Enzyme mutant with improved utilization efficiency of substrate and cosubstrate based on deep learning modification

Abstract

The invention relates to the technical field of gene engineering, and discloses an enzyme mutant with improved utilization efficiency of a substrate and a cosubstrate based on deep learning modification. The enzyme modification method based on deep learning can improve the utilization efficiency of a substrate and an auxiliary substrate, and can be widely applied to enzyme molecular modification. The enzyme activity of the enzyme mutant obtained based on deep learning modification is remarkably improved, so that the deep learning enzyme modification method can greatly improve the molecular modification efficiency of the produced enzyme.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and relates to an enzyme mutant with improved substrate and co-substrate utilization efficiency based on deep learning transformation. Background Art

[0002] As a core component of the life system, accurate understanding of the structure and function of proteins is crucial. At present, protein engineering is widely used in enzyme molecular improvement, that is, by modifying or modifying genes or proteins themselves to change protein structure to achieve enzyme function modification. Protein engineering is mainly used for the design and modification of enzyme properties such as thermal stability, catalytic efficiency, substrate specificity and extreme environmental tolerance. Due to the rapid development of artificial intelligence technology and the continuous emergence of advanced algorithms, computer-aided protein design and modification has received great attention and development, becoming an important new direction for protein engineering. Thanks to the improvement of computer computing power and the availability of large-scale data sets, deep learning is currently developing rapidly, showing unique advantages in the prediction of complex enzyme structure and stability, selectivity, catalytic activity-guided enzyme design, etc., providing new possibilities for enzyme molecular design.

[0003] The enzyme modification strategy based on deep learning combined with pocket shaping can be used to modify a variety of enzymes, improve their enzyme activity, and improve the corresponding substrate conversion efficiency. D-amino acid oxidase (DAAO) can be used to prepare glufosinate ammonium. Glufosinate ammonium (glufosinate ammonium phosphinothricin, referred to as PPT), chemical name (D, L)-2-amino-4-[hydroxy (methyl) phosphinothricin] butyric acid, is one of the world's three major herbicides (paraquat, glyphosate, glufosinate ammonium). Because glufosinate ammonium has the advantages of low toxicity, broad weed control spectrum, long lasting effect, high activity and good environmental compatibility, it is widely used in weed control in farmland crops, non-arable land, no-till land, etc., and has great market development potential and broad application prospects. Glufosinate ammonium is a racemic mixture with two enantiomers, L-type and D-type, but only L-type glufosinate ammonium works in weed control, while D-type enantiomer has no herbicidal activity. Therefore, the conversion of D-type glufosinate into L-type glufosinate will greatly reduce the amount of original drug used, which plays a very important role in improving product economy, reducing pesticide use, and alleviating environmental pressure.

[0004] At present, the most widely used method for removing D-phosphinothricin is to use D,L-phosphinothricin as raw material, catalyze D-phosphinothricin to obtain L-phosphinothricin precursor 2-carbonyl-4-[hydroxy(methyl)phosphinothricin]butyric acid through D-amino acid oxidase, and then catalyze L-phosphinothricin through amino acid dehydrogenase or transaminase. Because of the high selectivity and specificity of D-amino acid oxidase, this method can not only effectively remove D-phosphinothricin, but its key intermediate 2-carbonyl-4-[hydroxy(methyl)phosphinothricin]butyric acid can also be further converted into L-phosphinothricin, effectively improving the atomic utilization rate. Therefore, it is particularly important to screen for high-yield 2-carbonyl-4-[hydroxy(methyl)phosphinothricin]butyric acid mutants.

[0005] Nitrilase (EC 3.5.5.1) is a class of enzymes that can directly hydrolyze nitriles (containing -CN) into corresponding carboxylic acids. The catalytic reaction of nitrilase has the characteristics of high selectivity, high catalytic rate, mild reaction conditions and low environmental pollution. It is an environmentally friendly green synthesis method with important practical significance for energy conservation and emission reduction. Nitrilase (EC 3.5.5) is an enzyme in the nitrilase superfamily. It can catalyze a series of nitriles into corresponding carboxylic acids and release ammonia in a one-step reaction. The biocatalytic reaction mediated by nitrilase has the advantages of mild environment, environmental friendliness, no by-products, and excellent regioselectivity, chemical selectivity and stereoselectivity of the products. Compared with the harsh acid-base reaction conditions and the generation of undesirable by-products required by traditional chemical pathways, nitrilase is expected to become a substitute for traditional chemical pathways in fine chemical production. Nitrilases have been used to catalyze the production of valuable fine chemicals such as nicotinic acid, (R)-mandelic acid, acrylic acid, glycolic acid, 1,5-dimethyl-2-piperidone, atorvastatin, gabapentin, (R)-baclofen, and (S)-pregabalin.

