Application of SLC8A3, MGAT3 and METTL24 biomarkers in colorectal cancer diagnosis

Abstract

The invention discloses an application of SLC8A3, MGAT3 and METTL24 biomarkers in colorectal cancer diagnosis, which comprises the following steps: step 1, sample collection: screening three colorectal cancer hypermethylation biomarkers through early-stage hybridization capture sequencing and multiple data filtering analysis, step 2, DNA extraction, step 3, methylation primer probe design, step 4, detection of colorectal cancer hypermethylation biomarkers, step 5, detection of colorectal cancer hypermethylation biomarkers, step 6, detection of colorectal cancer hypermethylation biomarkers, step 7, detection of colorectal cancer hypermethylation biomarkers, and step 8, detection of colorectal cancer hypermethylation biomarkers. 4, establishing a qPCR amplification system: detecting and quantifying a target sequence by utilizing the DNA extracted in the step 2; the application result is interpreted after the reaction in the fourth step. According to the application, the DNA capture probe is contained, the detection sensitivity is improved, multi-methylation target combined detection is achieved, the missed diagnosis rate is reduced, the detection result is convenient to interpret, and non-invasive detection is truly achieved; a specific target combination and a primer probe sequence thereof are screened out, and then methylation detection and qPCR are carried out, so that colorectal cancer methylation detection is more accurate and convenient.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology, and specifically to the application of SLC8A3, MGAT3 and METTL24 biomarkers in the diagnosis of colorectal cancer. Background Art

[0002] Colorectal cancer is a common malignant tumor, and its incidence and mortality are on the rise worldwide. The occurrence of colorectal cancer is related to many factors, including genetics, environment, lifestyle and diet. In the early stage, colorectal cancer usually has no obvious symptoms, but as the disease progresses, symptoms such as abdominal discomfort, changes in bowel habits, and blood in the stool may occur. At present, the detection technologies for colorectal cancer mainly include colonoscopy and fecal occult blood test. Colonoscopy is the "gold standard" for diagnosis, with high accuracy, but it is invasive and traumatic, and requires complex and strict "intestinal cleansing" preparation, and patient compliance is relatively low. Although fecal occult blood test is easy to operate, non-invasive, non-invasive and inexpensive, it has limited sensitivity. Therefore, in addition to colonoscopy and fecal occult blood test, there is an urgent need for a non-invasive and highly sensitive detection method to support and supplement. In recent years, new early screening technologies based on molecular diagnosis, such as blood DNA testing and fecal DNA testing, have developed rapidly, providing new means for early screening of colorectal cancer.

[0003] DNA methylation is a common gene modification that can regulate gene expression by regulating the methyl groups on the DNA sequence. DNA methylation is an epigenetic mechanism used by cells to regulate gene expression. The DNA methylation process is usually carried out by DNA methyltransferase to add a methyl group (CH3) at the C5 position of the cytosine ring to generate 5-methylcytosine. Normal DNA methylation patterns are essential for maintaining genome stability and normal cell development. However, when DNA methylation patterns change, it may cause a variety of diseases, including cancer.

[0004] Studies have found that both DNA hypomethylation (occurring in unmethylated regions of the normal genome) and DNA hypermethylation (occurring in CpG islands of gene promoters) are related to the occurrence and development of cancer. Especially in colorectal cancer, the methylation status of certain genes may become abnormal, leading to abnormal gene expression, which in turn triggers the occurrence of cancer. Therefore, by detecting the methylation status of related genes in colorectal tissue or feces, colorectal cancer can be detected early and targeted treatment can be carried out.

