Quality control method for rapidly detecting trace gDNA pollution in cfDNA based on fragment omics

Abstract

The invention relates to a quality control method for rapidly detecting trace gDNA pollution in a cfDNA sample based on fragment omics. Based on the fragment size difference of cfDNA and gDNA, the cfDNA and gDNA in a cfDNA sample are amplified through nucleic acid, and the mole ratio of the cfDNA is calculated, so that the pollution degree of the gDNA in the cfDNA sample is evaluated, and guidance is provided for biosignal analysis of the cfDNA sample. According to the method, the sample demand quantity is small, the pollution degree of the gDNA in the cfDNA sample can be rapidly judged from the source, guidance is provided for follow-up information analysis in time, and therefore the time cost and the economic cost are effectively saved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a quality control method for rapidly detecting trace gDNA contamination in cfDNA based on fragment omics. Background Art

[0002] Circulating biomarkers have become important indicators for clinical diagnosis of diseases. In particular, the discovery that DNA from various tissues of the human body is present in blood and other body fluids outside cells (cell-free deoxyribonucleic acid, cfDNA) has promoted many blood-based cfDNA tests to query specific genomic abnormalities, such as chromosomal copy number aberrations for non-invasive prenatal testing, or tumor-derived mutations for targeted cancer treatment selection. A key application of blood-based cfDNA or other circulating analytes is the early detection of common cancer signals in multiple cancers through blood tests. The quality of the sample and the purity of cfDNA play a key role in the accuracy of the test. Genomic contamination can confuse biological inferences and lead to erroneous conclusions about evolutionary relationships and lateral gene transfer, so high-quality genomes are essential for data analysis across biological disciplines.

[0003] During transportation, bumps and vibrations can cause hemolysis and release gDNA. When cfDNA is contaminated by gDNA, the sequence characteristics are diluted and the biological indicators change, which has a great impact on subsequent detection. If this problem can be discovered at the source, it will help the accuracy of subsequent detection. Existing quality control methods include Qsep fragment detection, Qubit quantification, and sequencing data analysis. These methods can detect contamination indirectly and with a delay, and are limited by trace samples. Therefore, it is necessary to develop a more sensitive quality control method that can intervene early to help make efficient decisions for experimental quality control.

[0004] In summary, existing methods cannot directly identify whether cfDNA samples contain gDNA after nucleic acid extraction, and there is no effective quality control method for gDNA contamination before cfDNA NGS sequencing detection, which usually results in a large amount of data waste.

[0005] Therefore, it is urgent to establish an efficient quality control method for gDNA contamination so that contamination can be treated before detection to reduce cost waste, reduce data waste, improve the accuracy of sequencing pooling, and improve the qualified rate of sample sequencing. Summary of the invention

[0006] The purpose of the present invention is to establish a rapid and efficient quality control method for gDNA contamination in cfDNA samples based on the difference in fragment size between cfDNA and gDNA.

[0007] In a first aspect of the present invention, a method for determining the degree of gDNA contamination in a cfDNA sample is provided, the method comprising the following steps: (Z1) providing a cfDNA sample, wherein the cfDNA sample is a cfDNA sample from a body fluid; (Z2) amplifying the cfDNA and gDNA in the cfDNA sample to obtain a first amplification product with a length of L1 corresponding to the cfDNA and a second amplification product with a length of L2 corresponding to the gDNA; (Z3) quantitatively detecting the concentration or level of the first amplification product, which is designated as Y1; and quantitatively detecting the concentration or level of the second amplification product, which is designated as Y2; (Z4) Based on the concentration or level Y1 of the first amplification product and the concentration or level Y2 of the second amplification product, the relative proportion R of cfDNA in the cfDNA sample is obtained to determine the degree of gDNA contamination in the cfDNA sample.

[0008] In another preferred embodiment, the body fluid is blood, bone marrow, cerebrospinal fluid, peritoneal fluid, pleural fluid, lymph fluid, ascites, serous fluid, sputum, tears, urine, saliva, milk, gastric juice or pancreatic juice.

[0009] In another preferred example, in step (Z2), the target sequence for amplifying cfDNA in the cfDNA sample is selected from the following group: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19 or a combination thereof.

[0010] In another preferred example, in step (Z2), the target sequence for amplifying cfDNA in the cfDNA sample is preferably SEQ ID NO:15.

[0011] In another preferred example, in step (Z2), the primer pair for amplifying the cfDNA in the cfDNA sample is selected from: SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 11 and SEQ ID NO: 12 or a combination thereof.

[0012] In another preferred example, in step (Z2), the primer pair for amplifying cfDNA in the cfDNA sample is SEQ ID NO: 1 and SEQ ID NO: 2.

[0013] In another preferred embodiment, in step (Z2), the target sequence for amplifying the gDNA in the cfDNA sample is the housekeeping gene of the gDNA.

[0014] In another preferred embodiment, the housekeeping genes of the gDNA include (but are not limited to): β-Actin, GAPDH and α-Tublin.

[0015] In another preferred embodiment, the housekeeping gene of the gDNA is preferably β-Actin.

[0016] In another preferred example, in step (Z2), the target sequence for amplifying gDNA in the cfDNA sample is selected from the following group: SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 or a combination thereof.

[0017] In another preferred example, in step (Z2), the target sequence for amplifying gDNA in the cfDNA sample is preferably: SEQ ID NO:16.

[0018] In another preferred example, in step (Z2), the primer pair for amplifying gDNA in the cfDNA sample is selected from: SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 13 and SEQ ID NO: 14 or a combination thereof.

[0019] In another preferred example, in step (Z2), the primer pair for amplifying gDNA in the cfDNA sample is preferably SEQ ID NO: 3 and SEQ ID NO: 4.

[0020] In another preferred example, in step (Z2), the primer set for amplifying cfDNA and gDNA in the cfDNA sample includes: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0021] In another preferred embodiment, the L1 is 50-200 bp, preferably 80-180 bp, and most preferably 100-150 bp.

[0022] In another preferred embodiment, the L2 is 300-600 bp, preferably 320-500 bp, and most preferably 350 bp-450 bp.

[0023] In another preferred embodiment, the ΔL of L2-L1 is 100-450 bp, preferably 150-400 bp, and more preferably 200-350 bp.