[0006] Pranlukast is an oral bronchial asthma treatment drug. It is a leukotriene (CysLTs) receptor antagonist that can effectively inhibit LTD4 receptors to treat asthma. 3-Amino-2-hydroxyacetophenone, also known as 1-(3-Amino-2-hydroxyphenyl)ethanone (3AHAP for short), is a key intermediate in the synthesis of Pranlukast. The biosynthesis of 3-amino-2-hydroxyacetophenone relies on multi-enzyme catalysis and is suitable for in vitro multi-enzyme catalysis. Nitroreductase (nbzA) is a widely distributed flavin protease that binds to the cofactor FMN or FAD molecule and uses the coenzyme NAD(P)H as an electron donor to catalyze the nitro group to generate the corresponding hydroxylamine or amino group. The biosynthesis of 3-amino-2-hydroxyacetophenone uses the coenzyme cycle NADPH-GDH as a hydrogen donor. The nitro group of the substrate m-nitroacetophenone is first reduced to a hydroxylamine group by catalyzed by nitroreductase (nbzA), and then the hydroxylamine group is rearranged to form 3AHAP by catalyzed by hydroxylamine benzylmutase (habA). Summary of the invention

[0007] In order to improve the efficiency of preparing L-phosphinothricin ammonium, the present invention provides an enzyme mutant with improved substrate and co-substrate utilization efficiency based on deep learning transformation. The present invention is based on deep learning transformation, and the D-amino acid oxidase A0A499UB99 mutant obtained by mutating L55K, V94R, and S233R can efficiently utilize oxygen, improve the utilization efficiency of substrates and co-substrates, and at the same time, the enzyme activity is significantly improved. It is applied to the biocatalytic racemic PPT to prepare L-phosphinothricin ammonium precursor 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid (PPO), with high production efficiency.

[0008] The technical solution adopted by the present invention is: In a first aspect, the present invention provides a D-type amino acid oxidase mutant with high oxygen utilization efficiency, characterized in that: the amino acid sequence is shown in SEQ ID NO.1.

[0009] The present invention is based on deep learning transformation, takes D-type amino acid oxidase A0A499UB99 as the parent, and obtains D-type amino acid oxidase mutant A0A499UB99-M3 through MutProp design. The D-type amino acid oxidase mutant A0A499UB99-M3 is obtained by simultaneously mutating Leu55, Val94, and Ser233 of D-type amino acid oxidase A0A499UB99, and the mutations are: L55K, V94R, and S233R. The D-type amino acid oxidase A0A499UB99 mutant obtained by simultaneously mutating L55K, V94R, and S233R can efficiently utilize oxygen, greatly improving the efficiency of producing and preparing L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphono]butyric acid.

[0010] In a second aspect, the present invention provides a gene encoding a D-type amino acid oxidase mutant with high oxygen utilization efficiency.

[0011] Specifically, the present invention provides a nucleotide sequence of a gene encoding a D-type amino acid oxidase mutant with high oxygen utilization rate, as shown in SEQ ID NO.2.

[0012] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.

[0013] In a fourth aspect, the present invention provides a genetically engineered bacterium, wherein the engineered bacterium comprises the above-mentioned encoding gene or the above-mentioned recombinant vector.

[0014] Preferably, the host bacteria of the genetically engineered bacteria is Escherichia coli.

[0015] More preferably, the recombinant vector is PCDF-Duet, and the Escherichia coli is Escherichia coli BL21 (DE3).

[0016] In a fifth aspect, the present invention provides the use of a D-amino acid oxidase mutant or the above-mentioned genetically engineered bacteria in the preparation of L-phosphinothricin ammonium.

[0017] Specifically, it is applied to the biocatalytic racemic PPT preparation of L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid (PPO).

