An expression vector for secretory expression of bovine lactoferrin, Bacillus subtilis and application thereof

Abstract

The invention discloses an expression vector for secreting and expressing bovine lactoferrin, Bacillus subtilis and application thereof, and belongs to the field of genetic engineering technology. The expression vector is constructed with pMA5 as a skeleton, and the expression vector contains a promoter and an optimized bovine lactoferrin gene in sequence, and a gene encoding a signal peptide is connected between the promoter and the optimized bovine lactoferrin gene, and the signal peptide is SP ywbN , SP amyE , SP PhoB or SP pel The optimized bovine lactoferrin gene is optimized according to the codon preference of the host strain, and can smoothly express bovine lactoferrin in the host strain without causing toxicity to the host strain. The signal peptide encoding gene can achieve the secretory expression of bovine lactoferrin and increase the secretory expression of bovine lactoferrin, thereby simplifying the subsequent separation and purification process of bovine lactoferrin and saving production costs.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an expression vector for secretory expression of bovine lactoferrin, Bacillus subtilis and applications thereof. Background Art

[0002] At present, there are two main methods for preparing bovine lactoferrin (BLF): the first is to separate it from food, which is mainly obtained by ultrafiltration, dialysis, ammonium sulfate precipitation and membrane filtration during the separation process; the second method is to obtain it using a recombinant expression system of microorganisms. The extraction of BLF from bovine milk is inefficient and costly, and heterologous expression of BLF using a recombinant expression system is currently a hot topic in scientific research. The recombinant expression systems of BLF include bacterial expression systems, fungal expression systems and transgenic mammals. In addition, the expression level of the recombinant product and its structural similarity with natural lactoferrin are also increasing.

[0003] Bacillus subtilis is a recognized food safety-grade microorganism with the advantages of high efficiency, solubility, safety, wide adaptability, high plasmid stability and low cost. It is also a typical secretory expression strain. Through secretory expression, the subsequent protein purification steps can be reduced, saving the cost of industrial production. It is one of the most widely used expression systems.

[0004] However, since bovine lactoferrin has a broad spectrum of antibacterial properties, heterologous expression of BLF in Bacillus subtilis will be toxic to the host and have a significant impact on cell growth. In addition, the molecular weight of BLF is ≥80 kDa, which makes it difficult for Bacillus subtilis to secrete and express it. That is, BLF currently has problems such as difficulty in expression, low expression level and difficulty in secretion in the Bacillus subtilis expression system, and most studies focus on the expression of BLF fragments, and there are few reports on the efficient secretion expression of full-length bovine lactoferrin in Bacillus subtilis. Summary of the invention

[0005] In view of this, the object of the present invention is to provide an expression vector, Bacillus subtilis and application thereof for secretory expression of bovine lactoferrin, so as to overcome the problems of difficult expression, low expression level and difficulty in secretion of bovine lactoferrin in the prior art.

[0006] In the first aspect, the present invention provides an expression vector for secretory expression of bovine lactoferrin, the expression vector is constructed with pMA5 as the skeleton, the expression vector contains a promoter and an optimized bovine lactoferrin gene in sequence, and a gene encoding a signal peptide is connected between the promoter and the optimized bovine lactoferrin gene, and the signal peptide is SP ywbN , SP amyE , SP PhoB or SPpel .

[0007] Furthermore, SP ywbN The amino acid sequence is shown in SEQ ID NO.8.

[0008] SP amyE The amino acid sequence is shown in SEQ ID NO.2.

[0009] SP PhoB The amino acid sequence is shown in SEQ ID NO.4.

[0010] SP pel The amino acid sequence is shown in SEQ ID NO.6.

[0011] Preferably, SP ywbN The nucleotide sequence encoding the gene is shown in SEQ ID NO.9.

[0012] SP amyE The nucleotide sequence encoding the gene is shown in SEQ ID NO.3.

[0013] SP PhoB The nucleotide sequence encoding the gene is shown in SEQ ID NO.5.

[0014] SP pel The nucleotide sequence encoding the gene is shown in SEQ ID NO.7.

[0015] Furthermore, the nucleotide sequence of the optimized bovine lactoferrin gene is shown in SEQ ID NO.1.

[0016] Furthermore, the promoter is a tandem dual promoter, and the tandem dual promoter is: in promoter P ylbp Upstream tandem promoter P HpaⅡ .