[0024] In another preferred example, L2 / L1≥1.5, preferably, L2 / L1≥3.

[0025] In another preferred embodiment, the concentration is a molar concentration; or the level is a molar amount.

[0026] In another preferred embodiment, in step (Z3), the mass concentration or mass number C1 and length L1 of the first amplification product are determined to obtain the molar concentration or molar quantity Y1 of the first amplification product; and the mass concentration or mass number C2 and length L2 of the second amplification product are determined to obtain the molar concentration or molar quantity Y2 of the second amplification product.

[0027] In another preferred embodiment, in step (Z3), the mass concentration C1 and length L1 of the first amplification product are measured to obtain the molar concentration Y1 of the first amplification product; and the mass concentration C2 and length L2 of the second amplification product are measured to obtain the molar concentration Y2 of the second amplification product.

[0028] In another preferred embodiment, for the mass concentration, the determination method includes (but is not limited to): UV spectrophotometry, fluorescence photometry, qPCR method and Qubit method.

[0029] In another preferred embodiment, the mass concentration is determined by the Qubit method.

[0030] In another preferred embodiment, in step (Z3), the mass number C1 and length L1 of the first amplification product are measured to obtain the molar quantity Y1 of the first amplification product; and the mass number C2 and length L2 of the second amplification product are measured to obtain the molar quantity Y2 of the second amplification product.

[0031] In another preferred embodiment, the length is measured by capillary electrophoresis.

[0032] In another preferred embodiment, the unit of the mass number is nanogram, and the unit of the molar quantity is nanomole.

[0033] In another preferred example, the molar quantity of the first amplification product Y1=(C1 / 1000*10^6) / (660*L1)*1000.

[0034] In another preferred example, when SEQ ID NO: 1 and SEQ ID NO: 2 are used, L1 of the first amplification product is 139.

[0035] In another preferred example, the molar quantity of the first amplification product Y1=(C1 / 1000*10^6) / (660*139)*1000.

[0036] In another preferred example, the molar quantity of the second amplification product Y2=(C2 / 1000*10^6) / (660*L2)*1000.

[0037] In another preferred example, when SEQ ID NO: 3 and SEQ ID NO: 4 are used, L1 of the first amplification product is 420.

[0038] In another preferred example, the molar quantity of the second amplification product Y2=(C2 / 1000*10^6) / (660*420)*1000.

[0039] In another preferred embodiment, in step (Z4), the relative ratio R is compared with a predetermined reference value to determine the degree of contamination of gDNA in the cfDNA sample.

[0040] In another preferred embodiment, the relative ratio R is a relative ratio based on molar concentration or molar quantity.

[0041] In another preferred embodiment, the relative proportion of the cfDNA is R=Y1 / (Y1+Y2) × 100%.

[0042] In another preferred embodiment, the determination is made according to the following criteria: (a) If R < 38%, the cfDNA sample is judged to be severely contaminated with gDNA; (b) If R < 50%, the gDNA in the cfDNA sample is judged to be moderately contaminated; (c) If 50%≤R<55%, the cfDNA sample is judged to be slightly contaminated with gDNA; (d) If 55%≤R<70%, it is determined that there is no gDNA contamination in the cfDNA sample; (e) If R ≥ 70%, the cfDNA sample acquisition or nucleic acid amplification process is considered unqualified.

[0043] In another preferred example, when a cfDNA sample is determined to be heavily contaminated or unqualified, bioinformatics analysis of the cfDNA is not recommended and the cfDNA sample needs to be re-extracted.

[0044] In another preferred embodiment, for qualified cfDNA samples, the recommended value of the amount of data required for bioinformatics analysis of cfDNA samples is: cfDNA samples judged to be slightly contaminated or uncontaminated can undergo cfDNA bioinformatics analysis, and the required data volume is 6G; cfDNA samples judged to be moderately contaminated can undergo cfDNA bioinformatics analysis, and the required data volume is 8G.

[0045] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

[0046] In a second aspect of the present invention, a cfDNA quality control system for determining the degree of gDNA contamination in a cfDNA sample is provided, the system comprising the following modules: (S1) a sample acquisition module, wherein the sample acquisition module is configured to: acquire a cfDNA sample from a body fluid; (S2) a nucleic acid amplification module, wherein the nucleic acid amplification module is configured to: amplify the cfDNA and gDNA in the cfDNA sample to obtain a first amplification product with a length of L1 corresponding to the cfDNA and a second amplification product with a length of L2 corresponding to the gDNA; (S3) a quantitative detection module, wherein the quantitative calculation module is configured to: quantitatively detect the concentration or level of the first amplification product, which is determined as Y1; and quantitatively detect the concentration or level of the second amplification product, which is determined as Y2; (S4) a contamination degree analysis module, wherein the contamination degree analysis module is configured to: obtain a relative proportion R of cfDNA in the cfDNA sample based on the concentration or level Y1 of the first amplification product and the concentration or level Y2 of the second amplification product, thereby providing an assessment result of the contamination degree of gDNA in the cfDNA sample; (S5) An output module, wherein the output module is configured to output an assessment result of the contamination degree of the gDNA.

[0047] In another preferred example, the analysis module is further configured to: determine the degree of gDNA contamination in the cfDNA sample based on the relative ratio R, and give a recommended value for the amount of data required for bioinformatics analysis of the cfDNA sample for the qualified cfDNA sample.

[0048] In another preferred embodiment, the quantitative detection module includes: (S3-1) a mass concentration detection submodule, which is configured to: quantitatively detect the mass concentration or mass number C1 of the first amplification product and the mass concentration or mass number C2 of the second amplification product; (S3-2) an amplification product length detection submodule, which is configured to: determine the length L1 of the first amplification product and determine the length L2 of the second amplification product; and (S3-3) a molar relative abundance quantification submodule, which is configured to: obtain a molar concentration or molar quantity Y1 of the first amplification product based on a mass concentration or mass number C1 and a length L1 of the first amplification product; and obtain a molar concentration or molar quantity Y2 of the second amplification product based on a mass concentration or mass number C2 and a length L2 of the second amplification product; and Based on the molar concentration or molar amount Y1 of the first amplification product and the molar concentration or molar amount Y2 of the second amplification product, the relative proportion R (ie, molar relative abundance) of cfDNA in the cfDNA sample is determined.

