A space-borne Pleurotus geesteranus strain Kunzhi No. 6 and its application

Abstract

This application is about a space-borne Pleurotus geesteranus strain Kunzhi No. 6 and its application, belonging to the field of strain selection and breeding technology. The space-borne Pleurotus geesteranus strain Kunzhi No. 6 in this application was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on August 29, 2024, with a deposit number of CGMCC No. 41447, and a classification name of Pleurotus pulmonarius ( Pleurotus pulmonarius ), the preservation address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing. Compared with the strains not carried by spaceflight, the Kunzhi No. 6 strain has the characteristics of fast mycelial germination, fast feed consumption, thick flesh, dark color, high conversion rate and short growth cycle, which is suitable for factory cultivation.

Description

Technical Field

[0001] The present application relates to the technical field of strain selection and breeding, and in particular to a space-borne Pleurotus geesteranus strain Kunzhi No. 6 and its application. Background Art

[0002] Pleurotus geesteranus is a lung-shaped mushroom ( Pleurotus pulmonarius ) is one of the commercially cultivated strains. It belongs to the order Agaricales, family Pleurotaceae, genus Pleurotus Pleurotus Pleurotus geesteranus is one of the main cultivated varieties of oyster mushrooms in my country. Pleurotus geesteranus not only has the characteristics of fast growth, high yield, delicious taste and rich nutrition.

[0003] The technical personnel in this field have always been pursuing to cultivate spore-free or oligospore-free Pleurotus geesteranus, improve the taste of Pleurotus geesteranus, shorten the cultivation cycle and increase the yield, which has great application value. Summary of the invention

[0004] The present application provides a strain of Pleurotus geesteranus, Kunzhi No. 6, which has the characteristics of rapid mycelium germination, rapid feed consumption, thick mushroom flesh, dark color, high conversion rate and short growth cycle.

[0005] The Pleurotus geesteranus strain Kunzhi No. 6 in this application was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on August 29, 2024, with the deposit number CGMCC No.41447, and the classification name is Pleurotus pulmonarius ( Pleurotus pulmonarius ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Specifically, the new strain of Pleurotus geesteranus, Kunzhi No. 6, in the present application was obtained by the following breeding method:

[0007] First, a series of strains were obtained by tissue separation and purification from wild Pleurotus eryngii fruiting bodies collected in Lulang Town, Nyingchi City, Tibet Autonomous Region in August 2019. Then, the strain to be carried in space (No. S12-1) was selected through primary screening, re-screening, regional trials and production trials.

[0008] On June 17, 2021, the Pleurotus geesteranus strain numbered S12-1 was carried into space by the Shenzhou XII manned spacecraft, and returned to the ground on September 17, 2021 with the Shenzhou XII manned spacecraft; the S12-1 strain was activated, the activated mycelium was ground, the single root fragments were separated and cultured to obtain S12-1~200; further screening was carried out according to conventional breeding methods for edible fungi, and a strain with the characteristics of fast mycelium germination, fast feed consumption, thick flesh, dark color, high conversion rate and short growth cycle was obtained, and it was numbered Kunzhi No. 6.

[0009] The present application also provides an application of the above-mentioned Pleurotus geesteranus strain Kunzhi No. 6 in the cultivation and production of Pleurotus geesteranus. Applying the strain Kunzhi No. 6 provided in the present application to the factory production of Pleurotus geesteranus can reduce the impact of spores on the environment and workers, improve the conversion rate of Pleurotus geesteranus, and has broad application prospects.

[0010] The beneficial effects of this application are:

[0011] Compared with the strain S12-1 that was not cultivated by space travel, the Kunzhi No. 6 strain has the characteristics of fast mycelium germination, fast feed consumption, thick flesh, dark color, high conversion rate and short growth cycle. It is suitable for factory cultivation and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0013] Figure 1 It is a schematic diagram of the morphology of the strain Kunzhi No. 6 obtained in Example 1 of the present invention. DETAILED DESCRIPTION

[0014] The embodiments of the present application will be described in more detail below with reference to examples. Although the embodiments of the present application are shown in the examples, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and the scope of the present application can be fully communicated to those skilled in the art.

