Photo-thermal-chemical power synergistic nano-composite system modified by lung targeting peptide as well as preparation method and application of photo-thermal-chemical power synergistic nano-composite system

Abstract

The invention belongs to the field of nano biomedicine, and particularly discloses a lung targeting peptide modified photo-thermal-chemical power synergistic nano composite system as well as a preparation method and application of the lung targeting peptide modified photo-thermal-chemical power synergistic nano composite system. Then, lung targeted peptide modification and polyethylene glycol modification are performed to obtain the lung targeted peptide modified photo-thermal-chemical power synergistic nano-composite system; according to the system, the lung tumor is effectively killed by utilizing a chemical kinetics therapy in cooperation with photothermal therapy, and precise targeting of the nano-enzyme to lung tumor tissues is further realized through modification of lung targeting peptide.

Description

Technical Field

[0001] The present invention relates to the field of nano-biomedicine, and in particular to a photothermal-chemical power synergistic nano-composite system modified with a lung targeting peptide, and a preparation method and application thereof. Background Art

[0002] With the increasing incidence of cancer worldwide, lung cancer has become one of the leading causes of death in cancer patients. Traditional treatments for lung cancer, such as surgery, chemotherapy, and radiotherapy, have limited therapeutic effects due to their side effects and low efficacy. Benefiting from the booming development of nanomedicine, various treatments based on inducing intracellular oxidative stress have been studied for anti-tumor treatment, such as photodynamic therapy (PDT). Among them, reactive oxygen species (ROS) are important signaling and regulatory molecules at the physiological level, mainly composed of hydroxyl radicals, singlet oxygen, and superoxide anions. However, an increase in ROS concentration to abnormal levels can cause cancer cell death by inducing membrane lipid peroxidation, DNA damage, and protein denaturation.

[0003] Photothermal therapy (PTT) is a cancer treatment that uses highly efficient photothermal agents to generate heat through near-infrared light irradiation. Compared with traditional tumor treatment methods, PTT has unique advantages such as high tumor specificity, less damage to surrounding normal tissues, and reduced pain for patients. However, since the distribution of photosensitive materials in the tumor may be uneven, the thermal effect produced may also be uneven, resulting in some tumor cells not being effectively killed. This may lead to incomplete treatment and even cause tumor recurrence. The present invention makes full use of the weak acid and hydrogen peroxide-rich conditions of the tumor microenvironment, penetrates deep into the tumor tissue, covers a wide range, and complements PTT to increase temperature and expand blood vessels, greatly improving the efficiency of tumor treatment.

[0004] Chemodynamic therapy (CDT) is a treatment method that uses functional nanoparticles to induce Fenton or Fenton-like reactions in tumor tissues or tumor cells in situ under conditions such as acidic and hydrogen peroxide-rich tumor microenvironment (TME) to produce highly oxidizing hydroxyl radicals (·OH), thereby inducing cancer cell death. CDT does not rely on off-site stimulation, and can intuitively regulate the hypoxia defect of TME, with little damage to surrounding healthy tissues. It has the advantage of good biosafety and has been considered as an emerging non-invasive cancer treatment method. However, CDT is highly dependent on the characteristics of the tumor microenvironment, such as the concentration and acidity level of hydrogen peroxide. However, different tumors or different regions of the same tumor may have heterogeneity in these aspects, thereby affecting the treatment effect. The present invention generates local high temperature under 808-1064nm near-infrared light irradiation, which can improve the permeability of tumor tissue, promote the effective delivery and distribution of nanozymes, and alleviate the therapeutic defects of CDT to a certain extent.

[0005] Nanozymes are a class of artificially synthesized nanomaterials with catalytic activity similar to that of natural enzymes. Metal nanozymes are mainly reflected in improving biocatalytic efficiency, solving redox imbalance, improving tumor and infection treatment, enhancing disease diagnosis sensitivity, and having advantages such as enhanced drug stability and reduced production costs compared with natural enzyme preparations. Their wide range of functions and potential clinical application prospects make them an important tool in modern medical research. However, after intravenous administration of metal nanozymes, their nonspecific aggregation in tissues or organs may induce specific systemic adverse reactions, leading to varying degrees of hepatotoxicity, nephrotoxicity, neurotoxicity and other side effects.