[0049] In another preferred embodiment, the quantitative detection module includes: (S3-1) a mass concentration detection submodule, which is configured to: quantitatively detect a mass number C1 of the first amplification product and a mass number C2 of the second amplification product; (S3-2) an amplification product length detection submodule, which is configured to: determine the length L1 of the first amplification product and determine the length L2 of the second amplification product; and (S3-3) a molar relative abundance quantification submodule, which is configured to: obtain a molar concentration or a molar quantity Y1 of the first amplification product based on a mass number C1 and a length L1 of the first amplification product; and obtain a molar concentration or a molar quantity Y2 of the second amplification product based on a mass number C2 and a length L2 of the second amplification product; and Based on the molar concentration or molar amount Y1 of the first amplification product and the molar concentration or molar amount Y2 of the second amplification product, the relative proportion R (ie, molar relative abundance) of cfDNA in the cfDNA sample is determined.

[0050] In another preferred example, in the amplification, the target sequence for amplifying the cfDNA in the cfDNA sample is selected from the following group: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19 or a combination thereof.

[0051] In another preferred example, in the amplification, the target sequence for amplifying cfDNA in the cfDNA sample is preferably SEQ ID NO:15.

[0052] In another preferred example, the nucleic acid amplification module is configured to amplify cfDNA using a cfDNA primer pair, and the cfDNA primer pair is selected from: SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 11 and SEQ ID NO: 12, or a combination thereof.

[0053] In another preferred example, the cfDNA primer pair is SEQ ID NO: 1 and SEQ ID NO: 2.

[0054] In another preferred example, the nucleic acid amplification module is configured to amplify gDNA using a gDNA primer pair, and the gDNA primer pair is selected from: SEQ ID NO: 3 and SEQ ID NO: 4, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, SEQ ID NO: 13 and SEQ ID NO: 14 or a combination thereof.

[0055] In another preferred example, the gDNA primer pair is SEQ ID NO:3 and SEQ ID NO:4.

[0056] In another preferred example, the nucleic acid amplification module is configured to: amplify cfDNA using the primer pair shown in SEQ ID NO:1 and SEQ ID NO:2, and amplify gDNA using the primer pair shown in SEQ ID NO:3 and SEQ ID NO:4.

[0057] In another preferred embodiment, in the analysis module, the determination is made according to the following criteria: (a) If R < 38%, the cfDNA sample is judged to be severely contaminated with gDNA; (b) If R < 50%, the gDNA in the cfDNA sample is judged to be moderately contaminated; (c) If 50%≤R<55%, the cfDNA sample is judged to be slightly contaminated with gDNA; (d) If 55%≤R<70%, it is determined that there is no gDNA contamination in the cfDNA sample; (e) If R ≥ 70%, the cfDNA sample acquisition or nucleic acid amplification process is considered unqualified.

[0058] In another preferred example, when a cfDNA sample is determined to be heavily contaminated or unqualified, bioinformatics analysis of the cfDNA is not recommended and the cfDNA sample needs to be re-extracted.

[0059] In another preferred embodiment, for qualified cfDNA samples, the recommended value of the amount of data required for bioinformatics analysis of cfDNA samples is: cfDNA samples judged to be slightly contaminated or uncontaminated can undergo cfDNA bioinformatics analysis, and the required data volume is 6G; cfDNA samples judged to be moderately contaminated can undergo cfDNA bioinformatics analysis, and the required data volume is 8G.

[0060] In a third aspect of the present invention, a primer pair combination is provided, the primer pair combination comprising: A cfDNA primer pair for amplifying cfDNA, the cfDNA primer pair comprising primers shown in SEQ ID NO: 1 and SEQ ID NO: 2; and A gDNA primer pair for amplifying gDNA, wherein the gDNA primer pair includes primers shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0061] In the fourth aspect of the present invention, there is provided the use of the primer pair combination described in the third aspect of the present invention for preparing a kit for determining the degree of gDNA contamination in cfDNA samples.

[0062] In a fifth aspect of the present invention, a kit is provided, comprising: (a) a cfDNA primer pair for amplifying cfDNA, the cfDNA primer pair comprising primers shown in SEQ ID NO: 1 and SEQ ID NO: 2; (b) a gDNA primer pair for amplifying gDNA, the gDNA primer pair comprising primers shown in SEQ ID NO: 3 and SEQ ID NO: 4; and (c) Optional reagents for extracting cfDNA.

[0063] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Schematic diagram of primer design for cfDNA and gDNA is shown.

[0065] Figure 2 The sequencing results of cfDNA1 mixed primer amplification products are shown.

[0066] Figure 3 The sequencing results of the gDNA1 mixed primer amplification products are shown.

[0067] Figure 4 The capillary electrophoresis results of cfDNA1 mixed primer amplification products are shown.

[0068] Figure 5 The capillary electrophoresis results of the gDNA1 mixed primer amplification products are shown.

[0069] Figure 6 The development of a standard for assessing the degree of gDNA contamination is shown.

[0070] Figure 7The comparison results of cfDNA and gDNA mass concentrations in samples collected by different sampling tubes are shown.

[0071] Figure 8 A schematic diagram of decision assistance of the present invention is shown. DETAILED DESCRIPTION

[0072] After extensive and in-depth research and a large number of screenings, the inventors unexpectedly discovered for the first time that in cfDNA samples, the content of certain specific cfDNA sequences not only has an excellent correspondence with the quality of cfDNA, but also can quickly, efficiently and accurately characterize the degree of gDNA contamination in cfDNA samples with the relative abundance of specific gDNA sequences. On this basis, the present invention was completed.

[0073] Specifically, the inventors designed corresponding cfDNA and gDNA amplification primers based on the cfDNA sequence and the housekeeping gene of gDNA, and amplified the cfDNA and gDNA in the cfDNA solution with known contamination degree, and obtained the molar ratio of cfDNA in the solution with different contamination degrees, and set the contamination ratio evaluation standard based on this. By comparing the molar ratio of cfDNA in the cfDNA sample to be tested with the evaluation standard, the contamination degree of gDNA in the cfDNA sample to be tested can be obtained quickly, accurately and efficiently. .