[0018] The D-type amino acid oxidase A0A499UB99 mutant obtained by simultaneous mutation of L55K, V94R, and S233R can efficiently utilize oxygen. At the same time, the enzyme activity is significantly improved, which enhances the potential of the mutant to biocatalyze the racemic PPT to prepare L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid.

[0019] In a sixth aspect, the present invention provides a nitrilase mutant, the amino acid sequence of the nitrilase mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.

[0020] In a seventh aspect, the present invention provides a nitroreductase mutant, the amino acid sequence of the nitroreductase mutant is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6.

[0021] Based on the deep learning transformation method, the transformation and mutation of nitrilase and nitroreductase can also improve the utilization efficiency of substrates and co-substrates, which is beneficial to their application in the synthesis of 1-cyanocyclohexylacetic acid and 3-amino-2-hydroxyacetophenone.

[0022] Compared with the prior art, the present invention has the following technical effects: (1) The present invention is based on deep learning transformation, taking D-amino acid oxidase A0A499UB99 as the parent, and obtaining D-amino acid oxidase mutant A0A499UB99-M3 through MutProp design. D-amino acid oxidase mutant A0A499UB99-M3 is obtained by simultaneously mutating Leu55, Val94, and Ser233 of D-amino acid oxidase A0A499UB99, and the mutations are: L55K, V94R, and S233R. The D-amino acid oxidase A0A499UB99 mutant obtained by simultaneously mutating L55K, V94R, and S233R can efficiently utilize oxygen, and at the same time, the enzyme activity is significantly improved, so the efficiency of producing L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphono]butyric acid can be greatly improved.

[0023] (2) The D-amino acid oxidase A0A499UB99 mutant provided by the present invention can be used for microbial catalysis to prepare L-PPT, which is conducive to industrial production and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the SDS-PAGE electrophoresis diagram of the cell disruption supernatant of the recombinant strains A0A499UB99 and A0A499UB99-M3; wherein M is the molecular weight of the standard protein, 1 is the cell disruption supernatant of A0A499UB99, and 2 is the cell disruption supernatant of A0A499UB99-M3.

[0025] Figure 2 Comparison of relative enzyme activities between D-amino acid oxidase mutant and wild type.

[0026] Figure 3 This is the optimal pH for the D-amino acid oxidase mutant and wild type.

[0027] Figure 4 It is the optimum temperature of D-amino acid oxidase mutant and wild type.

[0028] Figure 5 Comparison of the concentration of PPO generated by the D-amino acid oxidase mutant and wild type during the reaction under aeration conditions and non-aeration conditions.

[0029] Figure 6 Comparison results of relative enzyme activities between nitrilase mutants and wild type.

[0030] Figure 7 Comparison results of relative enzyme activities between nitroreductase mutants and wild type. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with specific examples, but the present invention is not limited to the following implementations: the plasmid extraction kit and DNA purification recovery kit used in the examples were purchased from Hangzhou Qingke Zixi Biotechnology Co., Ltd.; the one-step cloning kit was purchased from Novozyme Co., Ltd.; E. coli BL21 (DE3), plasmid PCDF-Duet and whole gene synthesis were completed by Sangon Biotechnology (Shanghai) Co., Ltd.; DNA markers, low molecular weight standard proteins, and protein precast gels were purchased from Beijing GenStar Co., Ltd.; ClonExpress II OneStep Cloning Kit seamless cloning kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; pfu DNA polymerase and DpnI endonuclease were purchased from Thermo Fisher Scientific (China) Co., Ltd.; primer synthesis and sequence sequencing were completed by Hangzhou Qingke Zixi Biotechnology Co., Ltd. The above reagent usage methods refer to the product instructions.