[0017] Furthermore, the promoter P ylbp The nucleotide sequence is shown in SEQ ID NO. 12; the promoter P HpaⅡ The nucleotide sequence is shown in SEQ ID NO.13.

[0018] In a second aspect, the present invention provides a method for constructing an expression vector for secretory expression of bovine lactoferrin, comprising the following steps:

[0019] The optimized bovine lactoferrin gene was amplified by PCR, the backbone vector pMA5 was double-digested, and the double-digested products of the optimized bovine lactoferrin gene and the backbone vector pMA5 were ligated using T4 DNA ligase to obtain the plasmid pMA5-BLF.

[0020] The plasmid pMA5-BLF was digested with restriction endonucleases, and the linearized vector obtained by the digestion was connected with the coding gene of the signal peptide amplified by PCR through seamless cloning to obtain a recombinant plasmid.

[0021] The recombinant plasmid was used as a template, and the original promoter on the recombinant plasmid was removed by PCR amplification to obtain a linearized vector. The linearized vector after PCR amplification and the promoter after PCR amplification were connected by seamless cloning to obtain an expression vector for secretory expression of bovine lactoferrin.

[0022] In a third aspect, the present invention provides a Bacillus subtilis that secretes and expresses bovine lactoferrin, wherein the Bacillus subtilis contains any one of the above expression vectors; the Bacillus subtilis is B. subtilis WB600.

[0023] In a fourth aspect, the present invention provides a method for constructing the above-mentioned Bacillus subtilis that secretes and expresses bovine lactoferrin, comprising the following steps:

[0024] The activated Bacillus subtilis was inoculated into SPⅠ medium for cultivation. When the bacteria grew to the end of logarithmic growth, the bacterial liquid was inoculated into SPⅡ medium for cultivation for 1.5~2h, and EGTA solution was added to continue cultivation for 10~15min to obtain Bacillus subtilis competent cells.

[0025] The expression vector for secretory expression of bovine lactoferrin is transferred into Bacillus subtilis competent cells to obtain Bacillus subtilis for secretory expression of bovine lactoferrin.

[0026] In a fifth aspect, the present invention provides an application of an expression vector for secretory expression of bovine lactoferrin, wherein the expression vector is applied to produce bovine lactoferrin.

[0027] In a sixth aspect, the present invention provides an application of Bacillus subtilis that secretes and expresses bovine lactoferrin, wherein the Bacillus subtilis is applied to produce bovine lactoferrin.

[0028] Compared with the prior art, the expression vector for secretory expression of bovine lactoferrin of the present invention has the following technical effects:

[0029] (1) Compared with the prior art, the expression vector for secretory expression of bovine lactoferrin constructed by the present invention with pMA5 as the backbone contains a promoter and an optimized bovine lactoferrin gene in sequence. The optimized bovine lactoferrin gene is obtained by optimizing the codon preference of the host strain, and can smoothly express bovine lactoferrin in the host strain under the regulation of the promoter without causing toxicity to the host strain. In addition, a gene encoding a signal peptide is connected between the promoter and the optimized bovine lactoferrin gene in the expression vector constructed by the present invention. The signal peptide is SP ywbN, SP amyE , SP PhoB or SP pel These signal peptides can all achieve the secretory expression of bovine lactoferrin and increase the secretory expression level of bovine lactoferrin, thereby simplifying the subsequent separation and purification process of bovine lactoferrin and saving production costs.

[0030] (2) The bovine lactoferrin gene contained in the expression vector for secretory expression of bovine lactoferrin of the present invention is a full-length bovine lactoferrin gene obtained by optimizing the codon preference of Bacillus subtilis. After the expression vector containing the optimized bovine lactoferrin gene is transferred into Bacillus subtilis, the full-length bovine lactoferrin can be successfully expressed in Bacillus subtilis. The full-length bovine lactoferrin is active and has no toxic effect on the host.

[0031] (3) The promoter in the expression vector for secretory expression of bovine lactoferrin of the present invention is a tandem dual promoter, and the specific selection of the tandem dual promoter is limited. Compared with a single promoter, the tandem dual promoter further improves the secretory expression level of bovine lactoferrin in the host strain. DETAILED DESCRIPTION

[0032] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0033] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0034] Construction of recombinant plasmid pMA5-BLF

[0035] (1) Amplification of target gene

[0036] The gene sequence of bovine lactoferrin (Genbank No. L08604.1) was retrieved from the NCBI database, and the optimized bovine lactoferrin gene sequence was obtained according to the codon preference of Bacillus subtilis (B. subtilis), and the nucleotide sequence thereof was shown in SEQ ID NO. 1. The last three bases TAA of the nucleotide sequence are the termination codons, which are used to terminate the expression of bovine lactoferrin.

