0135] The above recombinant plasmids were introduced into Escherichia coli using the transformation method in Example 4, BL21_pACYADuet-1_FucO-aldA-FastPETase, BL21_pACYADuet-1_FucO-aldA-DuraPETase, BL21_pACYADuet-1_FucO-aldA-4Mz. The above recombinant bacteria were inoculated into LB liquid seed culture medium, cultured at 30°C for 6-12h, and centrifuged at 4000r / min and 4°C for 10min to collect the engineered bacteria. The inoculation amount was inoculated into ×10 residual PET hydrolyzate at 6wt% for culture. During the fermentation process, the pH was controlled at 7.0, the temperature was 25°C, and the fermentation was carried out for 48h. The results are shown in Table 7, and the recombinant bacteria can produce PET degradation enzymes using PET water degradation liquid. The recombinant bacteria produced 104.8 U / mL (0.57 mg / mL) of FastPETase, 112.1 U / mL (0.61 mg / mL) of DuraPETase, and 124.3 U / mL (0.68 mg / mL) of 4Mz.

[0136] Table 7 The production of different types of PET degrading enzymes by recombinant E. coli

[0137]

[0138] Example 10 Expression cassette introduced into Bacillus subtilis for production of PET degrading enzyme

[0139] The recombinant plasmid pACYADuet-1_FucO-aldA-BhrPETase constructed in Example 4 was introduced into Bacillus subtilis ATCC 6051a (the strain was disclosed in the paper "Multigene disruption inundomesticated Bacillus subtilis ATCC 6051a using the CRISPR / Cas9") by electroporation to construct the recombinant bacteria B.subtilis_pACYADuet-1_FucO-aldA-BhrPETase, and the Bacillus subtilis engineering bacteria were obtained after chloramphenicol resistance screening, colony PCR verification, and sequencing. The constructed Bacillus subtilis engineering bacteria were inoculated into LB liquid culture medium for 6-12h, and the engineering bacteria were collected by centrifugation at 4000r / min and 4°C for 10min. Inoculate in different culture media at 6wt% for culture. During the fermentation process, the pH was controlled at 7.0, the temperature was 25°C, and the fermentation was 48h. The results are shown in Table 8. The Bacillus subtilis engineering bacteria was fermented in 20 mg / mL EG M9 medium for 48 hours, and the BhrPETase degradation enzyme activity was about 135.3 U / mL and the yield was 0.71 mg / mL; the Bacillus subtilis engineering bacteria was fermented in ×15PET hydrolyzate for 48 hours, and the BhrPETase degradation enzyme activity was about 66.0 U / mL and the yield was 0.34 mg / mL; the Bacillus subtilis engineering bacteria was fermented in ×10 residual PET hydrolyzate for 48 hours, and the BhrPETase degradation enzyme activity was about 100.6 U / mL and the yield was 0.52 mg / mL;

[0140] Table 8 PET degradation enzyme produced by engineered Bacillus subtilis

[0141]

[0142] Example 11 Cultivation of recombinant bacteria BL21_pACYADuet-1_FucO-aldA-BhrPETase in a 3-ton fermenter

[0143] Fermentation medium: Na2HPO4 6.78g / L, KH2PO4 3.0g / L, NaCl 0.5g / L, NH4Cl 1.0g / L, MgSO47H2O 0.493g / L, CaCl2 0.011g / L.

[0144] Feed medium: MgSO4 7H2O 18.35 g / L, industrial yeast powder 4.8 g / L, ethylene glycol 500 g / L, pig bone peptone 2.4 g / L.

[0145] (1) Seed activation stage

[0146] From the -80°C glycerol tube, inoculate the bacteria at an inoculation volume of 2.0‰ into 50mL of LB liquid culture (final kanamycin concentration of 30μg / mL), for a total of 2 bottles, and culture on a rotary constant temperature and speed shaker with a controlled temperature of 37°C, a rotation speed of 200rpm, an initial pH of 7.0, and culture for 10h.

[0147] (2) Seed tank culture

[0148] In a clean bench, combine two bottles of seed solution into a 1L sterile triangular flask. Before inoculation, examine the seed solution under a microscope to confirm that there is no contamination by foreign bacteria. Flame inoculate into a 500L seed tank and culture for 20-24 hours.

[0149] (3) Fermentation stage in 3-ton fermenter

[0150] The seed tank was examined under a microscope and showed no foreign bacteria. The bacterial morphology was normal and the seed was transferred to a 3-ton fermentation tank. A final concentration of 30 mg / L kanamycin was added and kanamycin was added every 24 hours. During the fermentation process, the fermentation temperature was always controlled at 33°C with circulating condensed water and 30% (v / v -1 ) of aqueous ammonia solution and 20% (v·v -1 ) to control the pH value of the fermentation process at 7.0±0.5. Couple the speed with dissolved oxygen (DO) to keep the DO value of the fermentation process at 30%±2.5%. Pay attention to the changes in the DO curve in time. When dissolved oxygen rebounds, add feed medium in time, and then adjust the DO value according to OD. 600 The growth of the medium was fed with variable rate flow. Samples were taken every 12 hours during the fermentation process to determine the enzyme activity concentration. The results are as follows Figure 5 As shown, the results show that the activity of PET degrading enzyme gradually increases with the extension of culture time, and the enzyme activity reaches a peak of about 1542.2U / mL at 108h. At this time, the protein concentration of PET degrading enzyme reaches 9.6g / L.