[0005] However, traditional colorectal cancer diagnosis has the following disadvantages:

[0006] (1) Traditional colorectal cancer diagnosis using only one methylation gene to detect colorectal cancer in stool has low sensitivity, low sensitivity for detecting high-risk adenomas, and low specificity, which cannot meet people's needs;

[0007] (2) At present, the main detection technologies for colorectal cancer include colonoscopy and fecal occult blood test. Colonoscopy is the "gold standard" for diagnosis with high accuracy, but it is invasive and traumatic, and requires complex and strict "bowel cleansing" preparation. Patient compliance is relatively low. Although fecal occult blood test is easy to operate, non-invasive, non-intrusive and inexpensive, its sensitivity is limited. Therefore, in addition to colonoscopy and fecal occult blood test, there is an urgent need for a non-invasive and highly sensitive detection method to support and supplement. Summary of the invention

[0008] The purpose of the present invention is to provide the application of SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer, so as to solve the problem proposed in the above background technology that the traditional diagnosis of colorectal cancer uses only one methylation gene to detect colorectal cancer in stool, has low sensitivity, low sensitivity for detecting high-risk adenomas, and low specificity, which cannot meet people's use needs; at present, the detection technologies of colorectal cancer mainly include colonoscopy and fecal occult blood test, etc., colorectal endoscopy is the "gold standard" for diagnosis, with high accuracy, but it is invasive and traumatic, and requires complex and strict "intestinal cleansing" preparation, and patient compliance is relatively low. Although fecal occult blood test is easy to operate, non-invasive, non-invasive and inexpensive, it has limited sensitivity. Therefore, in addition to colorectal endoscopy and fecal occult blood test, there is an urgent need for a non-invasive and highly sensitive detection method to support and supplement it.

[0009] To achieve the above object, the present invention provides the following technical solution: Application of SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer, comprising the following steps:

[0010] Step 1: Sample collection: Through preliminary hybridization capture sequencing and multiple data filtering and analysis, three colorectal cancer hypermethylation biomarkers were screened out;

[0011] Step 2: DNA extraction: DNA extraction is performed on the collected samples, specifically including capture agent preparation, capture extraction and bisulfite conversion;

[0012] Step 3, design methylation primer probes: design specific methylation detection primer probes for multiple methylation sites on the three screened high methylation targets, and design detection primer probes and capture probes for each target for the internal reference gene ACTB. All primer probes are biosynthesized, and all detection probes have corresponding fluorescent labeling groups at their 5' ends and corresponding fluorescent quenching groups at their 3' ends. Capture probes are all labeled with biotin;

[0013] Step 4: Establishment of qPCR amplification system: Detect and quantify the target sequence using the DNA extracted in step 2;

[0014] Step 5: Interpretation of test results: Interpret the application results after the reaction in step 4.

[0015] As a preferred technical solution of the present invention, the sample collection in step 1 specifically includes a positive quality control product being human methylated standard DNA, a negative quality control product being human unmethylated standard DNA, and the sample to be tested being a human stool sample.

[0016] As a preferred technical solution of the present invention, the specific process of preparing the capture agent in step 2 is as follows: S1, liquid injection: take an appropriate volume (50 μL) of streptavidin-coupled magnetic beads (10 mg / ml) and place them in a new centrifuge tube; S2, reagent addition: add an equal volume of 1X B&W Buffer1 (2mol / L NaCl: 0.01mol / L Tris HCl: 0.001mol / L EDTA) buffer to resuspend the magnetic beads; S3, first reagent mixing: place on a magnetic stand for 1 minute, and discard the supernatant; S4, second reagent mixing: add an equal volume of 1X B&W Buffer1 buffer to the initial volume, wash the magnetic beads 3 times in total, and discard the supernatant; S5, third reagent mixing: add 50 μL probe (10uM), 200ul 1X B&W Buffer1 buffer, which must be prepared in advance (so that the final concentration of the magnetic beads is 2 mg / ml), fully shake and mix the magnetic beads, place on a mixer, and mix at room temperature for 30 minutes; S6, fourth reagent mixing: add 1ml Wash the magnetic beads with 1X B&W Buffer 1 buffer twice and discard the supernatant; S7, complete the capture: add 50 μL 1X B&W Buffer 1 buffer, the added volume is the same as the initial magnetic bead volume, resuspend the magnetic beads, and complete the capture agent preparation.