[0006] Therefore, it is necessary to develop a photothermal-chemodynamic synergistic nanocomposite system modified with lung-targeting peptides to reduce the systemic adverse reactions of metal nanozymes to human tissues or organs and enhance the efficacy of targeted treatment of lung tumors. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a photothermal-chemical dynamic synergistic nanocomposite system modified with a lung targeting peptide, and a preparation method and application thereof.

[0008] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0009] One of the purposes of the present invention is to provide a method for preparing a photothermal-chemical dynamic synergistic nanocomposite system modified with a lung targeting peptide, comprising the following steps:

[0010] S1. Synthesis of Fe-MoO 3-x Nanozyme: 0.5-0.8 g tannic acid (TA), 0.4-0.5 g Na2MoO4·7H2O and 0.75-0.85 g FeCl3 were dissolved in 35 mL distilled water, stirred for 30 min, transferred into a 50 mL polytetrafluoroethylene autoclave, kept at 160-180 ° C for 10 h, and finally the precipitate was collected, washed with distilled water several times, and dried to obtain Fe-MoO 3-x Nanozymes;

[0011] S2. Construction of a photothermal-chemical synergistic nanocomposite system modified with lung-targeting peptide: 25 mg Fe-MoO 3-x Nanozyme was added with 5 mL of deionized water, 50 mg of polyethylene glycol (PEG) and 100 μL of acrylic acid, stirred overnight at 25 °C and 500 rpm, and the precipitate was obtained by centrifugation and washed several times with deionized water to obtain Fe-MoO 3-x -PEG nanozyme; the obtained Fe-MoO 3-x-PEG nanozyme, 0.2g of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and 0.05g of N-hydroxysuccinimide ester (NHS) were added to 5mL of deionized water, stirred at room temperature for 120min, and centrifuged to obtain the precipitate after aliquoting. 5mg of the precipitate was added to 100μL of a 5mg / mL lung targeting peptide solution to obtain a photothermal-chemical dynamic synergistic nanocomposite system modified with a lung targeting peptide, which was stored at -20°C.

[0012] Furthermore, the Fe-MoO 3-x The particle size of nanozymes is 100-200nm.

[0013] Preferably, the nucleotide sequence of the lung targeting peptide is: GACGTCGGTGGCTCTGGTGCGGCTAGTGGCGCGAGCGGTACCGGT.

[0014] The second object of the present invention is to provide a photothermal-chemical dynamic synergistic nanocomposite system modified with a lung targeting peptide prepared by the above method.

[0015] The third object of the present invention is to provide a photothermal-chemodynamic synergistic nanocomposite system modified with a lung targeting peptide for use in the preparation of drugs for the targeted treatment of lung tumors.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. The photothermal-chemical dynamic synergistic nanocomposite system modified with lung targeting peptide of the present invention is Fe-MoO 3-x Nanozyme: This nanozyme has uniform morphology and good dispersibility. It releases reactive oxygen species (ROS) in a weakly acidic and hydrogen peroxide-rich tumor microenvironment, kills tumor cells using chemodynamic therapy, and further enhances the killing effect in synergistic photothermal therapy.

[0018] 2. The present invention can achieve precise targeting of lung tumors through lung targeting peptide modification; the biocompatibility of nanozymes can be improved through PEG modification to reduce specific systemic adverse reactions to body tissues or organs.

[0019] 3. The present invention is a minimally invasive, intelligent, precise and visualized nanocomposite system, which utilizes chemodynamic therapy in conjunction with photothermal therapy to achieve effective killing of lung tumors, and further achieves precise targeting of lung tumor tissues by nanozymes through modification of lung targeting peptides. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram of the preparation process of the photothermal-chemical dynamic synergistic nanocomposite system modified with lung targeting peptides of the present invention.

[0021] Figure 2 This is a diagram showing the mechanism of killing tumor cells by the photothermal-chemical dynamic synergistic nanocomposite system modified with lung targeting peptides of the present invention.