[0151] Comparative Example 1 Effect of ethylene glycol metabolism genes (FucO and AldA) from different sources on the production of PET degrading enzyme in Escherichia coli

[0152] Specific implementation method The same as Example 4, except that the ethylene glycol metabolism genes (FucO and AldA) of the expression frame are adjusted and replaced with FucO and AldA from Pseudomonas putida KT2440, FucO and AldA from Rhodococcus jostii RHA1, and FucO and AldA from Ideonella sakaiensis.

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159] The constructed recombinant plasmid was introduced into Escherichia coli by the transformation method in Example 4, and recombinant bacteria BL21_pACYADuet-1_PpFucO-PpaldA-BhrPETase, BL21_pACYADuet-1_RjFucO-RjaldA-BhrPETase, and BL21_pACYADuet-1_IsFucO-IsaldA-BhrPETase were obtained respectively. 20 mg / mL EG M9 medium, ×15PET hydrolyzate prepared in Example 1, and ×10 residual PET hydrolyzate prepared in Example 2 were used as raw materials, respectively, and fermented according to the method of Example 8. The results are shown in Table 9, and the enzyme production capacity of the strain with the ethylene glycol metabolism gene replaced was significantly reduced.

[0160] Table 9 PET degradation enzyme produced by engineered Escherichia coli

[0161]

[0162] Comparative Example 2 Effects of different promoters on the production of PET-degrading enzyme by Escherichia coli

[0163] The specific implementation is the same as in Example 4, except that the constitutive promoter P of the expression cassette is gyrA Replaced with promoter P ro04351 , P tac and P amiC ; The promoter sequence is as follows:

[0164] Promoter P ro04351 :

[0165] TGATGTCTCCGGGCTGTCGTAGGGTACGGGCGAGTAGCTTCCAACCGCCACGACCTGC

[0166] GCATTTGATGATAACGAGTCCTTTTCCGGGGCTGTCGCCCGGGGTGTCGTGACCCCCGC

[0167] GCCAATCCGCTGTTTCGTGCCTGTTCGCTACAAGATCAACTTTTTGTGTGAATTGTTCGG

[0168] ATTTCGACTGTTGCGTTCGCGGAGTTCATGGTTGACTACAACTGGTCGCAGCTTCTGTGT

[0169] TCGTAGGCTTGAAAGAGTGAACGTTCGCAGGATCGATGTTGCGAACGCGGTGCTCTGCT

[0170] TTTCCTGAGGGGGAAATCTAGAAGTACAGCGGTCGGAACCGGCCCGGCGGACTGTATGTGCTGTCCGCCGAATCCGGTGGTTAGAAAGAGAAGGAAAAGC;

[0171] Promoter P tac :TTGACAATTAATCATCGGCTCGTATAATG;

[0172] Promoter P amiC :

[0173] GAGATTACGGAGAACGGGGCTTGTGGCCGTCCCTGTCGTGTCGTAACGTGTCCACAACGTTGCAGTTCA.

[0174] The above-mentioned recombinant plasmid with the replaced promoter was introduced into Escherichia coli with reference to the transformation method of Example 4, and fermented according to the method of Example 8 using 20 mg / mL EG M9 medium, ×15 PET hydrolyzate prepared in Example 1, and ×10 residual PET hydrolyzate prepared in Example 2 as raw materials. The results are shown in Table 10. ro04351 , P tac or P amiC The expression effect of the constructed expression cassette is far inferior to that of the promoter P gyrA .

[0175] Table 10 PET degradation enzyme produced by engineered Escherichia coli

[0176]

[0177] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A polynucleotide sequence, characterized in that The sequence from the 5' end to the 3' end contains a promoter, an ethylene glycol metabolism gene and a PETase synthesis gene; the ethylene glycol metabolism genes are the FucO gene and the AldA gene; the nucleotide sequence of the FucO gene is shown in SEQ ID NO.2, and the nucleotide sequence of the AldA gene is shown in SEQ ID NO.3; the PETase synthesis gene is the BhrPETase gene, the FastPETase gene, the DuraPETase gene or the 4Mz gene.

2. The polynucleotide sequence according to claim 1, characterized in that The promoter is P gyrA , P tac or P T7 .

3. The polynucleotide sequence according to claim 1 or 2, characterized in that There is an RBS sequence shown in SEQ ID NO.11 between the promoter and the FucO gene.

4. A recombinant expression vector comprising the polynucleotide sequence of any one of claims 1 to 3.

5. The recombinant expression vector according to claim 4, characterized in that pACYCDuet-1 was used as the plasmid backbone.

6. A genetically engineered bacterium containing the recombinant expression vector according to claim 4 or 5.

7. The genetically engineered bacterium according to claim 6, characterized in that: Escherichia coli cells or Bacillus subtilis are used as host cells; the Escherichia coli includes but is not limited to E. coli BL21 (DE3), E. coli JM109, E. coli DH5α or E. coli TOP10; the Bacillus subtilis includes but is not limited to Bacillus subtilis 168, Bacillus subtilis WS9 or Bacillus subtilis ATCC 6051a.

8. A method for preparing a PET degrading enzyme, characterized in that: The genetically engineered bacteria according to claim 6 or 7 are cultured in a liquid environment containing ethylene glycol; the liquid environment containing ethylene glycol includes but is not limited to PET hydrolyzate and a culture medium containing ethylene glycol.

9. The method according to claim 8, characterized in that The culturing is carried out at ≥25°C for at least 48 hours.

10. The present invention also provides the use of the genetically engineered bacteria according to any one of claims 6 to 7 or the method according to any one of claims 8 to 9 in participating in biological circulation.

Images