[0074] The method of the present invention can quickly (e.g., within 1 hour) determine the degree of gDNA contamination in cfDNA samples, control sample quality from the source of cfDNA detection, avoid severely contaminated samples from entering the bioinformatics analysis step, and save economic and time costs; at the same time, it provides sequencing data volume requirements for samples of other contamination levels that can enter the bioinformatics analysis step, avoiding batch effects and time costs introduced by additional testing. In addition, the method of the present invention is simple to operate, and the sample volume requirement is as low as 1 μL.

[0075] Fragmentomics based on specific amplification products Fragmentomics refers to revealing the bioinformatics characteristics of individuals by analyzing free nucleic acid fragments circulating in the body. In the human body, cells release many different types of free nucleic acid fragments, including free DNA, RNA, and small non-coding RNA. These fragments can reflect information such as cell status, genetic variation, and epigenetic modification, and therefore have a wide range of research and application value.

[0076] The research methods of fragmentomics usually include advanced sequencing technology, mass spectrometry technology and bioinformatics analysis, etc. These technologies can efficiently separate, identify and quantify specific fragments and mine valuable information from large amounts of data.

[0077] As used herein, the term "short amplicon" refers to the amplification product for cfDNA, and the term "long amplicon" refers to the amplification product for gDNA.

[0078] Through extensive screening, the inventors unexpectedly obtained short amplicons based on specific cfDNA species (i.e., the first amplification product with a length of L1 corresponding to cfDNA), and long amplicons based on specific gDNA target sequences (i.e., the second amplification product with a length of L2 corresponding to gDNA).

[0079] In the present invention, the yield of the first amplification product and the yield of the second amplification product can be calculated to obtain the relative abundance R, thereby characterizing the severity of gDNA contamination.

[0080] In the present invention, the relative abundance R can be calculated by a variety of different methods. For example, qPCR can calculate the relative abundance by Ct value, and common PCR can calculate the relative abundance according to primer amplification efficiency.

[0081] In the present invention, a particularly preferred method is to obtain relative abundance on a molar basis.

[0082] cfDNA cfDNA, or cell-free DNA, is also known as free DNA. It usually exists in the form of fragments of about 170bp. It is DNA that exists freely in body fluids such as blood and is not bound to cells. cfDNA testing is of great significance. For example, in the field of oncology, it can be used for early diagnosis, treatment monitoring and prognosis evaluation of tumors. Since tumor cells release cfDNA into the blood, the presence of tumors can be detected at an early stage by detecting information such as tumor-specific mutations. In terms of prenatal diagnosis, cfDNA testing can be used to screen for diseases such as fetal chromosomal abnormalities, and has the advantage of being non-invasive.

[0083] The existing cfDNA extraction methods mainly include phenol-chloroform extraction, silica gel membrane adsorption, magnetic beads and commercial kit methods. Since the release of gDNA during sample transportation or extraction will contaminate the sample, the content of cfDNA is usually low, so high-accuracy extraction and detection is difficult, requiring superb pretreatment technology and strict experimental conditions to improve the reliability of the test results.

[0084] gDNA gDNA, or genomic DNA, is the sum of all genetic material in the cells of an organism. Human gDNA is composed of approximately 3 billion base pairs. gDNA carries genes that encode proteins, as well as various sequence elements that regulate gene expression. These genes and regulatory elements together determine the various biological characteristics of an organism, including morphology, physiological functions, and behavior. gDNA contains almost all the genetic information of an organism. When hemolysis occurs, gDNA will be released into the plasma, existing in the form of large fragments or degraded into small fragments, causing contamination of cfDNA.

[0085] Method of the present invention The method of the present invention refers to a quality control method for rapid detection of trace gDNA contamination in cfDNA based on fragmentomics. Specifically, based on the difference in fragment size between cfDNA and gDNA, the cfDNA and gDNA in the sample are amplified by nucleic acid and the molar ratio of cfDNA is calculated to evaluate the contamination degree of gDNA in the cfDNA solution.

[0086] cfDNA samples In the present invention, the cfDNA sample is a cfDNA sample from body fluids.

[0087] Representative body fluids include, but are not limited to, blood, bone marrow, cerebrospinal fluid, peritoneal fluid, pleural fluid, lymphatic fluid, ascites, serous fluid, sputum, tears, urine, saliva, breast milk, gastric juice or pancreatic juice.

[0088] In another preferred embodiment, the body fluid is blood, cerebrospinal fluid and lymph fluid.

[0089] In another preferred embodiment, the body fluid is blood.

[0090] In another preferred embodiment, methods for obtaining cfDNA samples from body fluids include (but are not limited to): phenol-chloroform extraction, silica gel membrane adsorption extraction, magnetic bead extraction and commercial kit method.

[0091] In another preferred embodiment, the method of obtaining cfDNA samples from body fluids also includes extraction using a prepared reagent with performance comparable to that of a commercial cfDNA-specific extraction kit.

[0092] In another preferred embodiment, the comparable performance means that the cfDNA extracted from the same sample has similar yield, purity and stability.

[0093] PCR amplification of cfDNA and gDNA in samples In the present invention, based on the difference in fragment size between cfDNA and gDNA, amplification primers for cfDNA and gDNA are designed on housekeeping genes. Short amplicon represents cfDNA, and long amplicon represents gDNA.

[0094] Among them, housekeeping genes refer to a type of genes that are expressed in all cells and whose products are necessary for maintaining the basic life activities of cells; Amplicon refers to the product obtained by amplifying a specific DNA fragment through techniques such as polymerase chain reaction (PCR). Its size depends on the selected amplification region, generally ranging from tens to thousands of base pairs.

[0095] In another preferred embodiment, the housekeeping gene has the following characteristics: (1) It is continuously expressed in different cell types, and the expression level is relatively stable; (2) Housekeeping genes usually encode proteins that maintain the basic structure and function of cells, such as proteins involved in ribosome composition, enzymes involved in cell metabolism, and proteins that maintain the integrity of cell structure; (3) The expression of housekeeping genes is not drastically affected by external environmental factors and can maintain a certain expression level under a wide range of physiological conditions to ensure the normal survival of cells and the conduct of basic metabolic activities.