[0037] The optimized bovine lactoferrin gene sequence was cloned into the pET-32a vector to obtain the recombinant expression vector pET-32a-BLF.

[0038] PCR amplification was performed using the recombinant expression vector pET-32a-BLF as a template and X1 and X2 as primers.

[0039] X1:CCTAAAAAGGAGCGATTTACATGGATCCATGAGCGATAAAATTATTCACCTGACTGACG (SEQ IDNO.14).

[0040] X2: AGCTTGAGCTCGACTCTAGAGCTTAACGTGTCAGAAAGGCGCA (SEQ ID NO.15).

[0041] After PCR amplification, 0.8% agarose gel was used for electrophoresis, and the band size was observed under the ultraviolet light of the gel imager. The gel was cut, and the purified target gene (i.e., the optimized bovine lactoferrin gene) was extracted according to the instructions of the gel recovery kit (Omega Feiyang Bioengineering Co., Ltd.), and the nucleic acid concentration was tested. The gene fragment concentration was 62.95 ng / µL.

[0042] (2) Double restriction digestion of vector pMA5

[0043] According to the instruction manual of the plasmid extraction kit (Omega Biotechnology Co., Ltd.), the pMA5 plasmid was extracted and the plasmid concentration was detected to be 107.85 ng / µL.

[0044] The composition of the pMA5 plasmid is as follows: promoter: Hpall promoter; replicon: ColE1 Ori, F1 Ori; prokaryotic resistance: Ampicillin, Kanamycin; plasmid size: 7202 bp.

[0045] use Nde I. BamH The pMA5 plasmid was double-digested with I Fast Digest (Thermo Fisher Scientific), verified by 0.8% agarose gel electrophoresis, and recovered using a gel recovery kit (Omega Biotechnology Co., Ltd.) to obtain a linearized plasmid. The nucleic acid concentration was tested and the linearized plasmid concentration was 44.85 ng / µL.

[0046] (3) Ligation of target gene and vector pMA5

[0047] The target gene and the double-enzyme digestion product of pMA5 were connected at a molar ratio of 5:1 using T4 DNA ligase to construct a recombinant plasmid pMA5-BLF. In the recombinant plasmid pMA5-BLF, the target gene was connected to the Hpall promoter.

[0048] (4) Conversion and verification

[0049] The ligation product obtained in step (3) was transformed into E. coli DH5α competent cells by heat shock, and incubated inverted in LBA liquid culture medium (10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride, pH 7.0, after sterilization, 100 mg / L ampicillin was added when the culture medium was cooled to 50°C, and mixed before use) at 37°C for 12 h. A single colony grown on the plate was picked up with a sterilized toothpick for colony PCR verification, and the successfully constructed recombinant plasmid pMA5-BLF was obtained. Example 2

[0050] Construction of recombinant strain WB600-pMA5-BLF and induction of bovine lactoferrin expression

[0051] Bacillus subtilis WB600 (i.e. B. subtilis WB600) was separated by streaking on LBK solid plates (10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride, 20 g / L agar powder, pH 7.0, after sterilization, 50 mg / L kanamycin was added to the culture medium after cooling to 50°C, and mixed before use), and then transferred to LBK liquid culture medium for culture after activation. After culture at 37°C and 180 r / min for 12 h, 200 μL was taken from the bacterial liquid and transferred to 10 mL SPⅠ culture medium. After culture at 37°C and 100 r / min for 3 h, the bacterial density OD was measured. 600 When the bacteria grow to the end of logarithmic growth, take out 1 mL of bacterial solution and inoculate it into 10 mL of SPⅡ medium. Culture it at 37℃ and 100 r / min for 1.5 h. Then, add 100 μL of 100×EGTA solution to the bacterial solution. Culture it at 37℃ and 100 r / min for 10 min. Take 500 μL of bacterial solution and distribute it into 1.5 mL sterile centrifuge tubes to obtain Bacillus subtilis WB600 competent cells.

