SNP (Single Nucleotide Polymorphism) molecular marker combination related to corn kernel traits and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination related to corn kernel traits and application thereof, and belongs to the technical field of molecular genetics. The SNP molecular marker related to the corn hundred-grain weight is developed by researching the relation between the Zm00001d014723 gene and the corn grain weight, early prediction of the yield of the selfing line is further achieved through PCR amplification and agarose gel electrophoresis and through direct and rapid identification of seedlings, and a new thought is provided for molecular breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and in particular to a SNP molecular marker combination related to corn kernel traits and an application thereof. Background Art

[0002] Corn is an important food, cash, and feed crop. High yield is one of the most important goals of corn breeding. Kernel-related traits, such as kernel length, kernel width, and 100-kernel weight, are key factors determining corn yield per unit area and have high heritability. Therefore, elucidating the genetic basis of corn kernel-related traits has theoretical guidance for the innovation of high-yield corn germplasm resources and the breeding of new varieties.

[0003] Unlike traditional breeding methods to increase yield, molecular marker technology is more efficient and reliable, greatly shortening the process of corn breeding. In recent years, a variety of molecular markers such as RFLP (restriction fragment length polymorphism), SSR (Simplesequence repeats), and SNP (single nucleotide polymorphism) have been used in corn breeding, which has played a certain role in quickly identifying corn kernel weight and promoting the increase of corn yield. Among them, SNP, as a common form of genetic variation, is widely present in biological genomes, accounting for about 90% of all known variations. Although SNP sites appear frequently, not all SNP sites can become candidate markers related to traits, which is mainly related to the location where the SNP occurs. The Zm00001d014723 gene is located on chromosome 5 of maize. Currently, no SNPs have been reported at the Zm00001d014723 gene location. Therefore, discovering and identifying superior alleles associated with maize kernel traits at the Zm00001d014723 gene location and developing corresponding molecular markers are of great production application value for the breeding of high-yield maize. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide a SNP molecular marker combination related to corn kernel traits and its application.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, a SNP molecular marker combination associated with corn kernel traits is provided, comprising a first molecular marker and a second molecular marker;

[0007] The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the 65th base from the 5' end of the sequence shown in SEQ ID No. 1 is a SNP site, and the base is T or C;

[0008] The nucleotide sequence of the second molecular marker is shown in SEQ ID No. 2. The 25th base from the 5' end of the sequence shown in SEQ ID No. 2 is a SNP site, and the base is C or T.

[0009] The nucleotide sequence of the first molecular marker is as follows:

[0010] CAGTAGACACATCGGCTCTGAAGACTGGCATGCACACATGCACATCTGGAAACGACAATGAGGGYACAGAGTCTGTGTGGGATAGGTATGAAAATAACCTGCAAGTGTTCGCTGA

[0011] Note: The nucleotides in bold shade in the sequence are SNP sites, and the nucleotide polymorphism is T / C, which is represented by "Y" in the sequence table.

[0012] The nucleotide sequence of the second molecular marker is as follows:

[0013] CTGCTGGTGCATCCATAGAAATCTYTGGTTCAAGCAGCTTAATAAGTGATCAA GTGGGAG

[0014] Note: The nucleotides in bold shade in the sequence are SNP sites, and the nucleotide polymorphism is C / T, which is represented by "Y" in the sequence table.

[0015] The present invention screened two single-nucleotide polymorphisms (SNPs) associated with maize kernel traits in the coding region of the maize Zm00001d014723 gene. These SNPs are located at nucleotides 936 and 1112, respectively, in the coding region of the Zm00001d014723 gene as shown in SEQ ID No. 3. Based on these SNPs, the present invention further developed and designed a first molecular marker and a second molecular marker. The first molecular marker, when the base at the SNP site is T, and the second molecular marker, when the base at the SNP site is C, correspond to high-grain weight. The combination of the two markers can be used for detecting maize kernel traits and breeding high-yield maize varieties.