[0017] As a preferred technical solution of the present invention, the capture and extraction in step 2 is specifically as follows: S1, dilution of the sample: collect stool samples, add stool preservation solution (0.3mol / L EDTA, 0.05mol / LTris·HCl, 0.1mol / L mannitol and 0.15mol / L NaCl) in proportion (feces: stool preservation solution = 1:3), fully oscillate and mix (mix for 2-4h) to obtain a stool dilution sample; S2, first sample centrifugation: take 40mL of stool dilution sample into a clean 50mL centrifuge tube, centrifuge at 3500g for 10min, gently remove the centrifuge tube from the centrifuge, and carefully pipette 30mL of supernatant into a clean 50mL centrifuge tube; S3, second sample centrifugation: add PVP (polyvinyl pyrrolidone, final concentration of 50mg / mL) for treatment, vortex Oscillate to mix thoroughly, centrifuge at 3500g for 10min; S4, mixing reagent: transfer the supernatant to a clean 50mL centrifuge tube, add an equal volume of 5mol / L guanidine isothiocyanate, and gently invert to mix (vertical mixer for 5min); S5, heat denaturation: heat denaturation at 90℃ for 10min; S6, magnetic separation: add appropriate amount of capture agent, mix at room temperature for 40min, magnetically absorb for 10min, and discard the supernatant; S7, reagent washing: wash 3 times with 600ul streptavidin magnetic beads combined with washing buffer (1X B&W Buffer1 buffer); S8, capture DNA: 50ul TE 80℃, 10min oscillation mixing + magnetic stand adsorption, collect the supernatant to obtain the captured DNA.

[0018] As a preferred technical solution of the present invention, the bisulfite conversion in the step 2 is specifically as follows: S1, preparation before the experiment: prepare the magnetic beads used for desulfurization purification according to the volume ratio of M-Binding Buffer: MagBinding Beads = 60:1, MagBingding is easy to precipitate, and it must be fully mixed, 80% ethanol and M-Elution Buffer (TE); S2, experimental reaction: add 104ul Lightining Conversion Reagent to 16ul DNA sample to be treated with BS (keep away from light, record the opening date), after fully mixing, react on a PCR instrument, the reaction volume is 120ul, the reaction conditions are hot cover 105℃, 98℃, 8min; 54℃, 60min; 4℃, keep (no more than 20h); S3, combination: add 488ul (M-BindingBuffer+MagBinding Beads) gently pipette to mix, let stand for 5 minutes, and then place on a magnetic stand for 2-5 minutes until the solution is completely clear; S4, first wash: use a pipette to slowly discard the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette, add 200ul of freshly prepared 80% ethanol, gently wash the magnetic beads, let stand for 30S and then discard the supernatant; S5, desulfurization: add 160ul L-Desulphonation Buffer, mix thoroughly by pipetting, let stand at room temperature for 15 minutes, place on a magnetic stand and magnetically absorb for 3 minutes, until the solution is clear and translucent (the total time of this step shall not exceed 25 minutes); S6, second wash: use a pipette to slowly aspirate the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette, add 200ul of newly prepared 80% ethanol, gently wash the magnetic beads, let stand for 30S and then discard the supernatant, wash twice; S7, dry: place on a magnetic stand and let stand at room temperature for 1-5min to dry the magnetic beads, wait until the alcohol is completely evaporated, there are no obvious droplets on the tube wall, and the magnetic beads are matte and not cracked; S8, elution: remove from the magnetic stand, add 80ul TE, mix by pipetting and let stand for 3-5min, adsorb on the magnetic stand for 1-3min, and after the solution is clear and translucent, aspirate the DNA solution into a new centrifuge tube.

[0019] As a preferred technical solution of the present invention, the colorectal cancer hypermethylation biomarkers in step 1 are specifically SLC8A3, MGAT3 and METTL24.

