Kit and method for rapidly detecting pseudomonas syringae kiwi fruit pathogenic variants in actinidia arguta by CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats)

Abstract

The invention provides a kit and a method for rapidly detecting pseudomonas syringae kiwi fruit pathogenic variants in actinidia arguta through CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats), and belongs to the technical field of molecular biology. The kit provided by the invention comprises the following components: an upstream primer, a downstream primer, crRNA, a Cas12a protein and a single-stranded DNA reporter molecule, the sequence of the upstream primer is as shown in SEQ ID NO: 1, the sequence of the downstream primer is as shown in SEQ ID NO: 2, and the sequence of the crRNA is as shown in SEQ ID NO: 3. The primer and the crRNA provided by the invention are suitable for rapid detection of pseudomonas syringae kiwi fruit pathogenic variants in soft kiwi fruits, the detection sensitivity of the primer and the crRNA reaches 10 copies / reaction, and the primer and the crRNA have relatively high specificity.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a kit and method for rapidly detecting the pathogenic variants of Pseudomonas syringae in Actinidia arguta using CRISPR-Cas12a. Background Art

[0002] Actinidia arguta is the fastest growing cultivar of the genus Actinidia in recent years. The fruit of Actinidia arguta is similar in size to a date, with a smooth and edible skin. It is rich in dietary fiber, vitamins, polysaccharides and other nutritional values ​​and is an emerging commercial fruit.

[0003] The pathogen of bacterial canker of kiwifruit is Pseudomonas syringaepv.actinidiae (Psa), which is one of the most widespread and serious diseases in the kiwifruit industry. It has the characteristics of fast spread, strong pathogenicity, and great difficulty in prevention and control. With the gradual increase in the kiwifruit planting area, the disease problem has become increasingly apparent. The disease was first discovered in New Zealand in 2014 and is now common in the main kiwifruit producing areas in Liaoning, my country, causing huge economic losses to the kiwifruit industry. Therefore, the rapid identification of Pseudomonas syringaepv.actinidiae is particularly important.

[0004] Traditional detection methods for kiwifruit pathogenic variants of Pseudomonas syringae mainly involve isolation of pathogens from diseased tissues, morphological identification, pathogenicity determination, etc. Traditional classification and identification methods are time-consuming, low in sensitivity, and easily interfered by many factors such as human and environmental factors. They cannot make rapid diagnoses during the incubation period and early stage of the disease, making it difficult to monitor and effectively control the occurrence of the disease in a timely manner. How to diagnose the disease as early as possible, focus on prevention, control the spread of the disease in a timely manner, and keep economic losses to a minimum has gradually become the focus of modern plant bacterial disease research.

[0005] The development of molecular biology provides rapid, sensitive and accurate technical support for the diagnosis of bacterial canker of Actinidia arguta. Although the PCR method has greatly improved the detection specificity and sensitivity, the diagnostic process is cumbersome, the cycle is long, the cost is high, and it requires expensive instruments and reagents, which cannot meet the needs of rapid detection. Recombinase polymerase isothermal amplification technology (RPA) is a nucleic acid isothermal amplification technology carried out in the range of 37℃~42℃, which simulates the replication of DNA in organisms and mainly relies on three enzymes: recombinase, single-strand binding protein and strand displacement DNA polymerase. RPA has mild reaction conditions, high amplification efficiency and simple equipment. It has been widely developed and applied in pathogen detection in recent years. The CRISPR-Cas12a system is derived from the immune defense system of bacteria against viral invasion, which can be achieved by cutting the target DNA through the Cas12a protein. As an emerging molecular biology tool, CRISPR-Cas12a can be used for rapid detection of pathogens. Under the guidance of crRNA, Cas12a specifically recognizes and cuts target DNA with a PAM sequence, thereby stimulating its trans-cutting activity. Single-stranded DNA reporter molecules can be added to the system, and fluorescent and quenching groups can be modified at both ends of the single-stranded DNA reporter molecules. The detection results can be judged based on the generated fluorescent signals. Summary of the invention

[0006] The object of the present invention is to provide a method for conveniently, rapidly, accurately and sensitively identifying the kiwifruit pathogenic variant of Pseudomonas syringae.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a CRISPR-Cas12a kit for rapidly detecting the pathogenic variants of Pseudomonas syringae in Actinidia arguta, comprising the following components: an upstream primer, a downstream primer, crRNA, a Cas12a protein and a single-stranded DNA reporter molecule;

[0009] The upstream primer sequence is shown in SEQ ID NO: 1, the downstream primer sequence is shown in SEQ ID NO: 2, and the crRNA sequence is shown in SEQ ID NO: 3.