[0016] The second aspect of the present invention provides the use of the above-mentioned SNP molecular marker combination in the following (1) or (2):

[0017] (1) Screening or identifying kernel traits of maize germplasm resources;

[0018] (2) Molecular marker-assisted breeding of corn.

[0019] In the above application, the grain traits include: 100-grain weight, grain length and grain width.

[0020] In the above application, the maize molecular marker-assisted breeding is specifically for: breeding of high-yield maize inbred lines.

[0021] In a third aspect of the present invention, there is provided a primer pair for amplifying the above-mentioned SNP molecular marker combination, comprising: a primer pair A for detecting a first molecular marker and a primer pair B for detecting a second molecular marker;

[0022] The nucleotide sequences of primer pair A are shown in SEQ ID No. 4 and SEQ ID No. 5. Specifically, they are as follows:

[0023] P-936-F1: 5'-CAGTAGACACATCGGCTCTG-3'; (SEQ ID No. 4)

[0024] P-936-R1: 5'-TCAGCGAACACTTGCAGGTTA-3'. (SEQ ID No.5)

[0025] The nucleotide sequences of primer pair B are shown in SEQ ID No. 6 to SEQ ID No. 8. Specifically, they are as follows:

[0026] P-1112-F2-1: 5'-GAAGGTGACCAAGTTCATGCTCTGCTGGTGCATCCATAGAAATCTT-3'; (SEQID No. 6)

[0027] P-1112-F2-2: 5'-GAAGGTCGGAGTCAACGGATTGCTGGTGCATCCATAGAAATCTC-3'; (SEQ ID No. 7)

[0028] P-1112-R2: 5'-CTCCCACTTGATCACTTATTAAGCTGC-3'. (SEQ ID No. 8).

[0029] The shaded area in P-1112-F2-1 represents the sequence of FAM blue fluorescence; the shaded area in P-1112-F2-2 represents the sequence of HEX red fluorescence.

[0030] A fourth aspect of the present invention provides a kit containing the above primer pair.

[0031] The above-mentioned primer pairs or kits can be used to amplify or detect the above-mentioned SNP molecular marker combination. For the first molecular marker, it is amplified by primer pair A and then identified by enzyme digestion; for the second molecular marker, it is amplified by primer pair B and then identified based on the color of the fluorescent signal.

[0032] The fifth aspect of the present invention provides the use of the above primer pair or kit in the following (1) or (2):

[0033] (1) Screening or identifying kernel traits of maize germplasm resources;

[0034] (2) Molecular marker-assisted breeding of corn.

[0035] In the above application, the grain traits include: 100-grain weight, grain length and grain width.

[0036] In the above application, the maize molecular marker-assisted breeding is specifically for: breeding of high-yield maize inbred lines.

[0037] A sixth aspect of the present invention provides a method for detecting corn kernel traits, comprising the following steps:

[0038] Using the genomic DNA of the corn to be tested as a template, PCR amplification was performed using primer pair A shown in SEQ ID No. 4 and SEQ ID No. 5, and the genotype at the SNP site of the first molecular marker was identified based on the amplification results; PCR amplification was performed using primer pair B shown in SEQ ID No. 6 to SEQ ID No. 8, and the genotype at the SNP site of the second molecular marker was identified based on the amplification results;

[0039] The maize inbred line whose first molecular marker is TT genotype and whose second molecular marker is CC genotype has higher 100-grain weight, grain length and grain width than the maize inbred line whose first molecular marker is CC genotype and whose second molecular marker is TT genotype.

[0040] Preferably, the PCR product after primer pair A amplification is digested with restriction endonuclease BseSI, and the genotype at the SNP site of the first molecular marker is identified based on the number of bands of the digested product; if there is only one 115bp band, it is a TT genotype, and if there are two bands of 50bp and 65bp, it is a CC genotype.

[0041] Preferably, the genotype at the SNP site of the second molecular marker is identified based on the color of the fluorescent signal after amplification by primer pair B; if the fluorescent signal is red, it is the CC genotype, and if the fluorescent signal is blue, it is the TT genotype.