[0096] In another preferred embodiment, the housekeeping genes include (but are not limited to): β-Actin, GAPDH and α-Tublin.

[0097] In another preferred embodiment, the housekeeping gene is preferably β-Actin.

[0098] In another preferred example, in the PCR amplification, the primer pair for amplifying cfDNA is SEQ ID NO: 1 and SEQ ID NO: 2.

[0099] In another preferred example, in the PCR amplification, the primer pair for amplifying cfDNA is SEQ ID NO: 5 and SEQ ID NO: 6.

[0100] In another preferred example, in the PCR amplification, the primer pair for amplifying cfDNA is SEQ ID NO:11 and SEQ ID NO:12.

[0101] In another preferred example, in the PCR amplification, the primer pair for amplifying cfDNA is SEQ ID NO: 1 and SEQ ID NO: 2.

[0102] In another preferred example, in the PCR amplification, the primer pair for amplifying gDNA is SEQ ID NO: 3 and SEQ ID NO: 4.

[0103] In another preferred example, in the PCR amplification, the primer pair for amplifying gDNA is SEQ ID NO: 7 and SEQ ID NO: 8.

[0104] In another preferred example, in the PCR amplification, the primer pair for amplifying gDNA is SEQ ID NO: 9 and SEQ ID NO: 10.

[0105] In another preferred example, in the PCR amplification, the primer pair for amplifying gDNA is SEQ ID NO:13, and the downstream primer is SEQ ID NO:14.

[0106] In another preferred example, in the PCR amplification, the primer pair for amplifying cfDNA and the primer pair for amplifying gDNA can be used in any combination.

[0107] Quantification and proportion of cfDNA and gDNA In the present invention, the ratio of cfDNA to gDNA is a molar ratio. After nucleic acid amplification, the cfDNA and gDNA are quantified and the molar ratio of cfDNA in the sample is calculated.

[0108] Among them, the quantitative methods that can be used include (but are not limited to): gel imaging analysis, ultraviolet spectrophotometry, fluorescence quantitative PCR, Qubit method, and biochip method.

[0109] In another preferred embodiment, the quantitative method used is the Qubit method. The principle of Qubit quantitative detection is to use the characteristics of specific binding of fluorescent dyes to dsDNA. When the fluorescent dye binds to dsDNA, it will emit fluorescence under the excitation light of a specific wavelength, and the instrument determines the concentration of dsDNA by detecting the intensity of the fluorescent signal.

[0110] Calculate the molar number based on the concentration: The number of moles of cfDNA = (mass number / 1000*10^6) / (660*length of the first amplification product)*1000.

[0111] The number of moles of gDNA = (mass number / 1000*10^6) / (660*length of the second amplification product)*1000.

[0112] In another preferred embodiment, the mass number is obtained by mass concentration and volume.

[0113] In another preferred embodiment, the molar numbers of cfDNA and gDNA are quantified as Y1 and Y2, respectively.

[0114] In another preferred example, the proportion of cfDNA in the cfDNA sample is Y1 / (Y1+Y2)×100%, and the proportion of gDNA is Y2 / (Y1+Y2)×100%.

[0115] Determination of contamination level of trace gDNA in cfDNA samples In the present invention, samples with known contamination levels obtained by comprehensive bioinformatics index analysis are used to set cfDNA ratio thresholds for different contamination conditions. By comparing the cfDNA ratio in the cfDNA sample with the set threshold, the contamination level of gDNA in the cfDNA sample to be tested can be obtained.

[0116] In another preferred embodiment, samples with known contamination levels are analyzed based on comprehensive bioinformatics indicators, gDNA ratio thresholds for different contamination conditions are set, and the gDNA ratio is compared with the set threshold to obtain the contamination level of gDNA in the cfDNA solution to be tested.

[0117] In another preferred embodiment, the pollution degree assessment standard is as follows: (a) If Y1 / (Y1+Y2)×100%<38%, the cfDNA sample is judged to be severely contaminated with gDNA; (b) If 38%≤Y1 / (Y1+Y2)×100%<50%, the cfDNA sample is judged to be moderately contaminated with gDNA; (c) If 50%≤Y1 / (Y1+Y2)×100%<55%, the cfDNA sample is judged to be slightly contaminated with gDNA; (d) If 55%≤Y1 / (Y1+Y2)×100%<70%, it is determined that there is no gDNA contamination in the cfDNA sample; (e) If Y1 / (Y1+Y2)×100%≥70%, the cfDNA sample extraction or amplification process is considered unqualified.

[0118] In another preferred embodiment, for samples determined to be slightly contaminated or uncontaminated, subsequent bioinformatics analysis can be performed, and the amount of data required for the bioinformatics analysis is 6G; For samples judged to be moderately contaminated, subsequent bioinformatics analysis can be performed, and the amount of data required for bioinformatics analysis is 8G; For samples judged to be heavily contaminated or unqualified, bioinformatics analysis of cfDNA is not recommended and the samples need to be re-extracted.

[0119] Detection of amplification product length In the present invention, a variety of different methods can be used to determine the length of the first amplification product and the second amplification product. A preferred method is to determine the length of the amplification product by capillary electrophoresis.

[0120] The main advantages of the present invention include: (a) The present invention provides a simple and rapid method for quality control of trace genomic nucleic acid contamination in trace plasma free nucleic acid.

[0121] (b) The method of the present invention has low sample quantity requirements and can quickly detect the proportion of contamination in trace samples.

[0122] (c) The method of the present invention controls the sample quality from the detection source, and can process the sample as quickly as possible, thereby avoiding waste of resources.

[0123] (d) The method of the present invention can calculate the sequencing data volume requirement by evaluating the contamination ratio, thereby avoiding the batch effect and time cost introduced by additional testing.

[0124] (e) The method of the present invention is stable, efficient, and has good data reproducibility.

[0125] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0126] Example 1 Sample extraction and calculation of relative proportion of cfDNA 1. cfDNA nucleic acid extraction. Use a cfDNA-specific extraction kit (Norvezyme circulating free nucleic acid extraction kit N913) to obtain high-quality cfDNA samples.