[0020] As a preferred technical solution of the present invention, the fluorescent labeling group in step three is specifically FAM, HEX, CY5 and ROX, and the fluorescent quenching group in step three is specifically BHQ1, BHQ2 and BHQ3.

[0021] As a preferred technical solution of the present invention, the specific process of establishing the qPCR amplification system in step 4 is as follows: S1, qPCR reaction solution configuration: SLC8A3-F1 (10 μM), SLC8A3-R1 (10 μM), SLC8A3-P1 (10 μM), MGAT3-F1 (10 μM), MGAT3-R1 (10 μM), MGAT3-P1 (10 μM), METTL24-F1 (10 μM), METTL24-R1 (10 μM), METTL24-P1 (10 μM), ACTB-F1 (10 μM), ACTB-R 1 (10 μM) and ACTB-P1 (10 μM) are configured according to the volume required for amplification of each component. If the number of samples is n, then n+3 copies are configured. The final concentration of each primer is 200-400 nM, and the final concentration of the probe is 100-200 nM. The configured PCR reaction solution is mixed and centrifuged, and then dispensed into PCR reaction tubes, with 20 μL dispensed into each tube; S2, sample addition: 5 μL of the prepared DNA sample is added to the PCR reaction tube, and the sample addition of the positive quality control and the negative quality control is the same as the sample. After adding the sample, cover the centrifuge tube cap, mix well and centrifuge briefly; S3, amplification reaction: pre-denaturation, annealing and extension are performed in sequence for qPCR amplification reaction.

[0022] As a preferred technical solution of the present invention, the interpretation of the test results in the step five is specifically as follows: S1, threshold setting: the threshold line is automatically generated by the instrument, or manually adjusted; S2, the effectiveness of the test kit is determined: the internal reference gene of the negative quality control product is amplified and the CT value is ≤30, and the methylation gene detection site is not amplified; the internal reference gene and the methylation gene of the positive quality control product are both amplified and the CT value is ≤35; S3, the determination of the methylation detection result: if two or all three of the three methylation targets are detected and the CT is ≤35, the sample to be tested is determined to be methylation positive; if only one of the three methylation targets or no methylation target is amplified, the sample to be tested is determined to be methylation negative.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1. This application contains DNA capture probes to improve detection sensitivity, detect multiple methylation targets in combination, reduce missed diagnosis rate, facilitate interpretation of test results, and truly achieve non-invasive detection;

[0025] 2. Screen out specific target combinations and their primer probe sequences, and then combine methylation detection with qPCR to make colorectal cancer methylation detection more accurate and convenient. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a structural schematic diagram of the present invention;

[0027] Figure 2 A flow chart for preparing the capture agent of the present invention;

[0028] Figure 3 Flowcharts to capture the extraction for the present invention;

[0029] Figure 4 is a flow chart of the bisulfite conversion of the present invention;

[0030] Figure 5 A flow chart established for the qPCR amplification system of the present invention;

[0031] Figure 6 A flow chart for interpreting the test results of the present invention;

[0032] Figure 7 It is the amplification result diagram of the present invention;

[0033] Figure 8 It is the detection result diagram of the present invention. DETAILED DESCRIPTION

[0034] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0035] See also Figure 1-8 The present invention provides the use of SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer, comprising the following steps:

[0036] Step 1: Sample collection: Through preliminary hybridization capture sequencing and multiple data filtering and analysis, three colorectal cancer hypermethylation biomarkers were screened out;

[0037] Step 2: DNA extraction: DNA extraction is performed on the collected samples, specifically including capture agent preparation, capture extraction and bisulfite conversion;

[0038] Step 3, design methylation primer probes: design specific methylation detection primer probes for multiple methylation sites on the three screened high methylation targets, and design detection primer probes and capture probes for each target for the internal reference gene ACTB. All primer probes are biosynthesized, and all detection probes have corresponding fluorescent labeling groups at their 5' ends and corresponding fluorescent quenching groups at their 3' ends. Capture probes are all labeled with biotin;

[0039] Step 4: Establishment of qPCR amplification system: Detect and quantify the target sequence using the DNA extracted in step 2;

[0040] Step 5: Interpretation of test results: Interpret the application results after the reaction in step 4.