[0022] Figure 3 The verification diagram of the uniform morphology and good dispersion of the nanozyme in the present invention is as follows: (a) Fe-MoO 3-x Nanozyme; (b) Fe-MoO 3-x -PEG nanozymes.

[0023] Figure 4 This is a verification diagram of the potential and particle size of the nanozyme in the present invention.

[0024] Figure 5 This is a verification diagram that the nanozyme in the present invention has chemical kinetic efficiency.

[0025] Figure 6 This is a verification diagram that the nanozyme in the present invention has the photothermal conversion function.

[0026] Figure 7 This is an in vitro experimental verification diagram of the nanozyme in the present invention killing tumor cells.

[0027] Figure 8 This is an in vivo experimental verification diagram of the nanozyme targeting the lungs in the present invention. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0029] Example 1. Preparation of a photothermal-chemical synergistic nanocomposite system modified with a lung targeting peptide Figure 1 As shown, the specific preparation process is as follows:

[0030] S1. Synthesis of Fe-MoO 3-x Nanozyme: 0.5-0.8 g TA, 0.4-0.5 g Na2MoO4·7H2O and 0.75-0.85 g FeCl3 were dissolved in 35 mL distilled water, stirred for 30 min, transferred into a 50 mL polytetrafluoroethylene autoclave, kept at 160-180 ° C for 10 h, and finally the precipitate was collected, washed with distilled water for 3 times, and dried to obtain Fe-MoO 3-x Nanozymes;

[0031] S2. Construction of a photothermal-chemical synergistic nanocomposite system modified with lung-targeting peptide: 25 mg Fe-MoO 3-xNanozyme was added with 5 mL of deionized water, 50 mg of PEG and 100 μL of acrylic acid, stirred overnight at 25 °C and 500 rpm, and the precipitate was obtained by centrifugation and washed three times with deionized water to obtain Fe-MoO 3-x -PEG nanozyme; the obtained Fe-MoO 3-x -PEG nanozyme, 0.2 g EDC and 0.05 g NHS were added to 5 mL deionized water, stirred at room temperature for 120 min, divided into 5 tubes (1 mL per tube) and centrifuged to obtain the precipitate, 5 mg of precipitate was loaded into each tube, and 100 μL of 5 mg / mL lung targeting peptide solution was added to each tube to obtain Fe-MoO 3-x -PEG-FITC, stored at -20°C; the nucleotide sequence of the lung targeting peptide is: GACGTCGGTGGCTCTGGTGCGGCTAGTGGCGCGA GCGGTACCGGT, which was commissioned to Gill Biochemical Shanghai Co., Ltd. for synthesis.

[0032] Comparative Example 1

[0033] Synthetic MoO 3-x Nanozyme: Dissolve 0.5-0.8 g tannic acid (TA) and 0.4-0.5 g Na2MoO4·7H2O in 35 mL distilled water, stir for 30 min, transfer to a 50 mL polytetrafluoroethylene autoclave, keep at 160-180 ° C for 10 h, collect the precipitate, wash it with distilled water several times, and dry it to obtain MoO 3-x Nanozymes.

[0034] The prepared MoO 3-x Nanozymes, Fe-MoO 3-x Nanozymes and Fe-MoO 3-x -Characterization experiment of PEG nanozyme:

[0035] 25 mg of Fe-MoO 3-x Nanozyme was added with 5 mL of deionized water and 50 mg of PEG, stirred overnight at 25 °C and 500 rpm, and the precipitate was obtained by centrifugation and washed three times with deionized water to obtain Fe-MoO 3-x -PEG nanozyme. Take Fe-MoO 3-x Nanozymes and Fe-MoO 3-x 10 μL of each PEG nanozyme solution was dropped onto a 9 mm cell slide and dried overnight. After gold spraying, the appearance and size were observed under a scanning electron microscope. Figure 3 ,Depend on Figure 3 It can be seen that the nanozymes have uniform morphology and good dispersibility.

