Rice nitrogen efficient utilization gene OsNAC15, protein coded by gene OsNAC15 and application of gene OsNAC15

Abstract

The invention discloses a rice nitrogen efficient utilization gene OsNAC15, a protein coded by the gene OsNAC15 and application of the gene OsNAC15, and belongs to the technical field of molecular breeding. The invention discloses the effect of the OsNAC15 gene in efficient utilization of rice nitrogen for the first time, the overexpression of the rice OsNAC15 gene significantly improves the nitrogen utilization rate and yield of a plant, and the mutation of the OsNAC15 gene significantly reduces the nitrogen utilization rate and yield of the plant; the mutant and / or overexpressed OsNAC15 gene has the advantages that the plant development is normal, the regulation and control of the nitrogen nutrition utilization rate of the rice can be realized by precisely regulating and controlling the expression level of the gene, the biomass and yield of crops are further improved, the environmental pollution is reduced, and the application prospect in the agricultural field is wide. Especially in the aspect of cultivating crop varieties capable of efficiently absorbing and utilizing nitrogen fertilizer, such as rice, corn, wheat, soybean, cotton, rape and other key crops, the wide application of the strain is expected to lead the agricultural production to be more environment-friendly and efficient, and a powerful scientific and technological support is provided for solving global grain safety problems and environmental protection challenges.

Description

Technical Field

[0001] The invention relates to the technical field of molecular breeding, and in particular to a rice nitrogen efficient utilization gene OsNAC15, a protein encoded by the gene, and applications thereof. Background Art

[0002] Rice (Oryza sativa) is one of the most important food crops for human beings. It is rich in nutritional value and is the staple food of more than half of the world's population. Nitrogen fertilizer is the main limiting factor for increasing crop yields. At present, there is a widespread phenomenon of high nitrogen application and low utilization rate in agricultural production in my country. If the amount of nitrogen fertilizer applied is too large, it will not only cause a reduction in grain production, but also cause a series of serious environmental problems such as eutrophication of water bodies. Improving the nitrogen use efficiency (NUE) of rice has become one of the important ways to achieve sustainable agricultural development. Therefore, cultivating new varieties of nitrogen efficient utilization in rice cultivation can not only achieve the rational use of rice nitrogen fertilizer, but also reduce the environmental problems caused by excessive nitrogen application, which has potential important agricultural production value.

[0003] Nitrogen is a macronutrient and one of the essential nutrients for rice growth. Appropriate application of nitrogen fertilizer can not only increase rice yield, but also improve rice quality. The process of rice using nitrogen includes nitrogen absorption, transport, assimilation and reuse, involving the participation and regulation of multiple genes and multiple pathways. Nitrogen fertilizer exists in the soil in the form of nitrate nitrogen and ammonium nitrogen. The rice root system can regulate the absorption and transport of nitrate nitrogen and ammonium nitrogen, and realize nitrogen assimilation through nitrate reductase, nitrite reductase, glutamine synthetase and glutamate synthetase. In the aboveground part of the plant, the transport and distribution of nitrogen are regulated by nitrogen transport proteins, amino acid transport proteins, etc.

[0004] Transcription factors play a key role in the efficient nitrogen use of rice. Transcription factors regulate gene expression. They activate or inhibit gene transcription by binding to specific sequences on DNA, thereby affecting the absorption, transport, assimilation and reuse of nitrogen by plants. Increasing the expression level of specific transcription factors can significantly improve the nitrogen use efficiency of rice. For example, SNAC1 may affect the nitrogen fertilizer use efficiency of rice by regulating the expression of genes related to nitrogen metabolism; transgenic rice overexpressing the OsENOD93-1 gene showed higher yield and biomass, indicating that this gene may play an important role in improving the nitrogen use efficiency of rice. Transcription factors directly affect the nitrogen use efficiency of rice by regulating the expression of genes related to nitrogen metabolism. It can be seen that by studying and utilizing these transcription factors and the genes they regulate, it can provide an important theoretical basis and technical support for the breeding of new nitrogen-efficient rice varieties. Summary of the invention

[0005] The purpose of the present invention is to provide a rice nitrogen efficient utilization gene OsNAC15, the protein encoded by it and its application, so as to solve the global food security problem and environmental protection challenge and provide a candidate gene highly linked to nitrogen efficient utilization.