[0015] Example 1

[0016] This example illustrates the breeding process of Pleurotus geesteranus strain Kunzhi No. 6, and the specific steps are as follows:

[0017] (1) A series of strains were obtained by tissue separation and purification from wild Pleurotus eryngii fruiting bodies collected in Lulang Town, Nyingchi City, Tibet Autonomous Region in August 2019. Then, a strain (numbered S12-1) for space travel was selected through primary screening, secondary screening, regional trials and production trials. The strain was amplified and identified using universal fungal ITS primers (ITS4 / ITS5), and the identification result was Pleurotus eryngii.

[0018] (3) On June 17, 2021, the Pleurotus geesteranus strain numbered S12-1 was carried into space by the Shenzhou XII manned spacecraft. On September 17, 2021, it returned to the ground in the Shenzhou XII manned spacecraft. After fair treatment, it was brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for relevant research.

[0019] (4) The space-borne strain S12-1 was activated, the activated mycelium was ground, and the single root fragments were separated and cultured to obtain S12.1~200.

[0020] (5) With reference to GB / T 21125-2007 Technical Specifications for Breeding of Edible Fungi, further screening was carried out according to conventional breeding methods for edible fungi, and an excellent strain with the characteristics of rapid mycelium germination, rapid feeding, thick flesh, dark color, high conversion rate and short growth cycle was obtained, which was numbered Kunzhi No. 6. The strain was preserved in the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using the 10% glycerol + distilled water preservation method.

[0021] (6) Pleurotus geesteranus strain Kunzhi 6 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on August 29, 2024, with the deposit number: CGMCC No.41447, and the classification name is Pleurotus pulmonarius ( Pleurotus pulmonarius ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0022] The characteristics of the Pleurotus geesteranus strain Kunzhi No. 6 in this embodiment are as follows:

[0023] 1. Morphological characteristics

[0024] The fruiting body is medium-sized. The cap is 4 to 8 cm in diameter, up to 10 cm, oblate to flat, obovate to reniform or nearly fan-shaped, with a smooth surface, white, grayish white to grayish yellow, with smooth or slightly wavy edges. The flesh is white, 0.3 to 0.8 cm thick. The gills are white, slightly dense, extended, and unequal in length. The stipe is very short or almost absent, white with fluff, nearly smooth in the later stage, and solid to soft inside. Figure 1 shown.

[0025] 2. Biological characteristics

[0026] 1) Mycelium culture: PDA medium is used to activate the mother culture, wheat grain medium is used to make the original culture, and finally 80-90% rice straw, 9-18% bran and 1-2% calcium carbonate are used to make the cultivation seeds, which are put into cultivation bags; after conventional inoculation, they are cultured at 23° C. in the dark for 12-15 days until the mycelium completely grows the cultivation bag.

[0027] 2) Management of mushroom production: After 7-10 days of mycelium post-ripening culture, maintain the temperature of the mushroom house at 16-23 ℃, relative humidity of 90-92%, carbon dioxide concentration at 450-550 ppm, light intensity at 500 lx, light at 20 min / h, and harvest in time when the fruiting body diameter reaches 5-15 cm to prepare for mushroom production.

[0028] 3. Genetic characteristics

[0029] The genomic DNA of Pleurotus geesteranus strain Kunzhi 6 was first amplified and sequenced using fungal universal primers ITS4 / ITS5 for the internal transcribed spacer region (ITS) of the ribosome. The bases obtained by sequencing are shown in SEQ ID NO.1, specifically:

[0030] AGGTCAATTGTCAAATTGTCCTTGCGGACGATTAGAGAGCTGGACTCTATTCATGCGTGCTATTGATGAGTGATAATTATCACATCATGCGCAGAGGCAATGAGAAGTCCTGCTAATGCATTTAAGAGGAGCCGACTTGTTACAGCCAGCAACCCC CAACAATCCAAACATCACAAATAAATGTGAGTTTGAGAATTTAATGACACTCAAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTT CTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTATGGTTTATAGGCACAAGGCCCATTAAATGACATTCGTAGACATACATTTGGGGTGTGTTAAGTAAATAGACTGCGTTGTCACACCGAGACGTTTTAAATCCCAGCAAACC AAGTCTGACGACTTGAAGGACGACTTCACAGATCTATCAAAAGTTCACAGGTGGTTGAAAGACTAGTGAAGCGTGCACATGCCCCTAGAGGCCAGCAACAACTCCATAGTGAATTCATTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTT

[0031] The fragment was sequenced by GenBank, and the result showed 100% homology with Pleurotus geesteranus in the database, gene accession number (MN244439). The Pleurotus geesteranus strain Kunzhi No. 6 (preservation number CGMCC No. 41447) was identified as Pleurotus geesteranus.