[0036] The prepared MoO 3-xNanozymes and Fe-MoO 3-x Take 200 μg of each nanozyme and add it into 1 mL of deionized water; add 25 mg of Fe-MoO 3-x Nanozyme was added with 5 mL of deionized water and 50 mg of PEG, stirred overnight at 25 °C and 500 rpm, and the precipitate was obtained by centrifugation and washed three times with deionized water to prepare Fe-MoO 3-x -PEG nanozyme. Take MoO 3-x Nanozymes, Fe-MoO 3-x Nanozymes and Fe-MoO 3-x -PEG nanozyme solution, 500 μL each, and the Zeta potential and particle size were observed using a multi-angle particle size and potential analyzer. Figure 4 ,Depend on Figure 4 It can be seen that the particle size of the nanozyme is uniformly about 200nm; the absolute value of the Zeta potential is high, the system is stable and can resist aggregation.

[0037] The prepared Fe-MoO 3-x Functional experiments of nanozymes:

[0038] The prepared MoO 3-x Nanozymes and Fe-MoO 3-x 400 μg of nanozyme was dissolved in 1 mL of LLC cell culture medium (LLC cells were cultured in DMEM complete medium. LLC cells are mouse Lewis lung cancer cells purchased from Fuheng Biotechnology Co., Ltd. (Shanghai, China)) and ultrasonically dispersed in an ultrasonic cleaner for 2 min. The nanozyme was added to a 6-well cell culture plate. The experimental groups were control group, MoO 3-x Group, MoO 3-x +Near infrared group, Fe-MoO 3-x Group and Fe-MoO 3-x +NIR group, the concentration in each well was controlled at 200μg / mL. After incubation for 4h, MoO 3-x +Near infrared group and Fe-MoO 3-x +NIR group was irradiated with 808-1064nm NIR light for 10min. After overnight culture, the supernatant was discarded, washed 3 times with 1X PBS, and ROS dye (1:1000) was added to each well, 200μL, and incubated at 37℃ for 30min. The residual dye was discarded and washed 3 times with serum-free medium. 100μL of ready-to-use DAPI dye was added to each well and incubated at room temperature for 10min. After washing with 1X PBS, the production of ROS was observed under a microscope. The results are shown in Figure 5 ,Depend on Figure 5 It can be seen that compared with the nanozyme with CDT activity itself, the ROS production is significantly increased under near-infrared light irradiation (assisted by PTT).

[0039] The prepared MoO 3-x Nanozymes and Fe-MoO 3-x Take 200 μg of each nanozyme and dissolve them in 1 mL of deionized water with pH = 6.0 / 6.8 / 7.4 respectively; 3-x Nanozymes and Fe-MoO 3-x Nanozymes were taken at 100 / 200 / 300 μg and dissolved in 1 mL of deionized water (pH = 6.8); the prepared MoO 3-x Nanozymes and Fe-MoO 3-x 200 μg of each nanozyme was dissolved in three portions of 1 mL of deionized water at pH 6.8 and irradiated with near-infrared light at 0.5 W / 1.0 W / 1.5 W respectively. A photothermal imager was used to photograph the MoO2 in the above experimental groups under 808-1064 nm near-infrared light. 3-x Nanozymes and Fe-MoO 3-x Nanozyme solution, observe its photothermal performance, the results are shown in Figure 6 ,Depend on Figure 6 It can be seen that the photothermal performance of nanozymes is proportional to the acidity of the reaction environment; the photothermal performance of nanozymes is proportional to the concentration of nanozymes; and the photothermal performance of nanozymes is proportional to the intensity of near-infrared light.