[0052] Among them, SPⅠ culture medium: 98mL SPⅠ A solution (ammonium sulfate 4g / L, potassium dihydrogen phosphate 12g / L, anhydrous dipotassium hydrogen phosphate 28g / L, sodium citrate trihydrate 2g / L), 98mL SPⅠ B solution (magnesium sulfate heptahydrate 0.4g / L), 2mL 50% glucose solution, 2mL 100×CAYE (casein hydrolysate 20g / L, yeast extract 100g / L), mix well before use.

[0053] SPⅡ medium: 98mL SPⅠ medium, 1mL 50mmol / L calcium chloride solution, 1mL 250mmol / L magnesium chloride hexahydrate solution, mix well before use.

[0054] The plasmid pMA5-BLF constructed in Example 1 was added to the above-mentioned Bacillus subtilis WB600 competent cells, gently mixed, and cultured at 37°C and 100 r / min for 30 min. The speed was then increased to 250 r / min and cultured for 1.5 h. The cells were centrifuged at 4°C and 4000 r / min for 5 min, the supernatant was discarded to collect the cells, and the cells were resuspended in a ratio of 1 g of cells to 5 mL of buffer using 50 mmol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer with a pH value of 7.0, and spread on an LBK plate. The cells were inverted and cultured at 37°C for 12 h. The single colony obtained from the plate was the Bacillus subtilis engineering strain, named WB600-pMA5-BLF.

[0055] Pick a single colony of the WB600-pMA5-BLF recombinant bacteria and inoculate it into 5 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate, and culture it in a shaker at 37°C and 220 r / min for 12 hours to obtain seed liquid. Inoculate the seed liquid into 2L of TB liquid medium (12 g / L peptone, 24 g / L yeast extract, 16.4 g / L disodium hydrogen phosphate, 2.3 g / L sodium dihydrogen phosphate, 7.5 g / L glycine, 5 g / L glycerol, pH 7.0) containing 50 μg / mL kanamycin sulfate at a volume ratio of 3%, and expand the culture in a constant temperature shaker at 37°C and 220 r / min for 16 hours. After the culture was completed, the cells were centrifuged at 4°C and 4000 r / min for 30 min in a low-temperature refrigerated centrifuge to collect the cells. The cells were resuspended in PBS buffer (50 mmol / L sodium dihydrogen phosphate-sodium dihydrogen phosphate buffer with a pH value of 7.0) at a ratio of 1 g of cells to 5 mL of buffer. The cells were broken by a high-pressure homogenizer to release the intracellular proteins. 2+ The protein was purified by column affinity chromatography to obtain BLF eluate. The purified BLF eluate was concentrated and desalted using an ultrafiltration tube, and the concentration of bovine lactoferrin was measured by the BCA method to be 25.1 μg / L. Example 3

[0056] Screening signal peptides

[0057] According to the instructions of the bacterial genome extraction kit (Tiangen Biochemical Technology Co., Ltd.), the genome of Bacillus subtilis 168 was extracted and four pairs of primers were designed, namely, signal peptide SP amyE , SP PhoB , SP pel , SP ywbN Upstream and downstream primers of the coding gene. Using the genome of Bacillus subtilis 168 as a template, the designed four pairs of primers were used for PCR amplification, 0.8% agarose gel electrophoresis, and the signal peptide coding gene fragment was purified using a gel recovery kit (Omega Feiyang Biotechnology Co., Ltd.).

[0058] Signal peptide SP amyE The amino acid sequence is shown in SEQ ID NO. 2, the gene sequence is shown in SEQ ID NO. 3, and the primer sequences are as follows:

[0059] SP1:AGGAGCGATTTACATATGTTTGCAAAACGATTCAAAACCTCTTT (SEQ ID NO.16).

[0060] SP2:AATGCCATGTTTCATAAGCACTCGCAGCCGC (SEQ ID NO. 17).

[0061] Signal peptide SP PhoB The amino acid sequence is shown in SEQ ID NO.4, the gene sequence is shown in SEQ ID NO.5, and the primer sequences are as follows:

[0062] SP3:AGGAGCGATTTACATATGAAAAAATTCCCGAAGAAATTACTGCCTATC (SEQ ID NO. 18).

[0063] SP4:AATGCCATGTTTCATAGGCGCTGGCTTCAGGC (SEQ ID NO. 19).

[0064] Signal peptide SP pel The amino acid sequence is shown in SEQ ID NO.6, the gene sequence is shown in SEQ ID NO.7, and the primer sequences are as follows:

[0065] SP17:AGGAGCGATTTACATATGAAAAAAGTGATGTTAGCTACGGCTTT (SEQ ID NO.20).