[0042] Beneficial effects of the present invention:

[0043] By studying the relationship between the Zm00001d014723 gene and corn kernel weight, this paper developed SNP molecular markers related to corn production traits such as 100-kernel weight, kernel length and kernel width. Furthermore, through PCR amplification and agarose gel electrophoresis, direct and rapid identification of seedlings was performed to achieve early prediction of inbred line yield, providing new ideas for molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Images of wild-type and Zm00001d014723 mutant kernels from the RP125 maize inbred line. Panel A shows the phenotypes of kernel length and width for the wild-type and mutant varieties. Panel B shows a statistical analysis of kernel length, width, and 100-kernel weight for the wild-type and mutant varieties. WT represents the RP125 inbred line, and MT represents the Zm00001d014723 mutant.

[0045] Figure 2 Images of wild-type and Zm00001d014723 mutant kernels from the B104 inbred maize background. Panel A shows the phenotypes of kernel length and width for the wild-type and mutant varieties. Panel B shows a statistical analysis of kernel length, width, and 100-kernel weight for the wild-type and mutant varieties. WT represents the B104 inbred line, and MT represents the Zm00001d014723 mutant.

[0046] Figure 3 Figure 1 shows the SNP information for the Zm00001d014723 gene. Figure A shows the haplotypes and corresponding SNP information for the Zm00001d014723 gene. The gray left arrow indicates the gene is on the antisense strand, the large gray box indicates the gene exon, the small gray box indicates the gene UTR, and the gray line indicates the gene intron. Black numbers indicate SNP locations, and red numbers indicate emphasis. LD indicates the association between SNPs. Red dots in the figure indicate a strong association between the two SNPs at Chr5:60592800 (i.e., the first molecular marker) and Chr5:60592624 (i.e., the second molecular marker). Figure B shows a comparison of 100-kernel weight among maize inbred lines with different haplotypes (P=0.0006). Figure C shows a comparison of kernel length among maize inbred lines with different haplotypes (P=0.0002). Figure D shows a comparison of kernel width among maize inbred lines with different haplotypes (P=0.0188).

[0047] Figure 4 The following are the results of BseSI digestion of the first molecular marker in the gene region of some maize inbred lines (agarose gel electrophoresis) for different genotypes. Inbred lines with a C nucleotide at the first molecular marker SNP site were split into 50bp and 65bp, indicating a low-grain-weight genotype, known as Hap1. Inbred lines with a T nucleotide at the first molecular marker SNP site were not digested by the enzyme, retaining 115bp, indicating a high-grain-weight genotype, known as Hap2.

[0048] Figure 5 This is the KASP genotyping map of some maize inbred lines at Chr5:60592624. DETAILED DESCRIPTION

[0049] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0050] As mentioned earlier, maize is one of the most widely distributed and highest-yielding food crops worldwide. It is also an important feed, industrial raw material, and energy crop. Stabilizing and increasing maize yield plays a vital role in ensuring my country's food and energy security. Therefore, identifying a new molecular marker that significantly increases maize kernel weight to achieve yield improvements is crucial.

[0051] During the research, the inventors used the chemical mutagen ethyl methane sulfonate (EMS) to treat the pollen of the backbone inbred line RP125 and obtained a mutant with significantly smaller grains and stable inheritance ( Figure 1 The gene controlling the grain mutation phenotype was located as Zm00001d014723 through map-based cloning. Then, using the maize B104 inbred line as the recipient material, a knockout mutant of the Zm00001d014723 gene was obtained using CRISPR / Cas9 technology. The results showed that the mutant's grain length, grain width, and 100-grain weight were significantly reduced compared to the wild type ( Figure 2 ). This proves that the Zm00001d014723 gene is a key gene regulating maize kernel size. The coding region sequence of the Zm00001d014723 gene is shown in SEQ ID No. 3, as follows:

[0052]

[0053] To facilitate breeding practices, this study used the Zm00001d014723 gene as the research target and developed a single-nucleotide polymorphism (SNP) molecular marker associated with maize kernel traits. This marker is derived from the coding region of the Zm00001d014723 gene. This coding region exhibits a characteristic shift from C / C and T / T (low kernel weight) to T / T and C / C (high kernel weight) at positions 60592800 and 60592624.