[0040] The prepared MoO 3-x Nanozymes and Fe-MoO 3-x 400 μg of nanozyme was dissolved in 1 mL of LLC cell culture medium (LLC cells were cultured in DMEM complete medium. LLC cells are mouse Lewis lung cancer cells purchased from Fuheng Biotechnology Co., Ltd. (Shanghai, China)) and ultrasonically dispersed in an ultrasonic cleaner for 2 min. The nanozyme was added to a 6-well cell culture plate. The experimental groups were control group, MoO 3-x Group, MoO 3-x +Near infrared group, Fe-MoO 3-x Group and Fe-MoO 3-x +NIR group, the concentration in each well was controlled at 200μg / mL. After incubation for 4h, MoO 3-x +Near infrared group and Fe-MoO 3-x The +NIR group was irradiated with 808-1064nm NIR light for 10min. After overnight culture, the adherent cells were collected, washed with 1X Assay Buffer, and centrifuged at 450g for 5min. The cell pellet obtained by centrifugation was resuspended with 1X Assay Buffer to count 10 cells in the resuspended cell suspension. 5 -10 6 / mL. Add 1-2μL of Calcein-AM (stock solution) to every 1mL of cells, mix well by pipetting, and incubate at 37℃ in the dark for 20-25min. Take 3-5μL of PI stock solution and add it to the above-stained cells, and stain at room temperature in the dark for 5min. Incubate the cells after fluorescence, 450g, 5min, and centrifuge to remove the staining solution. Wash the cells with 1X PBS at 450g, 5min, centrifuge and resuspend the cells with 1X PBS, take 3-5μL and drop it on a clean slide, press it with a clean coverslip, and observe the live and dead cells under a microscope. The results are shown in Figure 7 ,Depend on Figure 7 It can be seen that compared with the nanozymes that have CDT activity themselves, the tumor cell mortality rate is significantly increased under near-infrared light irradiation (assisted by PTT).

[0041] Example 2: Application of a photothermal-chemodynamic synergistic nanocomposite system modified with a lung targeting peptide in the preparation of drugs for targeted treatment of lung tumors

[0042] Mouse carcinoma in situ tumor model: 24 male C57BL / 6J mice aged 6 to 8 weeks were randomly divided into 4 groups, with 6 mice in each group. 3-x Group and Fe-MoO 3-x +Near-infrared light group. Mouse Lewis lung cancer cells-luciferase labeled (LLC-LUC) were cultured in DMEM complete medium until the logarithmic growth phase, where mouse Lewis lung cancer cells-luciferase labeled (LLC-LUC) were purchased from Fuheng Biotechnology Co., Ltd. (Shanghai, China); LLC-LUC in the logarithmic growth phase were digested with 0.25% trypsin, the cells were collected, centrifuged to remove the supernatant, washed twice with 1X PBS, and the cells were suspended in 1X PBS. The cell viability was determined to be greater than 90% by trypan blue staining, and the cells were counted and the cell concentration was adjusted to 1×10 6 / mL, and the mice were immediately inoculated in situ in the lungs. Live imaging of small animals was taken once a week to monitor tumor growth, and the weight, survival rate and other indicators of each group of mice were monitored daily to evaluate the effectiveness of treatment. Animal experiments were carried out in the Animal Experiment Center of Xuzhou Medical University. All mice were raised in a room with strictly controlled light and dark cycles (lights on ZT7, lights off ZT19) and had free access to water. After feeding for 3 weeks, the mice were killed with sodium pentobarbital.

[0043] Ten male C57BL / 6J mice aged 6 to 8 weeks with successful lung carcinoma in situ tumor model were selected and randomly divided into 5 groups, with 2 mice in each group. The groups were divided into control group, 10 minutes after administration group, 30 minutes after administration group, 1 hour after administration group, and 4 hours after administration group. 25 mg of Fe-MoO3-x nanozyme was added to 5 mL of deionized water, and then 50 mg of PEG and 100 μL of acrylic acid were added, and stirred overnight at 25 ° C and 500 rpm. After centrifugation to obtain the precipitate, the carboxyl group was activated with EDC and NHS, 5 mL of deionized water was added and stirred for 120 min, and then centrifuged and divided into 5 tubes, each tube with 5 mg, and 100 μL of lung targeting peptide solution (5 mg / mL) was added. FITC was modified on the targeting peptide to obtain Fe-MoO3-x-PEG-FITC solution. Take 200 μg / mL of Fe-MoO3-x-PEG-FITC solution and inject it into mice through the tail vein. The distribution of fluorescent targeting peptide in the heart, liver, spleen, lung and kidney is observed according to the experimental time of grouping. The results are shown in Figure 8 ,Depend on Figure 8 It can be seen that over time, the nanozyme is significantly enriched in the lungs, reaching a peak at around 10 minutes, and then gradually decreases. Over time, the nanozyme gradually completes metabolic degradation in the liver and kidneys, with no obvious liver and kidney toxicity.