[0006] To achieve the above objectives, the present invention provides the effect of overexpressing the OsNAC15 gene in efficient nitrogen utilization, and the nucleotide sequence of the OsNAC15 gene can be selected from 1) a CDS sequence as shown in SEQ ID NO.3; 2) a nucleotide sequence that can hybridize with the DNA sequence shown in SEQ ID NO.3 under highly stringent conditions.

[0007] The amino acid sequence encoded by the OsNAC15 gene is as follows: (A) 301 amino acid residues as shown in SEQ ID NO.4; (B) a protein derived from (A) in which one or more amino acid residues are substituted, deleted and / or added to the amino acid sequence as shown in SEQ ID NO.4 and which has the same activity as (A); (C) a protein encoded by other genes which has an amino acid identity of more than 50% similarity with the protein composed of the amino acid sequence as shown in SEQ ID NO.4 and has the same activity as (A).

[0008] Preferably, overexpression of the OsNAC15 gene increases the nitrogen absorption rate of roots and shoots of plants at the seedling stage.

[0009] The use of the overexpressed OsNAC15 gene as described above in improving crop yield.

[0010] The application of a recombinant vector comprising the above OsNAC15 gene in improving the nitrogen utilization rate and yield of crops, wherein the recombinant vector is an overexpression vector.

[0011] The use of a host cell containing the above-mentioned recombinant vector overexpressing the OsNAC15 gene in improving the nitrogen utilization rate and yield of crops, wherein the host cell is a microbial cell, preferably an Escherichia coli cell or an Agrobacterium cell.

[0012] Plants overexpressing the OsNAC15 gene as described above are obtained by genetic engineering means, including Agrobacterium-mediated transfection, plasmid transformation, direct DNA transformation, microinjection technology; or hybridization methods are used to obtain offspring plants overexpressing the nitrogen efficient utilization gene OsNAC15 or its active fragments. The plants include, but are not limited to, rice, Arabidopsis, wheat, corn, cotton, rapeseed or soybean, preferably rice.

[0013] The application of the overexpressed OsNAC15 gene as described above in the breeding of crop varieties with high nitrogen utilization efficiency.

[0014] A method for cultivating plants with high nitrogen utilization efficiency, the method comprising: introducing the above gene or its active fragment or recombinant expression vector into plant cells to obtain transgenic plants, or hybridizing a plant containing the above gene or its active fragment with another plant.

[0015] In another embodiment, the nitrogen efficient utilization gene OsNAC15 is introduced into the offspring plants by hybridization. For example, a plant containing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or an active fragment thereof is hybridized with another plant to obtain offspring plants, and stably homozygous hybrid plants containing the nucleotide sequence or an active fragment thereof are screened out, and the obtained hybrid offspring plants have improved nitrogen utilization efficiency compared with the unhybridized plants.

[0016] Preferably, the method further comprises the step of codon-optimizing the gene of claim 1 according to the codon usage of the plant before introduction into the plant cell.

[0017] Those skilled in the art will appreciate that the above method further comprises the step of codon-optimizing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 according to the codon usage of the plant before introduction into the plant cell.

[0018] The breeding method of the present invention can be used for the breeding of rice, corn, wheat, cotton, rape, soybean, forage or Arabidopsis, preferably for rice breeding. Using this method, plant varieties with improved nitrogen utilization efficiency can be obtained. The principle of breeding is to overexpress the OsNAC15 gene in the plant, specifically, it can be achieved by overexpressing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or its active fragment in the plant. The transgenic plant or hybrid offspring plant obtained by the breeding method has a growth advantage under low nitrogen and / or high nitrogen growth conditions. In the present invention, the normal nitrogen application amount is generally 150KG nitrogen / hectare, "low nitrogen growth conditions" generally refers to the application of nitrogen fertilizer amount 0.1-0.5 times the normal nitrogen application amount, and "high nitrogen growth conditions" generally refers to the application of nitrogen fertilizer amount 1.5-2 times the normal nitrogen application amount.

[0019] When used to cultivate rice with improved nitrogen utilization efficiency, the cultivation method comprises: introducing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or an active fragment thereof into rice cells to obtain transgenic rice cells, producing transgenic rice plants expressing the isolated nucleotide sequence or the active fragment thereof from the transgenic rice cells, and the transgenic rice has improved nitrogen utilization efficiency compared with control rice without the isolated nucleotide sequence or the active fragment thereof introduced; or the method comprises: hybridizing a rice plant containing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.4 or the active fragment thereof with another rice plant to obtain offspring rice plants, screening out stably homozygous hybrid plants containing the nucleotide sequence or the active fragment thereof, and the obtained hybrid offspring plants have improved nitrogen utilization efficiency compared with unhybridized rice plants.