[0032] The reagents used in the downstream catalytic process in the embodiment, D, L-phosphinothricin ammonium, were purchased from Sigma-Aldrich; 2,4-dinitrophenylhydrazine (DNPH) was purchased from Aladdin Reagents (Shanghai, China), and commercial micrococcal catalase was purchased from Sigma-Aldrich (Shanghai, China). m-Nitroacetophenone and 3-amino-2-hydroxyacetophenone were purchased from Aladdin Reagents (Shanghai, China). 1-Cyanocyclohexylacetonitrile was purchased from Carbosynth China Ltd, and 1-Cyanocyclohexylacetic acid was provided by Zhejiang Yongtai Chemical Co., Ltd. Other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0033] The present invention uses high performance liquid chromatography (HPLC) to detect the product of the reaction and analyze the product. The specific HPLC analysis method is as follows: The HPLC analysis method of the product 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid (PPO) is as follows: chromatographic column temperature / C18; column temperature / 30℃; flow rate / 1mL / min; detection wavelength / 232nm; mobile phase A is pure acetonitrile, mobile phase B is 1‰ tetrabutylammonium bromide (NH2)HPO4 (50mM pH 3.8). A and B are mixed in a ratio of 12:88 (V / V).

[0034] The product 1-cyanocyclohexylacetic acid HPLC analysis method is as follows: the chromatographic column is J&K Scientific C18-H column (4.6×250mm, 5μm, ), the mobile phase was buffer (0.58 g / L ammonium dihydrogen phosphate, 1.8375 g / L sodium perchlorate, pH adjusted to 1.8 with perchloric acid, and the solvent was deionized water): acetonitrile = 76:24 (v:v), the flow rate was 1 mL / min, the injection volume was 10 μL, the UV detection wavelength was 215 nm, and the column temperature was 40 °C.

[0035] The HPLC analysis method of the product 3-amino-2-hydroxyacetophenone is: chromatographic column / phenyl; column temperature / 40℃; flow rate / 1mL / min; detection wavelength / 235nm; mobile phase: 13.5mM trifluoroacetic acid: pure acetonitrile (V / V) = 75:25.

[0036] Example 1 Obtaining a gene encoding a mutant of D-type amino acid oxidase that utilizes high oxygen In this example, a gene encoding a mutant of D-type amino acid oxidase that utilizes high oxygen is designed based on a deep learning method.

[0037] Specifically, it is designed through the RNN neural network model, which consists of six layers of switches and overall linear modules. The first layer mainly uses a matrix algorithm to import the protein sequence into the computer, the second layer is a dimensionality reduction layer, which mainly vectorizes the protein matrix dimension, the third and fourth layers are long-term and short-term memory cell layers, which are used to learn the characteristics and structure of the sequence and memorize and circulate, and the fifth and sixth layers are mainly dense layers, which output the learning results to the characteristic analysis of the output protein. According to some suitable mutation sites and their related property changes, the top 10 mutant sequences with property changes are selected and introduced into the engineering strain for experimental mutagenesis, and the enzyme with the highest mutation activity is screened through 96-well plates, and the nucleic acid sequence encoding the mutant enzyme is obtained through DNA sequencing.

[0038] In this example, the D-amino acid oxidase A0A499UB99 derived from the fungus Rasamsonia emersonii is used as the parent, and the D-amino acid oxidase mutant A0A499UB99-M3 is obtained by designing. The D-amino acid oxidase mutant A0A499UB99-M3 is obtained by simultaneously mutating the three sites of Leu55, Val94, and Ser233 of the D-amino acid oxidase A0A499UB99, and the mutations are: L55K, V94R, and S233R. The amino acid sequence of the D-amino acid oxidase mutant A0A499UB99-M3 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2.

[0039] Example 2 Preparation of genetically engineered bacteria In this example, the wild-type engineered bacteria BL21 / A0A499UB99 were prepared to express wild-type DAAO by fermentation, and the D-amino acid oxidase mutant was obtained by mutation. The details are as follows: The wild-type DAAO from Rasamsonia emersonii was fully synthesized and then inserted into the expression plasmid PCDF-Duet to obtain PCDF-Duet-DAAO. After sequencing verification, PCDF-Duet-DAAO was transferred into the expression host E. coli BL21 (DE3) to obtain an engineered bacterium for subsequent recombinase expression.

[0040] The LB liquid culture medium was composed of 10 g / L peptone, 5 g / L yeast powder, and 10 g / L NaCl. The mixture was dissolved in water and fixed to volume. The mixture was sterilized at 121°C for 20 min and set aside.