[0044] In summary, if Figure 2 As shown in the photothermal-chemical synergistic nanocomposite system modified with lung targeting peptide prepared by the present invention, Fe-MoO 3-x -PEG-FITC can generate sufficient hydroxyl radicals in the tumor microenvironment, and the reaction formula is: Fe-MoO 3-x +GSH→Mo 4+ +Mo 5+ +GSSH;H2O2+Mo 4+ / Mo 5+ → OH+Mo 6+ .Fe-MoO 3-x In the redox reaction with glutathione (GSH), GSH (reduced glutathione) is oxidized to GSSH (oxidized glutathione), while Fe-MoO 3-x The Mo in 4+ Or Mo 5+ ; Hydrogen peroxide (H2O2) is reacted with the low-valent state of molybdenum (Mo 4+ / Mo 5+ ) catalytically decomposes to generate highly oxidizing hydroxyl radicals, while the valence of molybdenum increases, eventually forming a stable Mo 6+ After being irradiated with 808-1064nm near-infrared light, a large amount of superoxide anions (·O2 - ), the reaction formula is: O2+e- → O2 - . When Fe-MoO 3-x After the material absorbs laser photons, the electrons in the material jump from a lower energy level to a higher energy level (conduction band), forming electrons in the conduction band (e - ) and holes in the valence band (h + These holes can react with water or other proton donors to generate protons (H + ); Oxygen molecules gain an electron and are converted into superoxide anions (·O2 - ). It can be seen from the Fe-MoO 3-x Nanozymes have a killing effect on tumor cells, and the therapeutic effect of nanozymes will be further enhanced after irradiation with 808-1064nm near-infrared light; therefore, the photothermal-chemodynamic synergistic nanocomposite system modified with lung targeting peptides can be used to prepare targeted drugs for the treatment of lung tumors.

[0045] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for preparing a photothermal-chemical dynamic synergistic nanocomposite system modified with a lung targeting peptide, characterized in that: The following steps are involved: S1. Synthesis of Fe-MoO 3-x Nanozyme: 0.5-0.8 g tannic acid, 0.4-0.5 g Na2MoO4•7H2O and 0.75-0.85 g FeCl3 were dissolved in 35 mL distilled water, stirred for 30 min, transferred into a 50 mL polytetrafluoroethylene autoclave, kept at 160-180 °C for 10 h, and finally the precipitate was collected, washed with distilled water several times, and dried to obtain Fe-MoO 3-x Nanozymes; S2. Construction of a photothermal-chemical synergistic nanocomposite system modified with lung targeting peptides: 25 mg Fe-MoO 3-x Nanozyme was added with 5 mL of deionized water, 50 mg of polyethylene glycol and 100 μL of acrylic acid, stirred overnight at 25 °C and 500 rpm, and the precipitate was obtained by centrifugation and washed several times with deionized water to obtain Fe-MoO 3-x -PEG nanozyme; the obtained Fe-MoO 3-x -PEG nanozyme, 0.2 g of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.05 g of N-hydroxysuccinimide ester were added to 5 mL of deionized water, stirred at room temperature for 120 min, and then centrifuged to obtain the precipitate. 5 mg of the precipitate was added to 100 μL of 5 mg / mL lung targeting peptide solution to obtain a photothermal-chemical dynamic synergistic nanocomposite system modified with lung targeting peptide, which was stored at -20°C.

2. The method for preparing the photothermal-chemical dynamic synergistic nanocomposite system modified with lung targeting peptide according to claim 1, characterized in that: The Fe-MoO 3-x The particle size of nanozymes is 100-200 nm.

3. The method for preparing the photothermal-chemical dynamic synergistic nanocomposite system modified with lung targeting peptide according to claim 1, characterized in that: The nucleotide sequence of the lung targeting peptide is: GACGTCGGT GGCTCTGGTGCGGCTAGTGGCGCGAGCGGTACCGGT.

4. A photothermal-chemical dynamic synergistic nanocomposite system modified with a lung targeting peptide prepared by the method according to any one of claims 1 to 3.

5. Use of the photothermal-chemodynamic synergistic nanocomposite system modified with a lung targeting peptide as claimed in claim 4 in the preparation of drugs for targeted treatment of lung tumors.

Images