[0020] In general, the nitrogen efficient utilization gene provided by the present invention is derived from rice, named OsNAC 15, and is one of the following nucleotide sequences:

[0021] 1) a nucleotide sequence encoding the polypeptide shown in SEQ ID NO.4;

[0022] 2) DNA sequence of SEQ ID NO.3;

[0023] 3) A nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID NO. 3 under highly stringent conditions.

[0024] SEQ ID NO.3 consists of 906 bases, and its coding sequence starts from the first base at the 5′ end and encodes the amino acid sequence shown in SEQ ID NO.4.

[0025] The expression vector, transgenic cell line and host bacteria containing the nitrogen efficient utilization gene of the present invention are also within the protection scope of the present invention.

[0026] Primer pairs for amplifying any fragment of OsNAC15 are also within the scope of protection of the present invention.

[0027] By using a plant expression vector, the nitrogen efficient utilization gene of the present invention is introduced into plant cells to obtain transgenic cell lines and transgenic plants with enhanced nitrogen utilization efficiency.

[0028] The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment. The plant expression vector may also include the 3′ non-translated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragment that can participate in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3′ end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the rouge synthase NOS gene) and the 3′ non-translated region of the plant gene (such as the soybean storage protein gene) have similar functions.

[0029] When OsNAC15 is used to construct a plant expression vector, any enhanced promoter or inducible promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter, the root-specific expression promoter, etc., can be added before the transcription start nucleotide. They can be used alone or in combination with other plant promoters. In addition, when the gene of the present invention is used to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene.

[0030] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide Bar gene), etc. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0031] The plant expression vector carrying OsNAC15 of the present invention can be used to transform plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant cells or tissues can be cultivated into plants. The transformed plant host can be either monocotyledonous plants such as rice, corn, wheat, etc., or dicotyledonous plants such as Arabidopsis, soybean, rapeseed, cotton, etc.

[0032] Through the growth experiment of the transgenic rice obtained after the transformation of OsNAC15 gene in nutrient solution with different nitrogen levels and field experiment, it is proved that the gene can significantly improve the nitrogen utilization efficiency of the plant and increase the biomass of the plant after being transformed into the plant; through the growth experiment of the transgenic Arabidopsis obtained after the transformation of OsNAC15 gene in culture medium with different nitrogen levels, it is proved that the function of the gene in the model plant is conservative. The present invention provides a basis for artificially enhancing the nitrogen utilization efficiency of plants, and will play an important role in cultivating plants (especially crops such as rice, corn, wheat, rapeseed, soybean, cotton, etc.) that efficiently utilize nitrogen nutrition.

[0033] Therefore, the rice nitrogen efficient utilization gene OsNAC15, the protein encoded by it and the application thereof provided by the present invention have the following specific technical effects:

[0034] (1) The present invention discloses for the first time the role of the OsNAC15 gene in efficient nitrogen utilization in rice. Overexpression of the rice OsNAC15 gene significantly improves the nitrogen utilization rate of the plant, while mutation of the OsNAC15 gene significantly reduces the nitrogen utilization rate of the plant.

[0035] (2) Overexpression of the rice OsNAC15 gene significantly increased the rice seed setting rate, number of effective panicles, yield per plant, and dry weight; mutation of the OsNAC15 gene significantly reduced the rice seed setting rate, number of effective panicles, yield per plant, and dry weight;

[0036] (3) The mutation and / or overexpression of the OsNAC15 gene resulted in normal plant development. The expression level of this gene can be precisely regulated to achieve regulation of the nitrogen utilization rate of rice, which can not only increase rice yield but also effectively alleviate environmental problems caused by excessive nitrogen fertilizer application. It has great application potential in the agricultural field, especially in the breeding of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as rice, corn, wheat, soybean, cotton, rapeseed and other key crops. Its widespread application is expected to lead to more environmentally friendly and efficient agricultural production, and provide strong scientific and technological support for solving global food security issues and environmental protection challenges.