[0127] 2. Calculation of relative proportion of cfDNA 2.1 Amplification of cfDNA and gDNA According to the recipes in Tables 1 and 2, the corresponding primer sequences of the different primer sets shown in Table 3 are used as primers for cfDNA and gDNA amplification, and the cfDNA and gDNA in the sample obtained in step (a) are amplified (PCR / qPCR). The amplification reaction procedure is shown in Table 4.

[0128] Among them, cfDNA mixed primers refer to the mixture of upstream primers (_F) and downstream primers (_R) of cfDNA in the corresponding primer set, and gDNA mixed primers refer to the mixture of upstream primers (_F) and downstream primers (_R) of gDNA in the corresponding primer set. The primer design principles for cfDNA and gDNA are as follows: Figure 1 shown.

[0129] The target sequence amplified by cfDNA1 is: CGGCGGATCGGCAAAGGCGAGGCTCTGTGCTCGCGGGGCGGACGCGGTCTCGGCGGTGGTGGCGCGTCGCGCCGCTGGGTTTTATAGGGCGCCGCCGCGGCCGCTCGAGCCATAAAAGGCAACTTTCGGAACGGCGC (SEQ ID NO:15).

[0130] The target sequence amplified by gDNA1 is: GATACACCATGTCACACTGGGGAAGCCACTGGGGACAGCCAGGCCAGACGGGGGACATGCAGAAAGTGCAAAGAACACGGCTAAGTGTGCTGGGGTCTTGGGATGGGGAGTCTGTTCAGACCTACTGTGCACCTACTTAATACACACTCCAAGGCCGCTTTACACCAGCCTCATGGCCTTGTCACACGAGCCAGTGTTAGTACCTACACCCACAACACTGTCTTAGACACCTAGTCAGAGAGACAAACACCAGAAAAAGAGCTCATCTGGGAAAAAGCAAATAGAACCTGCAGAGTTCCAAAGGAGACTCAGGTCAGAGAAGAGAGTCCTACGGAAAACGGCAGAAGAGAGAACCAGTGAGAAAGGGCGCAGCTCCGGGAGGCCAGGAAGGAGGGAGGCGGCCACCAGAAGAGGTAGCGG (SEQ ID NO:16).

[0131] The target sequence amplified by cfDNA2 is: AGGTGAGACATTCTTGCTGGGGAGGGACCTGGTATGTTCTCCTCAGACTGAGGGTAGGGCCTCCAAACAGCCTTGCTTGCTTCGAGAACCATTTGCTTCCCGCTCAGACGTCTTG (SEQ ID NO:17).

[0132] The target sequence amplified by gDNA2 is: GTGGCTGGCTCAGAAAAAGGGCCCTGACAACTCTTTTCATCTTCTAGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTAGGGAGCCGCACCTTGTCATGTACCATCAATAAAGTACCCTGTGCTCAACCAGTTACTTGTCCTGTCTTATTCTAGGGTCTGGGGCAGAGGGGAGGGAAGCTGGGCTTGTGTCAAG (SEQ ID NO:18).

[0133] The target sequence amplified by cfDNA3 is: ATATCCCCAGCACGATACAAAGATTAAGGAAAATCACCTGCTACAAATGCTGCATATGGGTGTGGTCTGAATAATGATGTCGCCTTGGCCCTGTTCAGCACGTGGTACCAGCCCATTGTGCCTACTACCATGCTTGA (SEQ ID NO:19).

[0134] The target sequence amplified by gDNA3 is: ACTGTGGGTTCCAAGTCTACAAACACTGCCCGGGGCACATGCTTGCCAGCCCCCGTCTCACTGAAGAAGGTGTTGAAGGAATCATCTCCTCCCCCAATGGTCTTGTCACTTGGCATCTGGCCATCGGGCTGGATGCCGTGTTCCAGGCAGTAGAGCTCCCAGCAGGCATTGCCAATCTGGACAC CAGCCTGGCCAACGTGGATGGAGATGCACTCACGCTGTGGGGAGGAAAAGTGAAAAAATCGTAAAATTAAGGGTATTAGCATTTCAAACTTATAGGAAATTTCAAAAATATTTCTAATAATATACAGATATTTTTCTAAATTATTTGAGGTCATATCCCCAGCACGATACAAAGATTAAG (SEQ IDNO:20).

[0135] Table 1 cfDNA amplification system

[0136] Table 2 gDNA amplification system

[0137] Table 3 Primer pairs used for amplification

[0138] Table 4 Amplification reaction procedure

[0139] 2.2 Characterization of amplification products The sequencing results of the amplified products of cfDNA1 mixed primers and gDNA1 mixed primers are as follows: Figure 2 and Figure 3 shown.

[0140] Use a capillary electrophoresis instrument to analyze the fragment size of the amplified product. Pipette 1ul of PCR amplified product, mix it with the sample using the Dilution Buffer working solution, centrifuge it on a centrifuge, collect the sample to the bottom of the tube, make sure there are no bubbles in the sample solution, place it in the sample detection position of the Qsep400 instrument, and complete the detection. The capillary electrophoresis results of the amplified products of cfDNA mixed primers and gDNA mixed primers are as follows: Figure 4 and Figure 5 shown.

[0141] 2.3 Analysis of cfDNA Proportion The amplified products were purified and quantified by Qubit, and the quantitative data of the PCR products of cfDNA and gDNA were used to calculate the relative proportion of cfDNA in the sample. The relevant formula is: cfDNA molar number = (mass number / 1000*10^6) / (660*length of the first amplification product)*1000; gDNA molar number = (mass number / 1000*10^6) / (660*length of the first amplification product)*1000; cfDNA percentage = cfDNA moles / (cfDNA moles + gDNA moles)*100%.

[0142] Example 2: Development of gDNA contamination assessment standards Three samples with different contamination levels were selected, and different primer pairs were used to amplify and quantify cfDNA and gDNA, and the cfDNA ratio was calculated.

[0143] (a) cfDNA1+gDNA1 primer set Using SEQ ID NO:1 and SEQ ID NO:2 as the upstream primer and downstream primer for cfDNA, and SEQ ID NO:3 and SEQ ID NO:4 as the upstream primer and downstream primer for gDNA, the cfDNA and gDNA in samples with different known contamination levels were amplified and quantified, and the cfDNA proportion corresponding to the samples with known contamination levels was calculated.