[0041] After the sequencing-corrected engineering bacteria were activated by streaking on a plate, a single colony was picked and inoculated into 10 ml LB liquid culture medium containing 50 μg / ml streptomycin sulfate, and cultured at 37°C for 10 to 12 hours. The inoculation amount was transferred to 100 ml of fresh LB liquid culture medium containing 50 μg / ml kanamycin at a 2% inoculum, and shaken at 37°C until OD600 reached about 0.8, then cooled to 28°C, IPTG was added to a final concentration of 0.5 mM, and induced culture was carried out for 16 hours. After the culture was completed, the culture solution was centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, the bacteria were collected, and stored in a -20°C refrigerator for standby use. The bacteria collected after the culture was washed twice with 50 mM pH 8.0 phosphate buffer, then resuspended in 50 mL pH 8.0 phosphate buffer, homogenized and broken, and the broken solution was centrifuged to remove the precipitate to obtain a crude enzyme solution containing recombinant wild-type DAAO enzyme A0A499UB99.

[0042] Example 3 Obtaining Type D Amino Acid Oxidase Mutants Based on the wild-type DAAO sequence in Example 2, positions 55, 94, and 233 were mutated simultaneously to obtain a D mutant nucleotide sequence as shown in SEQ ID NO. 2. The PCR primer sequences were designed for the mutants with mutations at positions 55, 94, and 233 of the mutated DAAO sequence, and the design was shown in Table 1 according to the mutation order of the mutation sites.

[0043] Table 1 Primer sequences Serial number Primer name sequence 1 F-L55K GCAAATTATAAACCGGTTGGTGGCGGAAAAT 2 R-L55K ACCAACCGGTTTATAATTTGCACCTGCCCA 3 F-V94R GATACCGTTCGTTATAATCGTACCAAAGAT 4 R-V94R ACGATTATAACGAACGGTATCCTGAAAATG 5 F-S233R TGTAGTATTCGTGGTACCGATGATGGTGAT 6 R-S233R ATCGGTACCACGAATACTACACATCAGACC The PCR (25 μL) amplification system was: 12.5 μL of 2×PCR buffer, 0.5 μL of upstream and downstream primers, 0.5 μL of template plasmid, 0.5 μL of dNTP, 0.5 μL of high-fidelity enzyme, and ddH2O was added to make up to 25 μL.

[0044] The PCR amplification program was as follows: (1) pre-denaturation at 95°C for 5 min, (2) denaturation at 95°C for 30 s, (3) annealing at 60°C for 30 s, (4) extension at 72°C for 5 min, 30 cycles, (5) extension at 72°C for 10 min, and (6) storage at 4°C.

[0045] After the PCR was completed, 5 μL of the amplified product was analyzed by nucleic acid gel electrophoresis, and 0.5 μL of Dpn I endonuclease was added to the PCR product with a clear target band, and the template was digested at 37°C for 1 hour. After the reaction was completed, it was transformed into BL21 competent cells, spread on LB medium containing 50 μg / mL kanamycin, cultured at 37°C overnight, and the bacteria were harvested to obtain transformants containing the mutant A0A499UB99-M3.

[0046] According to the method of obtaining wild-type BL21 / A0A499UB99 engineered bacteria in Example 2, the mutant-expressing recombinant bacteria BL21 / A0A499UB99-M3 engineered bacteria and their broken liquid were prepared. The crude enzyme liquids of the two recombinant enzymes A0A499UB99 wild-type enzyme and A0A499UB99-M3 mutant enzyme were subjected to SDS-PAGE analysis. The results are as follows: Figure 1 shown.

[0047] Depend on Figure 1 It can be seen that compared with the wild type, the soluble expression of mutant A0A499UB99-M3 was significantly enhanced.

[0048] Example 4 Comparison of Enzyme Activities of Type D Amino Acid Oxidase Mutants The enzyme activity of the recombinant enzyme A0A499UB99 obtained in Example 2 and the mutant enzyme A0A499UB99-M3 obtained in Example 3 was measured. The 1.4 mL reaction system includes: 100 mM racemic glufosinate ammonium salt, 50 mM pH 8.0 phosphate buffer, 30 g / L D-amino acid oxidase or its mutant frozen stem cells. After 2 hours of reaction, the reaction solution sample was taken for treatment, and the concentration of PPO was determined by HPLC. The relative enzyme activity between A0A499UB99 and A0A499UB99-M3 was calculated based on the concentration of PPO in the sample. The results are shown in Figure 2 .