[0041] In step 1, the sample collection specifically includes the positive quality control material being human methylated standard DNA, the negative quality control material being human non-methylated standard DNA, and the sample to be tested being a human stool sample.

[0042] The specific process of preparing the capture agent in step 2 is as follows: S1. Liquid injection: take an appropriate volume (50 μL) of streptavidin-coupled magnetic beads (10 mg / ml) and place them in a new centrifuge tube; S2. Reagent addition: add an equal volume of 1X B&W Buffer1 (2 mol / L NaCl: 0.01 mol / L Tris HCl: 0.001 mol / L EDTA) buffer to resuspend the magnetic beads; S3. First reagent mixing: place on the magnetic stand for 1 min and discard the supernatant; S4. Second reagent mixing: add an equal volume of 1X B&W Buffer1 buffer to the initial volume, wash the magnetic beads 3 times in total, and discard the supernatant; S5. Third reagent mixing: add 50 μL probe (10 uM), 200 ul 1X B&W Buffer1 buffer, which must be prepared in advance (so that the final concentration of the magnetic beads is 2 mg / ml), fully shake and mix the magnetic beads, place on a mixer, and mix at room temperature for 30 min; S6. Fourth reagent mixing: add 1 ml 1X Wash the magnetic beads with B&W Buffer 1 buffer twice and discard the supernatant; S7, complete the capture: add 50 μL 1X B&W Buffer 1 buffer, the added volume is the same as the initial magnetic bead volume, resuspend the magnetic beads, and the capture agent preparation is completed.

[0043] The capture extraction in step 2 is specifically as follows: S1. Dilute the sample: collect the fecal sample, add fecal preservation solution (0.3 mol / L EDTA, 0.05 mol / L Tris·HCl, 0.1 mol / L mannitol and 0.15 mol / L NaCl) in proportion (feces: fecal preservation solution = 1:3), fully oscillate and mix (mix for 2-4 hours) to obtain a fecal dilution sample; S2. First sample centrifugation: take 40 mL of fecal dilution sample into a clean 50 mL centrifuge tube, centrifuge at 3500g for 10 minutes, gently remove the centrifuge tube from the centrifuge, and carefully pipette 30 mL of supernatant into a clean 50 mL centrifuge tube; S3. Second sample centrifugation: add PVP (polyvinyl pyrrolidone, final concentration of 50 mg / mL) for treatment, vortex and vibrate. Swirl to mix thoroughly, centrifuge at 3500g for 10min; S4, reagent mixing: transfer the supernatant to a clean 50mL centrifuge tube, add an equal volume of 5mol / L guanidine isothiocyanate, and gently invert to mix (vertical mixer for 5min); S5, heat denaturation: heat denaturation at 90℃ for 10min; S6, magnetic separation: add appropriate amount of capture agent, mix at room temperature for 40min, magnetically absorb for 10min, and discard the supernatant; S7, reagent washing: wash 3 times with 600ul streptavidin magnetic beads combined with washing buffer (1XB&W Buffer1 buffer); S8, capture DNA: 50ul TE 80℃, 10min oscillation mixing + magnetic stand adsorption, collect the supernatant to obtain the captured DNA.