[0144] The calculation results are shown in Table 5, and the corresponding bar chart and line chart results are shown in Figure 6 Among them, the comparison results of the mass concentration of cfDNA and gDNA are shown in Figure 7 shown.

[0145] It can be found that among the three samples with the same contamination level, the mass concentrations of cfDNA and gDNA fluctuate greatly, but the molar ratio of cfDNA is basically stable, and the CV values ​​of each group of data are small.

[0146] The results showed that the calculated cfDNA percentage was linearly correlated with the actual contamination level of the EDTA tube.

[0147] Table 5 Evaluation criteria for gDNA contamination

[0148] Based on this, the thresholds of severe pollution, moderate pollution, mild pollution and no pollution can be divided as the evaluation criteria for the proportion of gDNA pollution, as shown in Table 6.

[0149] Table 6 Evaluation criteria for gDNA contamination

[0150] When the calculated cfDNA proportion Y1 / (Y1+Y2)×100% is ≥55% and <70%, it means that the sample is slightly contaminated or not contaminated, and subsequent testing can be carried out normally. The required data volume is 6G (2x); When the calculated cfDNA proportion Y1 / (Y1+Y2)×100% is ≥38% and <50%, it indicates that the sample is moderately contaminated and the required sequencing data volume is 8G (2.7x); When the calculated cfDNA proportion Y1 / (Y1+Y2)×100% is less than 38%, it means that the sample is seriously contaminated and cannot be tested subsequently, and resampling is required; When the proportion of cfDNA is higher than 70%, it indicates that there are many gDNAs degraded into small fragments in the blood, indicating that the library construction is abnormal or the gDNA is severely degraded and resampling is required.

[0151] (b) cfDNA2+gDNA2 primer set SEQ ID NO: 5 was used as the upstream primer for cfDNA, SEQ ID NO: 6 was used as the downstream primer for cfDNA, SEQ ID NO: 7 was used as the upstream primer for gDNA, and SEQ ID NO: 8 was used as the downstream primer for gDNA. The cfDNA and gDNA in samples with different known contamination levels were amplified and quantified, and the proportion of cfDNA corresponding to the samples with known contamination levels was calculated.

[0152] The results are shown in Table 7. As the contamination level increased from no contamination to severe contamination, the proportion of cfDNA in the samples decreased, indicating that the cfDNA2+gDNA2 primer set can be used to distinguish samples with different contamination levels.

[0153] However, the average cfDNA proportions in severely contaminated tubes, moderately contaminated tubes, slightly contaminated tubes, and uncontaminated tubes were all between 60% and 80%. Compared with the results of the cfDNA1+gDNA1 primer group, the differentiation between the different contamination levels was lower.

[0154] Table 7 Degree of gDNA contamination in cfDNA after cfDNA2+gDNA2 primer amplification

[0155] (c) cfDNA3+gDNA3 primer set SEQ ID NO: 11 was used as the upstream primer designed for cfDNA, SEQ ID NO: 12 was used as the downstream primer designed for cfDNA, SEQ ID NO: 13 was used as the upstream primer designed for gDNA, and SEQ ID NO: 14 was used as the downstream primer designed for gDNA. The cfDNA and gDNA in samples with different known contamination levels were amplified and quantified, and the proportion of cfDNA corresponding to the samples with known contamination levels was calculated.

[0156] The results are shown in Table 8. As the contamination level of gDNA in the EDTA sampling tube increases, the proportion of cfDNA in the sample gradually decreases.

[0157] However, when there is no gDNA contamination in the sampling tube, the proportion of cfDNA in the sampling tube is lower than that in the severely contaminated samples. This is because the samples in the non-contaminated amplification group deviate from the linear relationship due to low primer amplification efficiency and low amplification product yield. In addition, the proportion of cfDNA in samples with the same degree of contamination fluctuates greatly.

[0158] Table 8 Degree of gDNA contamination in cfDNA after cfDNA3+gDNA3 primer amplification

[0159] Example 3: PCR detection of clinical samples The “gDNA contamination level assessment standard” described in Example 2 was used to assess 10 clinical samples, and the assessment results are shown in Table 9.

[0160] The results showed that most samples were of high quality and were either uncontaminated or slightly contaminated.

[0161] There was one moderately contaminated sample, and the amount of sequencing data required for subsequent testing was 8G (2.7x).

[0162] There were 2 unqualified samples and 1 severely contaminated sample with a cfDNA percentage of less than 38%, all of which required re-sampling and testing.

[0163] Table 9 PCR test results of clinical samples

[0164] Example 4: Comparison of the results of clinical sample detection by the method of the present invention and library Qsep detection The 10 clinical samples were evaluated using the "gDNA contamination level assessment standard" described in Example 2 and compared with the library Qsep test results.

[0165] The results are shown in Table 10. The method of the present invention was used to judge the degree of gDNA contamination in the samples. Among the 10 clinical samples, 1 was uncontaminated, 2 were slightly contaminated, and 9 were moderately contaminated. The uncontaminated and slightly contaminated samples could be used for subsequent testing normally, and the required data volume was 6G (2x); the amount of sequencing data required for the moderately contaminated samples for subsequent testing was 8G (2.7x).

[0166] In addition, the results of the PCR detection method of the present invention and the Qsep detection method were highly consistent, about 86.4%.

[0167] The PCR detection method of the present invention can more accurately judge the degree of contamination from four dimensions, including non-contaminated, slightly contaminated, moderately contaminated and severely contaminated samples, which can meet the contamination degree requirements of gDNA for different marker combinations, and comprehensively consider various detection process factors according to the degree of contamination, build a full quality control process, and provide guidance for the amount of sequencing data required for subsequent experiments.

[0168] Meanwhile, compared with the Qsep detection cycle of about 8 hours, the method of the present invention takes 1 hour, is faster, and has lower cost.

[0169] Qsep fragment detection uses the principle of capillary electrophoresis to determine the fragment size and concentration by analyzing the migration behavior of nucleic acid molecules in an electric field. Specifically, during the detection process, the sample is injected into the capillary, and under the action of the electric field, nucleic acid fragments of different sizes migrate at different speeds. By detecting the migration time of fluorescently labeled nucleic acid fragments in the capillary, the size of the fragment can be accurately determined; at the same time, based on the intensity of the fluorescent signal, the concentration of the fragment can be quantitatively analyzed.