[0010] Preferably, the Cas12a protein is LbCas12a protein.

[0011] Preferably, the single-stranded DNA reporter molecule is a fluorescent reporter group -TTATT-fluorescence quencher group.

[0012] Preferably, the fluorescent reporter group is FAM, HEX, TET, JOE or VIC, and the fluorescent quencher group is BHQ1, BHQ2 or BHQ3.

[0013] Preferably, the kit also includes RPA buffer, double distilled water, magnesium ions, and 10×LbCas12a Buffer.

[0014] The present invention also provides a method for rapidly detecting the pathogenic variants of Pseudomonas syringae in Actinidia arguta based on CRISPR-Cas12a using the kit, comprising the following steps:

[0015] (1) extracting DNA from the sample to be tested as a DNA template;

[0016] (2) preparing an RPA reaction system with an RPA buffer, an upstream primer, a downstream primer, double distilled water and magnesium ions, then adding the DNA template to perform RPA amplification to obtain an RPA amplification product;

[0017] (3) Prepare the Cas12a reaction system with 10×LbCas12aBuffer, crRNA, single-stranded DNA reporter molecule, Cas12a protein, water and RPA amplification product, react and observe the results.

[0018] Preferably, the final concentrations of the upstream primer and the downstream primer in the RPA reaction system are independently 300-500 nM, and the volume ratio is 0.8-1.2:0.8-1.2.

[0019] Preferably, the conditions for the RPA amplification are: 35-37° C., 10-40 min.

[0020] Preferably, the final concentration of the crRNA in the RPA reaction system is 200-300 nM, and the reaction conditions are: 35-37° C., 10-40 min.

[0021] Preferably, the result is a fluorescence result or a visualization result.

[0022] The primers provided by the present invention are suitable for amplification by the RPA isothermal amplification method. By introducing Cas12a and crRNA, the DNA of the kiwifruit pathogenic variant of Pseudomonas syringae in kiwifruit can be accurately detected. The detection sensitivity reaches 10 copies / reaction. The method can conveniently and quickly identify the DNA of the kiwifruit pathogenic variant of Pseudomonas syringae. It is easy to operate and does not require a temperature-variable instrument like PCR to achieve amplification detection. It only needs to be isothermal amplified at 37°C to complete the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1The results of sensitivity test of plasmid DNA of different concentrations of Pseudomonas syringae pv. kiwifruit (real-time fluorescence detection);

[0024] Figure 2 Results of sensitivity test of plasmid DNA of different concentrations of Pseudomonas syringae pv. kiwifruit (visual test)

[0025] Figure 3 It is the specific detection result of DNA of Pseudomonas syringae pv. kiwifruit (real-time fluorescence method);

[0026] Figure 4 It is the specific detection result of DNA of Pseudomonas syringae pv. kiwifruit (visual detection);

[0027] Figure 5 The actual sample test results of the DNA of Pseudomonas syringae pv. kiwifruit (real-time fluorescence method);

[0028] Figure 6 Actual sample test results for DNA of Pseudomonas syringae pv. kiwifruit (visual test). DETAILED DESCRIPTION

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1 Amplification primers, crRNA design and positive plasmid construction of Pseudomonas syringae pv. kiwifruit

[0031] According to the genome sequence of the kiwifruit pathogenic variant of Pseudomonas syringae, the specific sequence of the kiwifruit pathogenic variant of Pseudomonas syringae was found through sequence analysis, and the sequence is as shown in SEQ ID NO:4 (CTGCTTCATCGATGTGGACAAGTGTGATCCGCTTACCCGATAACACG TCGTCTACCGACATACCTTGCTTCAAAGGCGCATCTTTCGTGCCGTCTGAGCTTTCTGGCGTTGTGTCCACAAGCGTATTGGAGACGGAATTGCCACTAAATTCAGCGATTCTCACAATCACGCCATTGACGAACGGATGATCAGCGGCCCAGTTTTCAAAGCCCGGTAAAGGTTTGCGCAATTCCAGCGTAAGGTAACTGCCATCGCTACGAAACAGGCGCAAGCCTTTGACAACCGTGGCAT The sequence was cloned into the pUc57 plasmid to construct a positive recombinant plasmid containing the target detection gene. Primers and crRNA were designed on this sequence, the upstream primer sequence was shown in SEQ ID NO: 1 (CTTTGACAACCGTGGCATTGGCTTCTCTGAAC), the downstream primer sequence was shown in SEQ ID NO: 2 (CATCGGATACCCTGAATGGCGGAGGGTCAC), and the crRNA sequence was shown in SEQ ID NO: 3 (UAAUUUCUACUAAGUGUAGAUACGCUUCAGGGAAUUGCUCA). The reporter sequence is FAM-TTATT-BHQ1.