[0044] The bisulfite conversion in step 2 is as follows: S1. Preparation before the experiment: prepare the magnetic beads used for desulfurization purification and prepare M-Binding Buffer: MagBinding Beads according to the volume ratio of 60:1. MagBingding is easy to precipitate, so it is necessary to mix thoroughly, 80% ethanol and M-Elution Buffer (TE); S2. Experimental reaction: add 104ul Lightining Conversion Reagent to 16ul DNA sample to be treated with BS (keep away from light and record the opening date), mix thoroughly, and react on a PCR instrument. The reaction volume is 120ul and the reaction conditions are hot cover 105℃, 98℃, 8min; 54℃, 60min; 4℃, keep (no more than 20h); S3. Binding: add 488ul (M-Binding Buffer + MagBinding Beads) magnetic beads were gently pipetted and mixed, and then placed on a magnetic stand for 2-5 minutes until the solution was completely clear; S4, first wash: Use a pipette to slowly discard the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette, add 200ul of freshly prepared 80% ethanol, gently wash the magnetic beads, and discard the supernatant after standing for 30S; S5, desulfurization: Add 160ul L-Desulphonation Buffer, mix thoroughly by pipetting, let stand at room temperature for 15 minutes, place on a magnetic stand and adsorb for 3 minutes, until the solution is clear and translucent (the total time of this step shall not exceed 25 minutes); S6, second wash: use a pipette to slowly discard the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette, add 200ul of freshly prepared 80% ethanol, gently wash the magnetic beads, let stand for 30S and then discard the supernatant, wash twice; S7, dry: place on a magnetic stand and let stand at room temperature for 1-5min to dry the magnetic beads, wait until the alcohol is completely evaporated, there are no obvious droplets on the tube wall, and the magnetic beads are matte and not cracked; S8, elution: remove from the magnetic stand, add 80ul TE, mix by pipetting and let stand for 3-5min, adsorb on the magnetic stand for 1-3min, until the solution is clear and translucent, then aspirate the DNA solution into a new centrifuge tube.

[0045] The specific colorectal cancer hypermethylation biomarkers in step one are SLC8A3, MGAT3 and METTL24.

[0046] The fluorescent labeling group in step three is specifically FAM, HEX, CY5 and ROX, and the fluorescent quenching group in step three is specifically BHQ1, BHQ2 and BHQ3.

[0047] The specific process of establishing the qPCR amplification system in step 4 is as follows: S1, qPCR reaction solution preparation: SLC8A3-F1 (10 μM), SLC8A3-R1 (10 μM), SLC8A3-P1 (10 μM), MGAT3-F1 (10 μM), MGAT3-R1 (10 μM), MGAT3-P1 (10 μM), METTL24-F1 (10 μM), METTL24-R1 (10 μM), METTL24-P1 (10 μM), ACTB-F1 (10 μM), ACTB-R1 (10 μM), and ACTB-P1 (10 μM) is configured according to the volume required for amplification of each component. If the number of samples is n, then n+3 copies are configured. The final concentration of each primer is 200-400 nM, and the final concentration of the probe is 100-200 nM. The configured PCR reaction solution is mixed and centrifuged, and then dispensed into PCR reaction tubes, with 20 μL dispensed into each tube; S2, sample addition: 5 μL of the prepared DNA sample is added to the PCR reaction tube, and the sample addition of the positive quality control and the negative quality control is the same as the sample. After adding the sample, cover the centrifuge tube cap, mix well and centrifuge briefly; S3, amplification reaction: pre-denaturation, annealing and extension are performed in sequence for qPCR amplification reaction.

[0048] The interpretation of the test results in step five is specifically as follows: S1. Threshold setting: the threshold line is automatically generated by the instrument or adjusted manually; S2. The validity judgment of the test kit: the internal reference gene of the negative quality control product is amplified and the CT value is ≤30, and the methylation gene detection site is not amplified; the internal reference gene and the methylation gene of the positive quality control product are both amplified and the CT value is ≤35; S3. The judgment of the methylation test results: if two or all three of the three methylation targets are detected and the CT is ≤35, the sample to be tested is judged to be methylation positive; if only one of the three methylation targets or no methylation target is amplified, the sample to be tested is judged to be methylation negative.