[0037] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0039] Figure 1It is the subcellular localization result of the OsNAC15 gene in Example 1 of the present invention; wherein A is the GFP green fluorescent protein of the control group, B is the red fluorescence observation result of the control group, C is the protoplast state of the control group under bright field, D is the cell state of the control group under bright field, E is the GFP green fluorescent protein of OsNAC15, F is the red fluorescence observation result of OsNAC15, G is the protoplast state of OsNAC15 under bright field, and H is the cell state of OsNAC15 under bright field;

[0040] Figure 2 The physical map of the recombinant expression vector PBWA(V)HS-NAC15-OE-GL osgfp10500 obtained in Example 2 of the present invention;

[0041] Figure 3 The results of RT-PCR detection of the transgenic positive homozygous plants OE-1 and OE-2 and the wild-type plant (WT) overexpressing the OsNAC15 gene in Example 3 of the present invention;

[0042] Figure 4 It is a physical map and target location information map of the recombinant CRISPR-cas9 expression vector obtained in Example 4 of the present invention;

[0043] Figure 5 is the mutation site information of the OsNAC15 gene mutant strains KO-1, KO-2 and KO-3 relative to WT in Example 5 of the present invention;

[0044] Figure 6 The statistical results of nitrogen absorption rates of shoots and roots of WT, transgenic positive homozygous plants OE-1 and OE-2 overexpressing the OsNAC15 gene, and OsNAC15 gene mutant lines KO-1, KO-2 and KO-3 at the seedling stage in Example 6 of the present invention;

[0045] Figure 7 Plant photos A, effective panicle number B, yield C, fruit setting rate D and dry weight E statistical results of WT, transgenic positive homozygous plants OE-1 and OE-2 overexpressing the OsNAC15 gene and OsNAC15 gene mutant lines KO-1, KO-2 and KO-3 under high nitrogen (HN) and low nitrogen (LN) conditions, respectively, where * indicates a significant difference between the two groups, *: P < 0.05, **: P < 0.01, ***: P < 0.001, ****: P < 0.0001. DETAILED DESCRIPTION

[0046] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0047] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0048] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels, and all methods unless otherwise specified are conventional techniques in the art.

[0049] Embodiment 1

[0050] Obtaining the cDNA sequence of OsNAC15 gene and conducting subcellular localization analysis

[0051] The total RNA of 7-day-old Dongnong 427 seedlings was extracted by TRIzol method (TRIzol reagent was purchased from Invitrogen, Carlsbad, CA). 1 μg of total RNA was used for reverse transcription using a reverse transcription kit produced by Hangzhou Xinjing Biological Reagent Development Co., Ltd. and followed the steps described in the product guide to obtain cDNA.

[0052] The obtained cDNA was used as a template, and the primers shown in SEQ ID NO.1 and SEQ ID NO.2 were used for RT-PCR amplification to obtain the cDNA sequence of the OsNAC15 gene. The amplification system was: 0.8 μL FastPfu polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), 0.5 μL cDNA, 10 μL 5×PCR buffer, 100 μM dNTPs, 25 μM each of upstream and downstream primers, and then the reaction system was supplemented to 50 μL with double distilled water. The PCR program was: first 95°C, 1 min, then 58°C, 30 s, and finally 72°C, 1 min, for a total of 40 cycles.

[0053] SEQ ID NO.1:TTCTCCTGCGTCGTCATCG

[0054] SEQ ID NO.2:ACTTGCGGTCCTTGTGGC

[0055] After the PCR reaction was completed, the PCR product was recovered using a gel recovery kit and sent to the company for sequencing. The sequencing results showed that the cDNA sequence of the OsNAC15 gene was shown in SEQ ID NO.3, and the encoded amino acid sequence was shown in SEQ ID NO.4.

[0056] SEQ ID NO.3:

[0057]

[0058] SEQ ID NO.4:

[0059] Met SerGlu SerGluVal SerVal Ile AsnGln Leu GluGlu GluGlu ThrArg LeuGlu

[0060] LeuProPro GlyPheArgPheHis Pro ThrAsp GluGluValVal ThrHis TyrLeu Thr

[0061] ArgLys AlaGlnAsp Arg SerPhe SerCys ValVal Ile AlaAsp ValAsn LeuAsnAsn

[0062] Cys GluPro Trp Asp LeuPro SerLys AlaLys Met GlyGlu Lys Glu TrpPhePhePhe

[0063] Cys His Lys Asp Arg Lys TyrPro ThrGlyMetArg ThrAsnArgAlaThrAla SerGly

[0064] Tyr Trp Lys AlaThrGly Lys Asp Lys GluIle PheArgGlyArg Gly Leu LeuValGly

[0065] MetLys Lys ThrLeuVal Phe TyrMet GlyArgAlaProArg GlyGlu Lys ThrPro Trp

[0066] Val MetHis GluTyrArgLeuAsp GlyLys LeuPro Pro Asn LeuPro Arg SerAlaLys

[0067] Glu GluTrp AlaVal Cys ArgValPhe Asn Lys Asp LeuAlaAlaLys IleAlaGlnMet

[0068] ProProPro Pro PheProArgAsnAsp SerPheAsp LeuAsp LeuAspAspPhe LeuHis

[0069] LeuAspAlaAsp LeuProPro Leu Ile Asp Asp Pro PheAla SerThr SerThr LeuLys

[0070] ThrGluProProProProAlaAsn LeuMetHis AsnHis Tyr GlyTyrPhe Ser LeuPro

[0071] Ala SerAlaThrAsnTyrAsnHis Ser SerGlyAlaMetAlaAsp GlnAlaIle ArgArg

[0072] Phe Cys Lys AlaGluAla SerThrAlaCys Phe Ser GlyAlaAsp AlaAsp ValAspPro

[0073] Val Val Asp Glu Leu Leu SerPheProAsp SerIle ThrAsp Tyr SerTyr Ile TrpLys Ala

[0074] The PBWA(V)HS empty vector was double-digested with EcoRI and BamHI, and the PBWA(V)HS vector fragment was recovered by gel. Then, the target fragment was connected to the vector by homologous recombination for transformation. 10 μL of the ligation product was transformed into competent E. coli (see the standard method for competent E. coli transformation) and transformed into a (kanamycin) resistant plate. The plate was cultured at 37°C for 12 hours, and plaque PCR was performed for identification. After that, a single plaque was selected for sequencing. The subcellular localization of the plaque was determined by transfecting rice protoplasts, and the fluorescence signal was observed by laser confocal microscopy. The results are shown in the figure. Figure 1 As shown, the green fluorescence signal of the control group sample transformed with the empty vector exists in the rice protoplasts, while the green fluorescence signal of the sample transfected with the OsNAC15 fusion protein appears in the nuclear region of the protoplasts, indicating that the protein encoded by the OsNAC15 gene is localized in the nucleus.

[0075] Embodiment 2

[0076] Construction of OsNAC15 gene overexpression vector

[0077] The purified CDS fragment of the OsNAC15 gene obtained in Example 1 was connected to the PBWA(V)HS vector by homologous recombination and golden gate seamless cloning method. The specific steps are as follows:

[0078] Using the CDS sequence of the OsNAC15 gene as a template, PCR was performed with the primers shown in SEQ ID NO.5 and SEQ ID NO.6. The amplification system was 20 μL Nuclease-free Water, 25 μL Biorun Pfu PCR Mix, 2 μL each of upstream and downstream primers, and 1 μL Template. The amplification program was 1 cycle of 94°C 5 min, 30 cycles of 94°C 30 sec, 30 cycles of 50°C 45 sec, 30 cycles of 72°C 54 sec, 1 cycle each of 72°C 10 min and 16°C 30 min, for a total of 93 cycles. In addition to sequencing, the recombinant plasmid was digested with EcoRV endonuclease, and it was verified that the actual fragment size of the recombinant plasmid was consistent with the theoretical value. The physical map of the recombinant expression vector PBWA(V)HS-NAC15-OE-GLosgfp10500 is shown in Figure 2 shown.

[0079] SEQ ID NO.5:AACACGGGGGACTTTGCAACATGTCGGAGTCGGAGGTGTCG

[0080] SEQ ID NO.6:CCTGAAGCGGCCGCTGTACAGGCCTTCCATATGTAGGAGTAGTCC Example 3

[0081] Obtaining and identifying transgenic plants overexpressing OsNAC15 gene

[0082] The recombinant expression vector PBWA(V)HS-NAC15-OE-GLosgfp10500 obtained in Example 2 was genetically transformed using the genetic transformation method mediated by Agrobacterium EHA105, and the rice variety Dongnong 422 was used as the experimental material. For details, see Efficient transformation of rice (Oryza sativa

[0083] L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journa 16: 271-282.