[0032] Prepare recombinant plasmid working standards, respectively:

[0033] Working standard 1, prepared with double distilled water, contains 1.0×10 5 copies / μl plasmid containing DNA fragment of Pseudomonas syringae pv. kiwifruit.

[0034] Working standard 2, prepared with double distilled water, contains 1.0×104 copies / μl plasmid containing DNA fragment of Pseudomonas syringae pv. kiwifruit.

[0035] Working standard 3, prepared with double distilled water, contains 1.0×10 3 copies / μl plasmid containing DNA fragment of Pseudomonas syringae pv. kiwifruit.

[0036] Working standard 4, prepared with double distilled water, contains 1.0×10 2 copies / μl plasmid containing DNA fragment of Pseudomonas syringae pv. kiwifruit.

[0037] Working standard 5, prepared with double distilled water, contains 1.0×10 1 copies / μl plasmid containing DNA fragment of Pseudomonas syringae pv. kiwifruit.

[0038] Example 2 Sensitivity Experiment

[0039] (1) Preparation of RPA reaction system

[0040] Prepare the components according to Table 1 below, 50 μl system.

[0041] Table 1 RPA amplification system (50 μL reaction system)

[0042]

[0043] Prepare the dosage for 7 reactions according to Table 1 above, mix well in a 1.5ml EP tube, draw 46μl and add to 6 RPA reaction units (LeShang Biotechnology Co., Ltd.) respectively to dissolve the lyophilized powder, add 1μL negative control, 1μL standard working product 5, 1μL standard working product 4, 1μL standard working product 3, 1μL standard working product 2, 1μL standard working product 1 as templates to the above 6 prepared reaction reagent test tubes, mix each reaction tube thoroughly after adding the sample, and the total volume of each reaction tube is 50μL. React the 6 mixed reaction tubes at 37°C for 30min.

[0044] (2) Preparation of Cas12a reaction system

[0045] Table 2 CRISPR-Cas12a detection system (20 μl reaction system)

[0046]

[0047] Prepare the above system and put it into the detector for detecting FAM fluorescence. Set the reaction temperature to 37℃ and the reaction time to 30min. The test results are shown in the attached Figure 1For visual detection, the above system was prepared, 37°C, reaction time 30min, and photographed in a blue light gel cutting instrument. The detection results are shown in the attached Figure 2 shown.

[0048] The test results show that the detection sensitivity can reach 1.0×10 1 copies / reaction, that is, if there are 10 copies in each reaction tube, it can be detected within 30 minutes, achieving rapid and sensitive detection results.

[0049] Example 3 Specificity Experiment

[0050] Sample source and DNA extraction

[0051] Sample information: Pseudomonas syringaepv.actinidiae, Pspv.tabaci, P.fluorescens, P.putida, P.marginalis pv.Marginalis, P.syringae, Pspv.Syringae, Stenotrophomonas maltophilia, Xanthomonas campestris pv.Campestris, Xanthomonasalbilineans. DNA was extracted using a bacterial DNA extraction kit (Tiangen Biochemical Technology Co., Ltd.).

[0052] (1) Preparation of RPA reaction system

[0053] Prepare the dosage for 11 reactions according to Table 1, mix well in a 1.5ml EP tube, take 46μl and add to 10 RPA reaction units (LeShang Biotechnology Co., Ltd.) respectively to dissolve the lyophilized powder, add 1μL of the 10 extracted sample DNAs to the above 10 prepared reaction reagent test tubes respectively, and mix each reaction tube thoroughly after adding the sample, and the total volume of each reaction tube is 50μL. React the 10 mixed reaction tubes at 37℃ for 30min.