[0032] Subsequently, the genome of the Pleurotus geesteranus strain Kunzhi No. 6 was sequenced using a universal fungal genome sequencing method, and shallow genome sequencing (Shallow Whole Genome Sequencing) and primer design were performed with reference to existing technologies to obtain the following specific primers:

[0033] Primer_KZ6_1L :5'-GAGGAGGATGACATATAGGGTGAA -3'

[0034] Primer_KZ6_1R: 5'-GCAAAGGATGGCAGGATTTCTC-3'

[0035] Primer_KZ6_2L :5'-TCTTCTCATATTCATCAGTTATCACT-3'

[0036] Primer_KZ6_2R: 5'-GAAATGACCCATCGTGTTCCAATC-3'

[0037] Primer_KZ6_3L :5'-TGTTGGAAATCGATAGGTCAG-3'

[0038] Primer_KZ6_3R: 5'-GCAGGGCACGTAATCACTAATACA-3'

[0039] Specific gene detection was performed on the strain Kunzhi 6 bred after the Shenzhou XII-IV manned spacecraft was carried on board, the strain not carried on board, and the common Pleurotus geesteranus in the market. During amplification, Primer_KZ6_1L / Primer_KZ6_1R, Primer_KZ6_2L / Primer_KZ6_2R and Primer_KZ6_3L / Primer_KZ6_3R primer sets were added to the corresponding amplification system at the same time, and the reaction was detected by 2% agarose gel electrophoresis after the reaction was completed.

[0040] The amplification system included: PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, primers 1.00 mM each, rTaq Polymerase 1.5 U, and template DNA 50 ng; the reaction conditions were: pre-denaturation at 95°C for 3 min, followed by 95°C for 60 s, 56°C for 50 s, and 72°C for 30 s, for 35 cycles; and finally extension at 72°C for 10 min.

[0041] The sequencing of the PCR amplification reaction products was sent to Beijing Biotech Biotechnology Co., Ltd., Shanghai Shenggong Bioengineering Technology Service Co., Ltd. and Yingjun Biotechnology Co., Ltd. for sequencing. The sequencer used for sequencing was ABI3730 DNA sequencer, and the sequencing primers were the same as the PCR amplification primers. Only the Kunzhi No. 6 strain can obtain the following DNA sequence bases. The unloaded strains or the common Pleurotus geesteranus in the market cannot amplify the following DNA sequence bases.

[0042] Specifically, during PCR amplification, specific DNA fragments of approximately 313 bp, 325 bp and 306 bp in size were obtained, and their DNA sequence bases were shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0043] Specifically, SEQ ID NO.2 is specifically:

[0044] TGATTGGAAAAAGAAAGGACTCGCAGTAAAGGAGGATGCATCAAGCAGTTGCGGGCACACAGTGGGAAGACAAAGTCGTCTTTCCCTCTGAGGGCGCATCCACGCATTGACTGACTTCAGCGTATCACCGATATATGCGCTTCCCCGCTTCGCTATGGCTAGTGGAGTGGGCGGGTTT TGATCGCCTGTTGTATGAGACGGAGGTGAAGTCCCCTGAGGAGTCAACAACAGTAGACACCAACCAGATTTATCGACGGGAAACGCCTTGAGAAATCCTGCCATCCTTTGCGCGTATACGGTTTCCTTGAAAAATTGACGGCCTAGCGTCTGCAGTGAGAACGATATGACCGTTTCTTG

[0045] Specifically, SEQ ID NO.3 is specifically:

[0046] CTCTTCTCATATTCATCAGTTATCACTGGCACAGATCTGTAAAACATTTTCGCGGACCGGCTGCATAACACTAAACAGAAACGCGTGCGATTGACAACGTCTTTGACTCAAGTAATGGAGGACACCTACCGCACCGACGATGGTATTGGACTCTGGACAATGGGCGTACTAGATGATCTCATGTA AGATGAAGGCGACATGTTATTACGCCAAATCAGTCATCAAGAGGATCCACGCAATAAGACAACATCTGCTCAAGCAAAGCCTAAAGCAGGCCACGGATGGTACCTTGACGGCGAATCGATTGGAACACGATGGGTCATTTCCTCACCTGAAAATATCTGTAACAGTAAGGCATCCACAGTCTCTGT

[0047] Specifically, SEQ ID NO.4 is specifically:

[0048] TCCGCCAACTGCAGCACACGGAAACGCGACTTGCCGCAAATTCGGGCACTGCAAACATGAGTGAGACCGTGGATTTCAGAAATCAAAATTCCATTCCTGATTGCGAGATTTATTCACTGACTGGCCTGCATGCAGCCCCTTTAACTCGTACGAAAAAGG CCAACACGGCGGCGGTAGAAGGTGAACTGGTACGCCTTGCTGATAAATCAGTCCTGTTGAGCAAAGTATGTGTGAGCTATGTGCATACCGTTATACGGGGGTTGTATTAGTGATTACGTGCCCTGCATTGATGCTTTCGAACTCCAAGTCCTCCGATACG

[0049] Only the Kunzhi No. 6 strain can amplify the unique DNA fragment using the specific primers.

[0050] Example 2 Cultivation Comparative Test

[0051] In this example, the Pleurotus geesteranus strain Kunzhi No. 6 was cultivated and compared with the strain S12-1 that was not carried on space flight, and the mycelial growth rate, growth cycle and yield per unit area of ​​the original strain and the cultivated strain of the test strain were examined.

[0052] The mother culture formula used in this embodiment is PDA culture medium commonly used for edible fungi.

[0053] The stock formula used in this embodiment is a common stock culture medium for wood-decaying fungi: 68% wheat grains, 20% sawdust, 10% wheat bran, 1% light calcium carbonate, 1% gypsum, 58% water content, pH 7 after sterilization;

[0054] The cultivation formula used in this embodiment is a common culture medium for wood-decaying fungi: 60% sawdust, 20% wheat bran, 10% cottonseed hulls, 5% corn flour, 1% light calcium carbonate, 1% gypsum, with a water content of 60-63% and a pH of 7 after sterilization.

[0055] Furthermore, the cultivation method of Kunzhi No. 6 strain in this embodiment comprises the following steps:

[0056] 1) Preparation of mother seeds, original seeds and cultivated seeds: According to the invention patent (CN 105027984 B) obtained by the applicant in the early stage, the above formula is made into corresponding mother seeds, original seeds and cultivated seeds for standby use.

[0057] 2) Mycelium culture: After inoculation of the mother culture, original culture and cultivated culture, culture them in a dark place at an air temperature of 25°C and an air humidity of 65% for 15 to 18 days.

[0058] 3) Mushroom management: After 15-20 days of mycelium cultivation, maintain the temperature of the mushroom house at 18-23°C, the relative humidity of the air at 85-90%, the carbon dioxide concentration at 450-550ppm, the light intensity at 550lx, and the fruiting body diameter at 5-15cm, and harvest in time.

[0059] It should be noted that in Example 2, when comparing the cultivation of Kunzhi No. 6 and S12-1, the only difference was the strain itself, and the other cultivation conditions were the same.

[0060] The cultivation results are shown in the following table:

[0061]

[0062] It can be seen from the above table that compared with the cultivation of strain S12-1 that was not carried by space, the mycelium growth rate of the original strain and the cultivated strain of Kunzhi No. 6 strain was faster, and the conversion rate and yield were significantly improved.

[0063] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A space-borne Pleurotus geesteranus strain Kunzhi No. 6, characterized in that: It was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 29, 2024, with the deposit number CGMCC No.41447, and the classification name was Pleurotus pulmonarius ( Pleurotus pulmonarius ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. An application of the strain Kunzhi No. 6 described in claim 1 in the production of Pleurotus geesteranus.

Images