[0170] In this embodiment, for the Qsep result, if there are three impurity peaks between 450-1000 bp, it is evaluated that the sample is seriously contaminated, otherwise it means that the contamination is not serious. Although the Qsep result has high resolution and can accurately distinguish small fragment differences, the judgment result is a qualitative result or a semi-quantitative result. Factors such as the number, position and peak height of impurity peaks have a certain influence on the interpretation.

[0171] Table 10 Comparison results between the method of the present invention and Qsep detection

[0172] Example 5: Comparison of PCR results of samples collected using different sampling tubes The methods of the present invention were used to calculate the proportion of cfDNA in the samples and determine the degree of contamination, and the determination results were further verified by bioinformatics analysis.

[0173] The results are shown in Table 11.

[0174] The results show that the bioinformatics analysis results are highly consistent with the PCR test results and can achieve the same interpretation results, indicating that the method of the present invention has a high accuracy in prejudging the degree of contamination.

[0175] Table 11 Comparison of the results of the method of the present invention and the bioinformatics analysis method

[0176] It can be seen from the embodiments of the present invention that based on the length of cfDNA and gDNA fragments, the cfDNA1+gDNA1 primer set is selected to amplify the cfDNA and gDNA in the sample respectively, and then the proportion of cfDNA in the sample is quantified and calculated. The degree of sample contamination is obtained by comparison, which can guide the subsequent bioinformatics analysis of the sample (such as Figure 8 As shown in Figure 2, the quality control of trace gDNA contamination in cfDNA is realized based on fragment omics. This primer set has good stability, high accuracy, and rapid detection in the quality control of trace gDNA contamination in cfDNA, and the effect is not obvious.

[0177] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for determining the degree of gDNA contamination in a cfDNA sample, characterized in that: The method comprises the following steps: (Z1) providing a cfDNA sample, wherein the cfDNA sample is a cfDNA sample from a body fluid; (Z2) amplifying the cfDNA and gDNA in the cfDNA sample to obtain a first amplification product with a length of L1 corresponding to the cfDNA and a second amplification product with a length of L2 corresponding to the gDNA; (Z3) quantitatively detecting the concentration or level of the first amplification product, which is designated as Y1; and quantitatively detecting the concentration or level of the second amplification product, which is designated as Y2; (Z4) Based on the concentration or level Y1 of the first amplification product and the concentration or level Y2 of the second amplification product, the relative proportion R of cfDNA in the cfDNA sample is obtained to determine the degree of gDNA contamination in the cfDNA sample.

2. The method according to claim 1, characterized in that In step (Z2), the target sequence for amplifying cfDNA in the cfDNA sample is selected from the following group: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19 or a combination thereof.

3. The method according to claim 1, characterized in that In the amplification, the primer pair for amplifying cfDNA is SEQ ID NO: 1 and SEQ ID NO: 2; and The primer pair for amplifying gDNA is SEQ ID NO:3 and SEQ ID NO:

4.

4. The method according to claim 1, characterized in that In step (Z3), the mass concentration or mass number C1 and length L1 of the first amplification product are determined to obtain the molar concentration or molar quantity Y1 of the first amplification product; and the mass concentration or mass number C2 and length L2 of the second amplification product are determined to obtain the molar concentration or molar quantity Y2 of the second amplification product.

5. The method according to claim 1, characterized in that In step (Z4), the relative proportion R of cfDNA is compared with a predetermined reference value to determine the degree of gDNA contamination in the cfDNA sample.

6. The method according to claim 5, characterized in that The following criteria shall be used for determination: (a) If R < 38%, the cfDNA sample is judged to be severely contaminated with gDNA; (b) If 38%≤R<50%, the gDNA in the cfDNA sample was judged to be moderately contaminated; (c) If 50%≤R<55%, the cfDNA sample is judged to be slightly contaminated with gDNA; (d) If 55%≤R<70%, it is determined that there is no contamination of gDNA in the cfDNA sample; (e) If R ≥ 70%, the cfDNA sample is considered unqualified.

7. A cfDNA quality control system for determining the degree of gDNA contamination in cfDNA samples, characterized in that: The system includes the following modules: (S1) a sample acquisition module, wherein the sample acquisition module is configured to: acquire a cfDNA sample from a body fluid; (S2) a nucleic acid amplification module, wherein the nucleic acid amplification module is configured to: amplify the cfDNA and gDNA in the cfDNA sample to obtain a first amplification product with a length of L1 corresponding to the cfDNA and a second amplification product with a length of L2 corresponding to the gDNA; (S3) a quantitative detection module, wherein the quantitative calculation module is configured to: quantitatively detect the concentration or level of the first amplification product, which is determined as Y1; and quantitatively detect the concentration or level of the second amplification product, which is determined as Y2; (S4) a contamination degree analysis module, wherein the contamination degree analysis module is configured to: obtain a relative proportion R of cfDNA in the cfDNA sample based on the concentration or level Y1 of the first amplification product and the concentration or level Y2 of the second amplification product, thereby providing an assessment result of the contamination degree of gDNA in the cfDNA sample; (S5) An output module, wherein the output module is configured to output an assessment result of the contamination degree of the gDNA.

8. A primer pair combination, characterized in that: The primer pair combination comprises: A cfDNA primer pair for amplifying cfDNA, the cfDNA primer pair comprising primers shown in SEQ ID NO: 1 and SEQ ID NO: 2; and A gDNA primer pair for amplifying gDNA, wherein the gDNA primer pair includes primers shown in SEQ ID NO: 3 and SEQ ID NO:

4.

9. Use of the primer pair combination according to claim 8, characterized in that: A kit for preparing a method for determining the degree of gDNA contamination in cfDNA samples.

10. A kit, characterized in that: The kit comprises: (a) a cfDNA primer pair for amplifying cfDNA, the cfDNA primer pair comprising primers shown in SEQ ID NO: 1 and SEQ ID NO: 2; (b) a gDNA primer pair for amplifying gDNA, the gDNA primer pair comprising primers shown in SEQ ID NO: 3 and SEQ ID NO: 4; and (c) Optional reagents for extracting cfDNA.

Images