[0084] After the transgenic plants have taken root, they are transferred to culture soil for growth, young leaves are cut, and the whole genome DNA of each transgenic plant is extracted by the CTAB method. The obtained DNA is used as a template, and PCR is performed with the primers shown in SEQ ID NO.7 and SEQ ID NO.8 to obtain transgenic positive plants of the OsNAC15 gene, which are the T0 generation. Single plants are harvested, and then conventional sowing and self-pollination are performed and single plants are harvested until the T2 generation is detected to obtain transgenic positive homozygous plants of the OsNAC15 gene.

[0085] SEQ ID NO.7:TCCGCAAAGGAGGAATGG

[0086] SEQ ID NO.8:GGGAGAAGTAGCCGTAGTGGT

[0087] The seeds of the transgenic positive homozygous plants of the OsNAC15 gene were sown on MS medium (formula shown in Table 1), and the germinated homozygous lines were conventionally cultured until the 7th day, and young leaves were cut to extract RNA using the method in Example 1, and then reverse transcribed. The cDNA obtained by reverse transcription was used as a template, the ACTIN1 gene was used as an internal reference, and the primers shown in SEQ ID NO.9 and SEQ ID NO.10 were used. The Q-PCR kit (Takara Premix Ex Taq TM II) produced by Dalian Bao Bioengineering Co., Ltd. was used to perform qRT-PCR to identify the expression level of the OsNAC15 gene in each line. The qRT-PCR system was: 0.25 μL of 10 μM upstream and downstream primers, 0.3 μL of cDNA, 4.2 μL of double distilled water, and 5 μL of SYBR Green reagent. The qRT-PCR program was: 95°C, 1 min; 95°C, 5 s; 60°C, 30 s, 40 cycles. The primer sequences used to amplify the ACTIN1 gene are shown in SEQ ID NO. 11 and SEQ ID NO. 12. The same method was used to detect the expression level of the OsNAC15 gene in 7-day-old wild-type (Dongnong 427) seedlings as a control.

[0088] The two strains with the largest difference in expression from the wild type were selected and named OE-1 and OE-2 for subsequent experiments. The relative expression results of OE-1, OE-2 and the wild type are shown in Figure 3 shown.

[0089] SEQ ID NO.9:GGAGGAATGGGCGGTTTG

[0090] SEQ ID NO.10:CCGTCTTGAGCGTGGAGGT

[0091] SEQ ID NO.11:TGGTCGTACCACAGGTATTGTGTT

[0092] SEQ ID NO.12:AAGGTCGAGACGAAGGATAGCAT

[0093] Table 1

[0094]

[0095]

[0096] Embodiment 4

[0097] Construction of CRISPR-cas9 expression vector for OsNAC15 gene

[0098] According to the "Golden Gate" cloning method, a target gene (target sequence such as Figure 4 The gRNA expression cassette (as shown) was connected to the pYLCRISPR / Cas9Pubi-H vector backbone, and the constructed vector was the pYLCRI SPROsNAC15-gRNA vector.

[0099] Embodiment 5

[0100] Acquisition and identification of OsNAC15 gene CRISPR-cas9 transgenic positive plants

[0101] The recombinant expression vector pYLCRISPROsNAC15-gRNA obtained in Example 4 was introduced into the normal Dongnong 422 rice variety using the Agrobacterium EHA105-mediated genetic transformation method (for specific steps, see Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 6: 271-282).

[0102] When the transgenic plants grow to have 5-6 true leaves, the leaves are cut and the whole genome DNA of the transgenic plants is extracted by the CTAB method. The target region sequence is amplified using the primers shown in SEQ ID NO.13 and SEQ ID NO.14. The amplified products are sent to the company for sequencing, and the positive plants with effective mutations in the OsNAC15 gene are screened out and recorded as the T0 generation. The individual plants are harvested until homozygous plants are detected in the T2 generation. Three of the multiple OsNAC15 gene mutant strains obtained are selected for subsequent experiments, and the selected three OsNAC15 gene mutant strains are named KO-1, KO-2 and KO-3.

[0103] The OsNAC15 gene mutant strains produced mutations near the target site that hindered the normal function of the gene. The information of the mutation sites of KO-1, KO-2 and KO-3 is as follows: Figure 5 As shown, the OsNAC15 gene of the KO-1 strain had a 1-base deletion at the target site, the OsNAC15 gene of the KO-2 strain had a 2-base deletion at the target site, and the OsNAC15 gene of the KO-3 strain had a 1-base insertion at the target site.