[0054] (2) Preparation of Cas12a reaction system

[0055] Prepare according to the system in Table 2, put it into the detector for detecting FAM fluorescence, set the reaction temperature to 37°C, and the reaction time to 30 minutes. The test results are shown in the attached Figure 3 For visual detection, the above system was prepared, 37°C, reaction time 30min, and photographed in a blue light gel cutting instrument. The detection results are shown in the attached Figure 4 shown.

[0056] The test results show that this method has good detection performance on actual samples.

[0057] Example 4 Actual sample detection experiment

[0058] Sample information: positive samples 1-4, 6-9, 11-14, negative samples 5, 10, 15. The samples were diseased Actinidia arguta leaves, and the leaf tissue at the junction of diseased and healthy leaves was cut. After liquid nitrogen grinding, the bacterial genomic DNA isolation kit (Hangzhou Beiwo Medical Technology Co., Ltd.) was used to extract the sample DNA.

[0059] (1) Preparation of RPA reaction system

[0060] Prepare the dosage for 4 reactions according to Table 1, mix well in a 1.5ml EP tube, draw 46μl and add to 3 RPA reaction units (LeShang Biotechnology Co., Ltd.) respectively to dissolve the lyophilized powder, add 1μL of the extracted sample DNA to the above 3 prepared reaction reagent test tubes respectively, and mix each reaction tube thoroughly after adding the sample, and the total volume of each reaction tube is 50μL. React the 3 mixed reaction tubes at 37℃ for 30min.

[0061] (2) Preparation of Cas12a reaction system

[0062] Prepare according to the system in Table 2, put it into the detector for detecting FAM fluorescence, set the reaction temperature to 37°C, and the reaction time to 30 minutes. The test results are shown in the attached Figure 5 For visual detection, the above system was prepared, 37°C, reaction time 30min, and photographed in a blue light gel cutting instrument. The detection results are shown in the attached Figure 6 shown.

[0063] The test results show that this method has good detection performance on actual samples.

[0064] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A CRISPR-Cas12a kit for rapid detection of Pseudomonas syringae pseudomonas kiwifruit pathogenic variants in Actinidia arguta, characterized in that: It includes the following components: upstream primer, downstream primer, crRNA, Cas12a protein and single-stranded DNA reporter molecule; The upstream primer sequence is shown in SEQ ID NO: 1, the downstream primer sequence is shown in SEQ ID NO: 2, and the crRNA sequence is shown in SEQ ID NO:

3.

2. The kit according to claim 1, characterized in that The Cas12a protein is LbCas12a protein.

3. The kit according to claim 2, characterized in that The single-stranded DNA reporter molecule is a fluorescent reporter group-TTATT-fluorescence quencher group.

4. The kit according to claim 3, characterized in that The fluorescent reporter group is FAM, HEX, TET, JOE or VIC, and the fluorescent quencher group is BHQ1, BHQ2 or BHQ3.

5. The kit according to claim 4, characterized in that The kit also includes RPA buffer, double distilled water, magnesium ions, and 10×LbCas12aBuffer.

6. A method for rapidly detecting the kiwifruit pathogenic variant of Pseudomonas syringae in kiwifruit based on CRISPR-Cas12a using the kit according to any one of claims 1 to 5, characterized in that: The steps include: (1) extracting DNA from the sample to be tested as a DNA template; (2) preparing an RPA reaction system with an RPA buffer, an upstream primer, a downstream primer, double distilled water and magnesium ions, then adding the DNA template to perform RPA amplification to obtain an RPA amplification product; (3) Prepare the Cas12a reaction system with 10×LbCas12aBuffer, crRNA, single-stranded DNA reporter molecule, Cas12a protein, water and RPA amplification product, react and observe the results.

7. The method according to claim 6, characterized in that The final concentrations of the upstream primer and the downstream primer in the RPA reaction system are independently 300-500 nM, and the volume ratio is 0.8-1.2:0.8-1.

2.

8. The method according to claim 7, characterized in that The conditions for the RPA amplification are: 35-37° C., 10-40 min.

9. The method according to claim 8, characterized in that The final concentration of the crRNA in the RPA reaction system is 200-300 nM, and the reaction conditions are: 35-37° C., 10-40 min.

10. The method according to claim 9, characterized in that The result is a fluorescence result or a visualization result.

Images