[0049] like Figure 2 As shown, the relative enzyme activity of mutant A0A499UB99-M3 was increased 26-fold compared with the wild-type A0A499UB99.

[0050] Example 5 Determination of properties of type D amino acid oxidase mutants and wild type In this example, the enzymatic properties of the recombinant enzyme A0A499UB99 obtained in Example 2 and the mutant enzyme A0A499UB99-M3 obtained in Example 3 were measured and analyzed according to the following steps: 1. Determination of the optimal pH of D-amino acid oxidase mutants and wild type The pH was adjusted to 4.0 to 9.0 by K2HPO4-KH2PO4 buffer. The crude enzyme solution of the D-amino acid oxidase mutant and the wild type was reacted in the above buffer solutions with different pH values. The other reaction conditions were the same as those of the reaction system in Example 4. After the reaction was carried out for 10 min, 6M HCl was added to terminate the reaction. The amount of PPO generated was then determined by HPLC to evaluate the relative activity of the enzyme under various pH conditions. The results are shown in FIG. Figure 3 shown.

[0051] like Figure 3 As shown, the optimal reaction pH of the wild-type D-amino acid oxidase and the mutant D-amino acid oxidase are 7.5 and 8.0, respectively.

[0052] 2. Determination of the optimal temperature of D-amino acid oxidase mutants and wild type The optimum temperature of the D-amino acid oxidase mutant and the wild-type D-amino acid oxidase was determined as follows: the enzymatic reaction was carried out at different temperatures of 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, and 60°C in a Na2HPO4-NaH2PO4 buffer system at pH 8.0. The other reaction conditions were the same as those in the reaction system of Example 4. The results are shown in FIG. Figure 4 shown.

[0053] like Figure 4 As shown, the optimum temperature of the D-amino acid oxidase mutant is 45°C, and the optimum temperature of the wild-type D-amino acid oxidase mutant is 40°C.

[0054] Example 6 Catalytic efficiency of D-amino acid oxidase mutants under ventilation and non-ventilation conditions The wild-type A0A499UB99 and mutant A0A499UB99-M3 of D-amino acid oxidase were cultured according to the culture scheme in Example 2, and a 40 mL reaction system was reacted in a magnetic stirring water bath, the reaction temperature was set to 35°C, the reaction speed was set to 600 rpm, and the variable conditions in the reaction process were set to ventilation and non-ventilation conditions. The 40 mL reaction system included: 100 mM racemic glufosinate ammonium salt, 50 mM pH 8.0 phosphate buffer, and 30 g / L crude enzyme solution of wild-type A0A499UB99 and mutant A0A499UB99-M3 of D-amino acid oxidase. After four hours of reaction, samples of the reaction solution were taken for treatment. The PPO concentration was determined by HPLC. The product concentrations of the wild-type A0A499UB99 and mutant A0A499UB99-M3 in the reaction system under aeration and non-aeration conditions were calculated based on the PPO concentration in the samples. The results are as follows: Figure 5 shown.

[0055] like Figure 5 As shown, the concentration of PPO generated by the D-amino acid oxidase mutant A0A499UB99-M3 under aeration and non-aeration conditions was higher than that of the wild-type A0A499UB99. Among them, the concentration of PPO generated by the wild-type A0A499UB99 reaction system under aeration and non-aeration conditions was 0.61 g / L and 0.42 g / L, respectively; The concentrations of PPO generated by the mutant A0A499UB99-M3 reaction system under aeration and non-aeration conditions were 8.24 g / L and 2.93 g / L, respectively. It can be seen that the conversion rate of PPO of the mutant A0A499UB99-M3 under aeration conditions increased by 2.37 times.

[0056] Example 7 Obtaining nitrilase mutants The same transformation design method as in Example 1 was used. In this example, the wild-type nitrilase ZJB09122 from Acidovorax facilis was used as the parent to design and obtain the nitrilase mutant ZJB09122-M3. The nitrilase mutant ZJB09122-M3 was obtained by simultaneously mutating the 192nd, 194th, and 201st positions of the nitrilase ZJB09122. The amino acid sequence of the nitrilase mutant ZJB09122-M3 is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.