[0066] SP18:AATGCCATGTTTCATACTGCGTTCGCGCCAGC (SEQ ID NO. 21).

[0067] Signal peptide SP ywbN The amino acid sequence is shown in SEQ ID NO.8, the gene sequence is shown in SEQ ID NO.9, and the primer sequences are as follows:

[0068] SP23:AGGAGCGATTTACATATGAGCGATGAACAGAAAAAGCCAGA (SEQ ID NO. 22).

[0069] SP24:AATGCCATGTTTCATACTGGCTTAGCCGCAGTCTGA (SEQ ID NO. 23).

[0070] use BamH ⅠFast Digest (Thermo Fisher Scientific) was used to perform single restriction digestion on the recombinant plasmid pMA5-BLF constructed in Example 1, followed by 0.8% agarose gel electrophoresis, and a gel recovery kit (Omega Biotechnology Co., Ltd.) was used to purify the single restriction fragment of the recombinant plasmid pMA5-BLF.

[0071] The single enzyme-cut fragment of pMA5-BLF and the signal peptide encoding gene were connected using the ClonExpress® UltraOneStep Cloning Kit (Vazyme Biotech Co., Ltd.). Prepare the reaction system on ice, prepare each reaction system according to Table 1, mix gently, react in a 50°C water bath for 5 min, and then immediately cool on ice to obtain secretory recombinant expression vectors containing different signal peptide encoding genes. The signal peptide is located at the N-terminus of the secretory protein.

[0072] Table 1 Seamless cloning system

[0073]

[0074] Single fragment homologous recombination reaction:

[0075] The optimal amount of single enzyme-cut fragment added = [0.02 × single enzyme-cut fragment base pair number] ng (0.03 pmol)

[0076] The optimal amount of signal peptide fragment added = [0.04 × number of base pairs of signal peptide fragment] ng (0.06 pmol)

[0077] After the connection was completed, four secretory recombinant expression vectors containing different signal peptide encoding genes were constructed: pMA5-SP amyE -BLF, pMA5-SP PhoB -BLF, pMA5-SP pel -BLF, pMA5-SP ywbN -BLF.

[0078] The above four secretory recombinant expression vectors were added to the Bacillus subtilis WB600 competent cells prepared in Example 2, and gently mixed. The cells were cultured at 37°C and 100 r / min for 30 min, and then the speed was increased to 250 r / min and cultured for 1.5 h. The cells were collected by centrifugation, the supernatant was discarded, the cells were resuspended, and spread on LBK plates. The cells were inverted and cultured at 37°C for 12 h to obtain four Bacillus subtilis engineered strains containing different signal peptide encoding genes, which were named: WB600-SP amyE -BLF, WB600-SP PhoB -BLF, WB600-SP pel -BLF, WB600-SP ywbN -BLF.

[0079] Single colonies of the above four recombinant strains were picked up respectively, inoculated into 5 mL LBK liquid medium, and cultured in a shaker at 37°C and 220 r / min for 12 h. The seed liquid was transferred to 2 L TB liquid medium containing 50 μg / mL kanamycin sulfate at a volume ratio of 3%, and expanded in a constant temperature shaker at 37°C and 220 r / min for 16 h. After the culture, a low-temperature refrigerated centrifuge was used to centrifuge at 4°C and 4000 r / min for 30 min. The bacteria were discarded, and the supernatant after the fermentation was collected to detect the bovine lactoferrin content in the supernatant. The results are shown in Table 2.

[0080] Table 2

[0081]

[0082] From the above results, we can know that:

[0083] Among the four signal peptides, the signal peptide SP from the Tat secretion pathway ywbN The secretory expression of bovine lactoferrin BLF had the best effect, with a content of 38.69 μg / L; SP from the Sec pathway amyE , SP PhoB and SP pel The secretion expression ability decreased in sequence, and the protein contents were 30.62μg / L, 28.95μg / L and 25.17μg / L respectively. ywbN -BLF can successfully achieve the secretory expression of bovine lactoferrin, and the secretory expression effect is the best. Example 4

[0084] Screening for single promoter

[0085] According to the instructions of the bacterial genome extraction kit (Tiangen Biochemical Technology Co., Ltd.), the genome of Bacillus subtilis 168 was extracted and three pairs of primers were designed, namely, promoter P 43 , PamyQ , P ylbp The genome of Bacillus subtilis 168 was used as a template, and the three designed primer pairs were used for PCR amplification and 0.8% agarose gel electrophoresis, and the promoter fragment was purified using a gel recovery kit (Omega Feiyang Biotechnology Co., Ltd.).