[0054] When the bases at positions Chr5: 60592800 and Chr5: 60592624 were detected to be homozygous C / C and T / T respectively, the inbred line was predicted to be a low-grain weight inbred line, which is the main genotype of most inbred lines; when the bases at positions Chr5: 60592800 and Chr5: 60592624 were detected to be homozygous T / T and C / C respectively, the inbred line was predicted to be a high-grain weight inbred line, which only exists in a few inbred lines.

[0055] The present invention also provides a method for predicting grain weight of maize inbred lines using the aforementioned SNP molecular markers. Using PCR amplification and enzyme digestion, the base sequences at positions 60592800 and 60592624 of the coding region of the Zm00001d014723 gene are determined to be C / C, T / T, or T / T, C / C, respectively. The C / C and T / T types indicate low-grain-weight inbred lines, while the T / T and C / C types indicate high-grain-weight inbred lines.

[0056] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0057] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0058] Example 1: Screening and association analysis of SNP loci associated with corn kernel traits

[0059] The kernel trait information of 500 maize inbred lines and the coding region information of the Zm00001d014723 gene were obtained from the ZEAMAP website (http: / / www.zeamap.com / ). A total of 11 SNP sites were found, forming 8 haplotypes, as follows: Figure 3 As shown in A.

[0060] By analyzing different haplotypes and grain weight information (including 100-grain weight, grain length and grain width), only the grain weight of the inbred lines of haplotype 1 (Hap1) and haplotype 2 (Hap2) showed significant differences (P=0.0006).

[0061] This screening identified two SNPs significantly associated with grain weight, located at Chr5:60592800 and Chr5:60592624. Chr5:60592800 corresponds to nucleotide position 936 in the coding region of the Zm00001d014723 gene as shown in SEQ ID No. 3; Chr5:60592624 corresponds to nucleotide position 1112 in the coding region of the Zm00001d014723 gene as shown in SEQ ID No. 3. The maize reference genome for these locations is B73RefGen_v4.

[0062] The above two SNP sites are strongly correlated. In order to facilitate their use in actual production, two molecular markers were developed based on these two SNP sites, wherein: the nucleotide sequence of the first molecular marker is shown in SEQ ID No.1, and the 65th base from the 5' end of the sequence shown in SEQ ID No.1 is the SNP site, and its base is T or C; the nucleotide sequence of the second molecular marker is shown in SEQ ID No.2, and the 25th base from the 5' end of the sequence shown in SEQ ID No.2 is the SNP site, and its base is C or T.

[0063] Example 2: Detection of genotypes at SNP sites associated with corn kernel traits

[0064] 1. Detection of the genotype at the SNP site of the first molecular marker:

[0065] For the first molecular marker developed in Example 1, the following primer pair A was designed:

[0066] P-936-F1: 5'-CAGTAGACACATCGGCTCTG-3'; (SEQ ID No. 4)

[0067] P-936-R1: 5'-TCAGCGAACACTTGCAGGTTA-3'. (SEQ ID No.5)

[0068] Using the genomic DNA of the maize to be tested as a template, PCR amplification of A was performed using primers shown in SEQ ID No. 4 and SEQ ID No. 5. The PCR kit was 2× Taq Plus Master Mix II (Dye Plus), the reaction system was shown in Table 1, and the amplification program was shown in Table 2.