[0057] After the wild-type nitrilase from Acidovorax facilis was fully synthesized, it was inserted into the expression plasmid pET-28b(+) to obtain pET-28b(+)-ZJB09122. After sequencing verification, pET-28b(+)-ZJB09122 was transferred into the expression host Escherichia coli BL21(DE3) for subsequent expression of the recombinant enzyme. The LB liquid culture medium preparation and engineering bacteria culture steps were in accordance with Example 2. The 192nd, 194th, and 201st positions were mutated on the basis of the wild-type nitrilase sequence by MutProp design. The PCR primer sequences were designed for the mutants with mutations at the 192nd, 194th, and 201st positions of the mutated nitrilase sequence, and the design was shown in Table 2 according to the mutation order of the mutation site.

[0058] Table 2 Primer sequences of nitrilase mutants Serial number Primer name sequence 1 F-S192G CCGGCTATGGGTCCGCTGCAACCGGACGTG 2 R-S192G TTGCAGCGGACCCATAGCCGGCCAAGAAGC 3 F-T201R GTGTTTCAACGTTCCATCGAGGCTAATGCG 4 R-T201R CTCGATGGAACGTTGAAACACGTCCGGTTG 5 F-L194A ATGTCCCCGGCACAACCGGACGTGTTTCAA 6 R-L194A GTCCGGTTGTGCCGGGGACATAGCCGGCCA The PCR (25 μL) amplification system was: 12.5 μL of 2×PCR buffer, 0.5 μL of upstream and downstream primers, 0.5 μL of template plasmid, 0.5 μL of dNTP, 0.5 μL of high-fidelity enzyme, and ddH2O was added to make up to 25 μL.

[0059] The PCR amplification program was as follows: (1) pre-denaturation at 95°C for 5 min, (2) denaturation at 95°C for 30 s, (3) annealing at 60°C for 30 s, (4) extension at 72°C for 5 min, 30 cycles, (5) extension at 72°C for 10 min, and (6) storage at 4°C.

[0060] After the PCR was completed, 5 μL of the amplified product was analyzed by nucleic acid gel electrophoresis, and 0.5 μL of Dpn I endonuclease was added to the PCR product with a clear target band, and the template was digested at 37°C for 1 hour. After the reaction was completed, it was transformed into BL21 competent cells, coated on LB medium containing 50 μg / mL kanamycin, cultured at 37°C overnight, and the bacteria were harvested to obtain transformants containing mutant ZJB09122_M3. The engineered bacteria and their broken liquid were obtained according to the method in Example 2.

[0061] Example 8 Comparison of Enzyme Activities of Nitrilase Mutants The enzyme activities of the wild-type nitrilase ZJB09122 and the mutant enzyme ZJB09122-M3 obtained in Example 7 were measured.

[0062] 1mL reaction system includes: 200mM 1-cyanocyclohexylacetonitrile, 200mM pH7.0 phosphate buffer, 10g / L nitrilase or its mutant freeze-dried cells. After 10min of reaction, the reaction solution sample was taken for treatment, and the concentration of 1-cyanocyclohexylacetic acid was determined by HPLC. The relative enzyme activity between ZJB09122 and ZJB09122_M3 was calculated based on the concentration of 1-cyanocyclohexylacetic acid in the sample. The results are shown in Figure 6 .

[0063] like Figure 6 As shown, the relative enzyme activity of mutant ZJB09122_M3 was 160% of that of wild-type ZJB09122.

[0064] Example 9 Obtaining nitroreductase mutants This example adopts the same modification design method as Example 1, and uses the wild-type nitroreductase K8099RS04 from Bartonella henselae as the parent to design and obtain the nitroreductase mutant K8099RS04-M3. The nitroreductase mutant K8099RS04-M3 is obtained by simultaneously mutating the 100th, 120th, and 228th positions of the nitroreductase K8099RS04. The amino acid sequence of the nitroreductase mutant K8099RS04-M3 is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6.