[0086] Promoter P 43 The gene sequence is shown in SEQ ID NO. 10, and the primer sequences are as follows:

[0087] P1:GTGATCTCTCAAAAAATGATAGGTGGTATGTTTTCGCTTGAACT (SEQ ID NO.24).

[0088] P2: TGTTCATCGCTCATATGGTGTACATTCCTTCTCTTACCTATAATGGTACC (SEQ ID NO. 25).

[0089] Promoter P amyQ The gene sequence is shown in SEQ ID NO. 11, and the primer sequences are as follows:

[0090] P13:GTGATCTCTCAAAAAAGGCGGCGTTCTGTTTCTG (SEQ ID NO. 26).

[0091] P14: TGTTCATCGCTCATATGTAACGGCAGTAAAGAGGTTTTGAATCGTTTT (SEQ ID NO.27).

[0092] Promoter P ylbp The gene sequence is shown in SEQ ID NO. 12, and the primer sequences are as follows:

[0093] P15:GTGATCTTCTCAAAAAAGTCACAACAGTCACGTCGTGATAAAG (SEQ ID NO.28).

[0094] P16: TGTTCATCGCTCATATGACAAATCTCCCCCTTTGTTGTTTCTACA (SEQ ID NO. 29).

[0095] pMA5-SP ywbN -BLF was used as a template, and the original P on the plasmid was removed by PCR amplification using primers Q1 and Q2. HpaⅡ promoter, and the amplified vector was directly used as a template for linearization.

[0096] Q1: CATATGAGCGATGAACAGAA (SEQ ID NO.30).

[0097] Q2:TTTTTTGAGAAGATCACTCAAA (SEQ ID NO.31).

[0098] The gel-recovered products of the above three promoters and the above linearized template were heated in a 50°C water bath for 5 min under the action of the homologous recombinase of the ClonExpress® Ultra One Step Cloning Kit (Vazyme Biotech Co., Ltd.), and then immediately placed on ice to obtain the ligation products: 3 secretory recombinant expression vectors containing different single promoters.

[0099] The above three secretory recombinant expression vectors containing different single promoters: pMA5-P 43 -SP ywbN -BLF, pMA5-P amyQ -SP ywbN -BLF, pMA5-P ylbp -SP ywbN -BLF, respectively, using the heat shock method to introduce into E. coli DH5α competent cells. The three kinds of transformants grown were inoculated into 10mL LBA liquid culture medium and cultured for 12h, and then the recombinant plasmids were extracted and added to the competent cells of Bacillus subtilis WB600 prepared in Example 2, respectively, and gently mixed, 37°C, 100r / min, cultured for 30min, then increased the speed to 250r / min, cultured for 1.5h, centrifuged to collect the cells, discarded the supernatant and resuspended the cells, and spread on the LBK plate, 37°C inverted culture for 12h, and obtained 3 Bacillus subtilis engineered strains containing different single promoters, respectively named: WB600-P 43 -SP ywbN -BLF, WB600-P amyQ -SP ywbN -BLF, WB600-P ylbp -SP ywbN -BLF.

[0100] Single colonies of the above three recombinant strains were picked up respectively, inoculated into 5 mL LBK liquid medium, and cultured in a shaker at 37°C and 220 r / min for 12 h. The seed liquid was transferred to 2 L TB liquid medium containing 50 μg / mL kanamycin sulfate at a volume ratio of 3%, and expanded in a constant temperature shaker at 37°C and 220 r / min for 16 h. After the culture, a low-temperature refrigerated centrifuge was used to centrifuge at 4°C and 4000 r / min for 30 min. The bacteria were discarded, and the supernatant after the fermentation was collected to detect the bovine lactoferrin content in the supernatant. The results are shown in Table 3.