[0104] Embodiment 6

[0105] Evaluation of nitrogen nutrient utilization efficiency of transgenic positive strains obtained in Example 3 and Example 5 (I) Nitrogen absorption rate of each transgenic positive strain at the seedling stage

[0106] Each transgenic positive strain was sown in the field at the same time and managed conventionally until the seedling stage. The nitrogen absorption rate of the shoots and roots of each transgenic positive strain was measured on the same day, with the wild type as the control. The results are as follows: Figure 6 As shown, the nitrogen absorption rate of the shoots and roots of the overexpression lines was significantly higher than that of the wild type, and the nitrogen absorption rate of the shoots and roots of the KO-1, KO-2 and KO-3 mutant lines was significantly lower than that of the wild type.

[0107] (II) Investigating the yield-related parameters of each transgenic positive strain

[0108] After each transgenic positive strain has grown normally in the field for 3 months, the plant photos are as follows Figure 7 As shown in A, the OsNAC15 overexpression line has a significant growth advantage, while the knockout mutant has a weaker growth trend. The effective ear number, yield, fruit setting rate and dry weight of each line were counted, and the results were as follows: Figure 7As shown in B, C, D, and E, the fruit setting rate of the overexpression lines increased compared with the wild type, but not significantly, the number of effective panicles increased significantly, the yield increased significantly, and the dry weight increased; while the fruit setting rate of KO-1, KO-2, and KO-3 lines decreased compared with the wild type, the decrease was not obvious, but the number of effective panicles and yield decreased significantly, and the dry weight decreased. The above data indicate that rice overexpressing OsNAC15 has obvious advantages in field growth.

[0109] Therefore, the present invention discloses for the first time the role of OsNAC15 gene in efficient nitrogen utilization of rice. Overexpression of rice OsNAC15 gene significantly improves nitrogen utilization rate of plants, while mutation of OsNAC15 gene significantly reduces nitrogen utilization rate of plants. Overexpression of rice OsNAC15 gene significantly improves rice fruit setting rate, number of effective panicles, yield per plant, and dry weight. Mutation of OsNAC15 gene significantly reduces rice fruit setting rate, number of effective panicles, yield per plant, and dry weight. By mutation and / or overexpression of OsNAC15 gene, plants develop normally. The expression level of the gene can be precisely regulated to achieve regulation of nitrogen nutrient utilization rate of rice, thereby increasing crop biomass and yield, and reducing environmental pollution. The invention has broad application prospects in the agricultural field, especially in cultivating crop varieties that can efficiently absorb and utilize nitrogen fertilizers, such as key crops such as rice, corn, wheat, soybean, cotton and rapeseed. Its wide application is expected to lead agricultural production to be more environmentally friendly and efficient, and provide strong scientific and technological support for solving global food security issues and environmental protection challenges.

[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. The role of overexpression of the OsNAC15 gene in efficient nitrogen utilization, characterized by: The CDS sequence of the OsNAC15 gene is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.

4.

2. The effect of overexpressing OsNAC15 gene in efficient nitrogen utilization according to claim 1, characterized in that: Overexpression of the OsNAC15 gene increased the nitrogen absorption rate of roots and shoots in the seedling stage.

3. Use of the overexpressed OsNAC15 gene as claimed in claim 1 in increasing crop yield.

4. Use of a recombinant vector comprising the OsNAC15 gene of claim 1 in improving nitrogen utilization efficiency and yield of crops, characterized in that: The recombinant vector is an overexpression vector.

5. Use of a host cell comprising the OsNAC15 gene recombinant vector according to claim 4 in improving nitrogen utilization efficiency and yield of crops, characterized in that: The host cell is an Escherichia coli cell or an Agrobacterium cell.

6. Use of the overexpressed OsNAC15 gene as claimed in claim 1 in the breeding of crop varieties with high nitrogen utilization efficiency.

7. A method for cultivating plants with high nitrogen utilization efficiency, characterized in that: The method comprises: introducing the gene or active fragment thereof according to claim 1 or the recombinant expression vector according to claim 4 into plant cells to obtain transgenic plants, or hybridizing a plant comprising the gene or active fragment thereof according to claim 1 with another plant.

Images