[0065] After the wild-type nitroreductase K8099RS04 was fully synthesized, it was inserted into the expression plasmid pET-28b(+) to obtain pET-28b(+)-K8099RS04. After sequencing verification, pET-28b(+)-K8099RS04 was transferred into the expression host Escherichia coli E.coli BL21(DE3) for subsequent expression of the recombinase. The LB liquid culture medium preparation and engineering bacteria culture steps were in accordance with Example 2. The 100th, 120th, and 228th positions were mutated on the basis of the wild-type nitroreductase sequence by MutProp design. The 100th, 120th, and 228th positions of the mutated nitroreductase sequence were targeted. The primer sequences for PCR were designed for the mutants subjected to mutation, and the design was shown in Table 3 according to the mutation order of the mutation sites.

[0066] Table 3 Primer sequences of nitroreductase mutants Serial number Primer name sequence 1 F-G100A GTCGTCGTAAAGTTGCGCTGGATCTGTACAAATCTC 2 R-G100A AACTTTACGACGACGAGACAGGTAC 3 F-Q120G AGAAGATGCTGCACGGTAAAGCGAAGAACTTCTT 4 R-Q120G GTGCAGCATCTTCTCTTGGTCACCTTT 5 F-Y228W CACTTCATCAAGTCTTGGCCGTAAATGGTATCTT 6 R-Y228W AGACTTGATGAAGTGAACGAAGTTGTCG The PCR (25 μL) amplification system was: 12.5 μL of 2×PCR buffer, 0.5 μL of upstream and downstream primers, 0.5 μL of template plasmid, 0.5 μL of dNTP, 0.5 μL of high-fidelity enzyme, and ddH2O was added to make up to 25 μL.

[0067] The PCR amplification program was as follows: (1) pre-denaturation at 95°C for 5 min, (2) denaturation at 95°C for 30 s, (3) annealing at 60°C for 30 s, (4) extension at 72°C for 3 min, 30 cycles, (5) extension at 72°C for 10 min, and (6) storage at 4°C.

[0068] After the PCR was completed, 5 μL of the amplified product was analyzed by nucleic acid gel electrophoresis, and 0.5 μL of Dpn I endonuclease was added to the PCR product with a clear target band, and the template was digested at 37°C for 1 hour. After the reaction was completed, it was transformed into BL21 competent cells, coated on LB medium containing 50 μg / mL kanamycin, cultured at 37°C overnight, and the bacteria were harvested to obtain transformants containing mutant K8099RS04_M3. The bacterial cells and their broken liquid were obtained as described in Example 2.

[0069] Example 10 Comparison of Enzyme Activities of Nitroreductase Mutants The enzyme activities of the wild-type enzyme K8099RS04 and the mutant enzyme K8099RS04-M3 obtained in Example 9 were measured.

[0070] 1mL reaction system includes: 10g / L m-nitroacetophenone, 100mM pH8.0 phosphate buffer, 10g / L nitroreductase or its mutant frozen cells. After 12h of reaction, the reaction solution sample was taken for processing, and the concentration of 3-amino-2-hydroxyacetophenone was determined by HPLC. The relative enzyme activity between K8099RS04 and mutant enzyme K8099RS04_M3 was calculated based on the concentration of 3-amino-2-hydroxyacetophenone in the sample. The results are shown in Figure 7 .

[0071] like Figure 7 As shown, the relative enzyme activity of mutant K8099RS04_M3 was 120% of that of wild-type K8099RS04.

[0072] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0073] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An enzyme mutant with improved substrate and co-substrate utilization efficiency based on deep learning, characterized in that: The amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding an enzyme mutant with improved substrate and cosubstrate utilization efficiency based on deep learning transformation as described in claim 1.

3. The coding gene according to claim 2, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that: The recombinant vector comprises the coding gene according to claim 2.

5. A genetically engineered bacterium, characterized in that: The engineered bacteria comprises the coding gene according to claim 2 or the recombinant vector according to claim 4.

6. The genetically engineered bacterium according to claim 5, characterized in that: The host bacteria of the genetically engineered bacteria is Escherichia coli.

7. Use of the D-amino acid oxidase mutant according to claim 1 in the preparation of L-phosphinothricin ammonium.

8. The use according to claim 7, characterized in that: The preparation method comprises the following steps: biocatalyzing racemic PPT to prepare L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid.

9. Use of the genetically engineered bacteria as claimed in claim 5 in the preparation of L-phosphinothricin ammonium.

10. The use according to claim 9, characterized in that: The preparation method comprises the following steps: biocatalyzing racemic PPT to prepare L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid.

Images