[0101] Table 3

[0102]

[0103] The above results show that there are great differences in the expression effects mediated by different promoters, among which the single promoter P ylbp The expression effect of promoter P was the best, and the content of bovine lactoferrin in the fermentation broth was 54.71 μg / L; followed by promoter P 43 and P amyQ , the bovine lactoferrin contents in the supernatant were 45.69 μg / L and 40.32 μg / L, respectively. Example 5

[0104] Screening for tandem dual promoters

[0105] The inventors found through research that in addition to the promoter P ylbp The recombinant strain expressed lactoferrin at the highest level. 43 , P amyQ , P HpaⅡ The recombinant strain mediated by PCR also secreted a high level of lactoferrin, so these four promoters were selected and connected in series to construct a dual-promoter expression recombinant strain. ylbp The upstream of 43 , P amyQ , P HpaⅡ , P ylbp .

[0106] Four pairs of primers were designed respectively, using the Bacillus subtilis 168 genome or pMA5 plasmid as template, and PCR amplification and 0.8% agarose gel electrophoresis were performed. The promoter fragments were purified using a gel recovery kit (Omega Feiyang Biotechnology Co., Ltd.) for the next experiment. HpaⅡ The gene sequence is shown in SEQ ID NO. 13. Promoter P HpaⅡ The pMA5 plasmid was used as a template for PCR amplification, and the genome of Bacillus subtilis 168 was used as a template for other promoters.

[0107] Promoter P ylbp The primer sequences are as follows:

[0108] S1:GGGAGATTTGTCATAGTCACAACAGTCACGTCG (SEQ ID NO.32).

[0109] S2: TGTTCATCGCTCATAACAAATCTCCCCCTTTGTT (SEQ ID NO.33).

[0110] Promoter P 43 The primer sequences are as follows:

[0111] S3:GGGAGATTTGTCATATGATAGGTGGTATGTTTTCGC (SEQ ID NO. 34).

[0112] S4: TGTTCATCGCTCATAGTGTACATTCCTCCTTACCTATAAT (SEQ ID NO. 35).

[0113] Promoter P amyQ The primer sequences are as follows:

[0114] S5:GGGAGATTTGTCATAGGCGGCGTTCTGTTTCTG (SEQ ID NO. 36).

[0115] S6: TGTTCATCGCTCATATAACGGCAGTAAAGAGGTTTTGAA (SEQ ID NO. 37).

[0116] Promoter P HpaⅡ The primer sequences are as follows:

[0117] S7:GGGAGATTTGTCATACTACCTGTCCCTTGCTG (SEQ ID NO. 38).

[0118] S8: TGTTCATCGCTCATAGTAAATCGCTCCTTTTAGGTG (SEQ ID NO. 39).

[0119] use BamH Ⅰ Fast Digest (Thermo Fisher Scientific) digested vector pMA5-P ylbp -SP ywbN-BLF, 0.8% agarose gel electrophoresis, using the gel recovery kit (Omega Feiyang Biotechnology Co., Ltd.) to purify the recombinant plasmid pMA5-P ylbp -SP ywbN - Single enzyme digestion fragment of BLF.

[0120] The four kinds of promoter gel recovery and purification products were respectively combined with the above single enzyme gel recovery fragments under the action of the homologous recombinase of ClonExpress® UltraOne Step Cloning Kit Seamless Cloning Kit (Vazyme Biotech Co., Ltd.) in a 50°C water bath for 5 minutes, and then immediately placed on ice to obtain the connection product. The connection product was introduced into E. coli DH5α competent cells by heat shock transformation. The grown transformants were cultured in 10mL liquid LBA medium for 12 hours, and then the recombinant plasmids were extracted to obtain four secretion recombinant expression vectors pMA5-P containing different tandem dual promoters. 43 -P ylbp -SP ywbN -BLF, pMA5-P amyQ -P ylbp -SP ywbN -BLF, pMA5-P ylbp -P ylbp -SP ywbN -BLF, pMA5-P HpaⅡ -P ylbp -SP ywbN -BLF.

[0121] The above four secretory recombinant expression vectors were added to the Bacillus subtilis WB600 competent cells prepared in Example 2, and gently mixed. The cells were cultured at 37°C and 100 r / min for 30 min, and then the speed was increased to 250 r / min and cultured for 1.5 h. The cells were collected by centrifugation, the supernatant was discarded, the cells were resuspended, and spread on LBK plates. The cells were inverted and cultured at 37°C for 12 h to obtain four Bacillus subtilis engineered strains containing different tandem dual promoters, which were named as: WB600-P 43 -P ylbp -SP ywbN -BLF, WB600-P amyQ -P ylbp -SP ywbN -BLF, WB600-P ylbp -P ylbp -SP ywbN -BLF, WB600-P HpaⅡ -P ylbp -SP ywbN -BLF.