[0069] Table 1: PCR reaction system

[0070] Components Volume (μL) <![CDATA[ddH2O]]> To 20μL 2×Taq Plus Master Mix II(Dye Plus) 10 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL DNA sample (concentration approximately 200 ng / μL) 1 μL

[0071] Table 2: PCR reaction program

[0072]

[0073] The obtained PCR product was digested with the restriction endonuclease BseSI (New England Biolabs). The BseSI cleavage site is 5'-G(G / T)GC(A / C)C-3'. The PCR product digestion system is shown in Table 3:

[0074] Table 3: Enzyme digestion system

[0075] Components Volume (μL) Restriction enzymes 0.2μL 10X NEBuffer 0.7 μL PCR products 5μL <![CDATA[ddH2O]]> To 7μL

[0076] Use 4% agarose gel electrophoresis to distinguish the enzyme digestion results. If the nucleotide at the SNP site of the first molecular marker is T, it cannot be digested by enzyme, and there is only one 115bp band. The genotype (TT) is a high-grain weight genotype; if the nucleotide at the SNP site of the first molecular marker is C, the enzyme digestion product is divided into two bands of 50bp and 65bp. The genotype (CC) is a low-grain weight genotype.

[0077] 2. Detection of genotype at the SNP site of the second molecular marker:

[0078] For the second molecular marker developed in Example 1, the following primer pair B was designed using KASP typing technology:

[0079] P-1112-F2-1: 5'-GAAGGTGACCAAGTTCATGCTCTGCTGGTGCATCCATAGAAATCTT-3'; (SEQID No. 6)

[0080] P-1112-F2-2: 5'-GAAGGTCGGAGTCAACGGATTGCTGGTGCATCCATAGAAATCTC-3'; (SEQ ID No. 7)

[0081] P-1112-R2: 5'-CTCCCACTTGATCACTTATTAAGCTGC-3'. (SEQ ID No.8)

[0082] It includes two upstream typing primers P-1112-F2-1 (3' end is T), P-1112-F2-2 (3' end is C) and a universal downstream primer P-1112-R2; among them, P-1112-F2-1 has FAM blue fluorescence and P-1112-F2-2 has HEX red fluorescence.

[0083] PCR amplification was performed using the maize inbred line genome as a template. The PCR kit used was 2× Master Mix for ASPCRV1 (Chengdu Hanchen Guangyi Bioengineering Co., Ltd.). The reaction system is shown in Table 4, and the amplification procedure is shown in Table 5.

[0084] Table 4: PCR reaction system

[0085] Components Volume (μL) <![CDATA[ddH2O]]> To 10μL 2×Master Mix (HCSCI) 5μL Upstream primer (10 μM) 0.25 μL Downstream primer (10 μM) 0.25 μL DNA sample (concentration approximately 35ng / μL) 1 μL

[0086] Table 5: PCR reaction program

[0087]

[0088] The genotype of each cross is determined according to the color of the fluorescent signal. If the fluorescent signal is blue, the genotype of the SNP site of the second molecular marker (Chr5: 60592624) is TT; if the fluorescent signal is red, the genotype of the SNP site of the second molecular marker (Chr5: 60592624) is CC.

[0089] Example 3: Application of SNP molecular marker combinations associated with maize kernel traits in identifying maize 100-kernel weight, kernel length, and kernel width

[0090] Five seeds of each of 24 maize inbred lines were taken and planted in an artificial climate chamber (16 h light, 8 h dark, temperature 28°C, relative humidity 50%). On the tenth day of germination, a 2 cm thick seed was selected from the middle of the second leaf. 2 Leaves of different sizes. Five individual plants of each inbred line were repeated and placed in the same centrifuge tube. The genomes of 24 inbred lines were extracted using the CTAB method. The centrifuge tubes containing the leaves and steel balls were quickly frozen in liquid nitrogen for five minutes, and then ground with a Xinzhi high-throughput tissue grinder, set to 55Hz, 45s. Then, 500μL of CTAB preheated at 65℃ was added, mixed, and incubated at 65℃ for 30min. Let it cool to room temperature, then add 200μL of chloroform, mix again, and centrifuge at 12000rpm for 10min. Take 400μL of supernatant, add it to 400μL of anhydrous ethanol, invert to mix, and centrifuge at 10000rpm for 5min. Wash twice with 75% ethanol, dry it, and then dissolve it back with 100μLddH2O, and store it at 4℃.

[0091] The extracted genome of the maize inbred line was used as a template, and the genotypes of the SNP sites related to maize grain traits in the maize inbred line materials were detected according to the method of Example 2. The detection results of the genotypes of the SNP sites of the first molecular marker in some maize inbred lines are as follows: Figure 4 As shown; the detection results of the genotypes at the SNP sites of the second molecular markers in some maize inbred lines are shown as follows Figure 5 The results showed that among the 24 maize inbred lines tested, 13 were haplotype 1 (Hap1), which was determined to be low-grain-weight inbred lines; and 11 were haplotype 2 (Hap2), which was determined to be high-grain-weight inbred lines.

[0092] After the corn matured, its 100-grain weight, grain width and grain length were examined. The results showed that the 100-grain weight, grain width and grain length of the inbred line of haplotype 2 were higher than those of the inbred line of haplotype 1, which was consistent with the identification results of the SNP molecular marker combination.

[0093] The above results prove that the SNP molecular marker combination of the present invention can be used to detect corn kernel traits, and the results are accurate and reliable.

[0094] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A SNP molecular marker combination related to corn kernel traits, characterized in that: including a first molecular marker and a second molecular marker; The nucleotide sequence of the first molecular marker is shown in SEQ ID No. 1, and the 65th base from the 5' end of the sequence shown in SEQ ID No. 1 is a SNP site, and the base is T or C; The nucleotide sequence of the second molecular marker is shown in SEQ ID No.

2. The 25th base from the 5' end of the sequence shown in SEQ ID No. 2 is a SNP site, and its base is C or T.

2. Use of the SNP molecular marker combination according to claim 1 in the following (1) or (2): (1) Screening or identifying kernel traits of maize germplasm resources; (2) Molecular marker-assisted breeding of corn.

3. The use according to claim 2, characterized in that: The grain traits include: 100-grain weight, grain length and grain width.

4. The use according to claim 2, characterized in that: The maize molecular marker-assisted breeding specifically includes: breeding of high-yield maize inbred lines.

5. A primer pair for amplifying the SNP molecular marker combination according to claim 1, characterized in that: include: A primer pair A for detecting a first molecular marker and a primer pair B for detecting a second molecular marker; The nucleotide sequences of primer pair A are shown in SEQ ID No.4 and SEQ ID No.5; the nucleotide sequences of primer pair B are shown in SEQ ID No.6-SEQ ID No.

8.

6. A kit comprising the primer pair according to claim 5.

7. Use of the primer pair according to claim 5 or the kit according to claim 6 in the following (1) or (2): (1) Screening or identifying kernel traits of maize germplasm resources; (2) Molecular marker-assisted breeding of corn.

8. A method for detecting corn kernel traits, characterized in that: The following steps are involved: Using the genomic DNA of the corn to be tested as a template, PCR amplification is performed using the primer pair A shown in SEQ ID No.4 and SEQ ID No.5, and the genotype at the SNP site of the first molecular marker is identified according to the amplification result; PCR amplification is performed using the primer pair B shown in SEQ ID No.6-SEQ ID No.8, and the genotype at the SNP site of the second molecular marker is identified according to the amplification result; The 100-grain weight, grain length and grain width of the corn inbred line whose first molecular marker is TT genotype and whose second molecular marker is CC genotype are higher than those of the corn inbred line whose first molecular marker is CC genotype and whose second molecular marker is TT genotype.

9. The method according to claim 8, characterized in that The PCR product after primer pair A amplification was digested with restriction endonuclease BseSI, and the genotype at the SNP site of the first molecular marker was identified according to the number of bands of the digested product; if there was only one 115bp band, it was a TT genotype, and if there were two bands of 50bp and 65bp, it was a CC genotype.

10. The method according to claim 8, characterized in that The genotype at the SNP site of the second molecular marker is identified according to the color of the fluorescent signal after amplification by primer pair B; if the fluorescent signal is red, it is the CC genotype, and if the fluorescent signal is blue, it is the TT genotype.

Images