[0122] Single colonies of the above four recombinant strains were picked up respectively, inoculated into 5 mL LBK liquid medium, and cultured in a shaker at 37°C and 220 r / min for 12 h. The seed liquid was transferred to 2 L TB liquid medium containing 50 μg / mL kanamycin sulfate at a volume ratio of 3%, and expanded in a constant temperature shaker at 37°C and 220 r / min for 16 h. After the culture, a low-temperature refrigerated centrifuge was used to centrifuge at 4°C and 4000 r / min for 30 min. The bacteria were discarded, and the supernatant after the fermentation was collected to detect the bovine lactoferrin content in the supernatant. The results are shown in Table 4.

[0123] Table 4

[0124]

[0125] From the above results, we can see that compared with the single promoter P ylbp The expression effect of the double promoter P 43 -P ylbp , P amyQ -P ylbp , P ylbp -P ylbp When bovine lactoferrin was secreted and expressed, the expression level of bovine lactoferrin was reduced. This is because the selected single promoter has a strong promoter strength, which will interfere or compete with each other when connected in series, resulting in a decrease in expression level. HpaⅡ -P ylbp It showed good protein secretion ability, and the expression level of bovine lactoferrin secretion mediated by it was significantly increased, with the content of bovine lactoferrin in the supernatant reaching 85.93μg / L.

[0126] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An expression vector for secretory expression of bovine lactoferrin, characterized in that: The expression vector is constructed with pMA5 as the skeleton, and contains a promoter and an optimized bovine lactoferrin gene in sequence. A gene encoding a signal peptide is connected between the promoter and the optimized bovine lactoferrin gene, and the signal peptide is SP ywbN The promoter is a tandem dual promoter, wherein the tandem dual promoter is: ylbp Upstream tandem promoter P HpaⅡ ; The SP ywbN The amino acid sequence is shown in SEQ ID NO.8; The nucleotide sequence of the optimized bovine lactoferrin gene is shown in SEQ ID NO.1; The promoter P ylbp The nucleotide sequence is shown in SEQ ID NO. 12; the promoter P HpaⅡ The nucleotide sequence is shown in SEQ ID NO.

13.

2. A method for constructing an expression vector for secretory expression of bovine lactoferrin as claimed in claim 1, characterized in that: The following steps are involved: The optimized bovine lactoferrin gene was amplified by PCR, the backbone vector pMA5 was double-digested, and the double-digested products of the optimized bovine lactoferrin gene and the backbone vector pMA5 were connected using T4 DNA ligase to obtain the plasmid pMA5-BLF; The plasmid pMA5-BLF is digested with a restriction endonuclease, and the linearized vector obtained by the digestion is connected with the coding gene of the signal peptide amplified by PCR through a seamless cloning method to obtain a recombinant plasmid; The recombinant plasmid is used as a template, and the original promoter on the recombinant plasmid is removed by PCR amplification to obtain a linearized vector. The linearized vector amplified by PCR and the promoter amplified by PCR are connected by a seamless cloning method to obtain an expression vector for secretory expression of bovine lactoferrin.

3. A Bacillus subtilis that secretes and expresses bovine lactoferrin, characterized in that: The Bacillus subtilis contains the expression vector according to claim 1; the Bacillus subtilis is B. subtilis WB600.

4. A method for constructing the Bacillus subtilis that secretes and expresses bovine lactoferrin according to claim 3, characterized in that: The following steps are involved: The activated Bacillus subtilis was inoculated into SPⅠ medium for cultivation. When the bacteria grew to the end of logarithmic growth, the bacterial liquid was inoculated into SPⅡ medium for cultivation for 1.5-2h, and EGTA solution was added to continue cultivation for 10-15min to obtain Bacillus subtilis competent cells. The expression vector for secretory expression of bovine lactoferrin according to claim 1 is transferred into the Bacillus subtilis competent cells to obtain Bacillus subtilis that secretes and expresses bovine lactoferrin.

5. An application of an expression vector for secretory expression of bovine lactoferrin, characterized in that: The expression vector according to claim 1 is used to produce bovine lactoferrin.

6. An application of Bacillus subtilis for secretory expression of bovine lactoferrin, characterized in that: The Bacillus subtilis described in claim 3 is used to produce bovine lactoferrin.

Images