[0049] Embodiment 1:

[0050] In the present invention, three colorectal cancer hypermethylation biomarkers SLC8A3, MGAT3 and METTL24 were screened out through hybrid capture sequencing and multiple data filtering and analysis in the early stage. Specific methylation detection primer probes were designed for multiple methylation sites on the three screened hypermethylated targets. At the same time, detection primer probes and capture probes for each target were designed for the internal reference gene ACTB. All primer probes were synthesized, and the candidate target and primer probe sequences are shown below:

[0051] SLC8A3:CGGCTGCCCGCTAAGGGGGAAGGGCAGGAGGCTCACCCCATTACTCACCGTTTCCTCTCGGCCTCCCGAGCGGAGTGGGCAAGGGAGGGGGGTGAGGAAGGTACGCGATGCCCCCGCCGCCCGGCGCCTCACCGGTCGCAGCGGCTCATCGCCCCCGCGGGCTGCCCGCCGGCCGCAGCCGCGTCCGGGGCATGTCAGTCCGCCGCCGCCGCCCTCCCGCCGGGGTTCGTGGGCTCGCAGCTGTCAGGGAGCTGCGGGGCAGCGCATCTGGAGCGC;

[0052] MGAT3:CGGGCACCCCTGCGCGCCGCGCTCGGCCTCGCCTCCGCGCCCCCCGCGCGCCCGCCGCGGTCCCTCCCCCGCGCCCGTCCGCTCGCCGGGCCCCCGCCGCCGCCCCGGGGTGCAGCCGAGCGGCCGCGCCGGGTCCCCGGGACGGGGTGGAAGTGGGGGTGGGGGGAGGGGATCGGGGCCGGGCC

[0053] METTL24:

[0054] GCGCCGGGCTCCGTAGCGCGGTCGGGAGGGGGCTTCTGGTCCCAGGCCCAAGACCGACCGCTTTGCAACTGACCTTCCGGCGGGGGCGCCCGCGCGGGCACAGCAGCCAGGCTCCGGCGTCCCGCTCCCGCCGCCCCCCGGCGGCGCCC GGCGACCGCTGCGCACGTAGGTCACCTGCCTCCTGCTGGCGCCGCGCGGCTGGCCCGGCGCGGGCGGCAGGTGCGGCCCAGGTGGCCGCCAGGCCGGGCCCGGCGGGGCGCTGCGGGTGGGGGACCCGGGCCCGGCGCGCCGCAGCTCTGC GCAGAGCCGCAGGCCGAACAACAGCACAGCCCCGAGTAGACACCGGCGCAGGACGCCGCAGCCCCTCCCGGGCGGCCTCTCCCGGGCCATGGCGCTACACTCGGGGTCCCGCGGGCCGCGCCTGGCCGGCAGCAGGGATGTAGCCCCACA GGCCGGAGCGGCCAACTGTGGGAACTCCCCCGCGGGCCGGGGTGCGGGCTCCGGACCCGCCTCCCTCCCTCCCGACCGAGGAAGCCCCGGCGTAACCTTATCCTGCCCTGCCGAGCGCGCCCCGCCGCTGGAAACGTGGTGGGCCGAACGCG

[0055]

[0056] Table 1. Primer and probe names

[0057] Capture probe name sequence ACTB-CaptureProbe TGGTGATGGAGGAGGCTCAGCAAGTCTTCTG SLC8A3-CaptureProbe CTCCCGAGCGGAGTGGGCAAGGGAGGGGGGTGAGGAAGGTACGCGATG MGAT3-CaptureProbe ACCCCTGCGCGCCGCGCTCGGCCTCGCCT METTL24-CaptureProbe TCCCAGGCCCAAGACCGACCGCTTTGCAACTGACCTTCC

[0058] Table 2. Capture probe names

[0059] All detection probes have corresponding fluorescent labeling groups at the 5' end, FAM, HEX, CY5 and ROX, and corresponding fluorescent quenching groups at the 3' end, BHQ1, BHQ2 and BHQ3. Capture probes are all labeled with biotin.

[0060] The positive quality control is human methylated standard DNA, the negative quality control is human unmethylated standard DNA, and the sample to be tested is human feces sample

[0061] Preparation of capture agent: Take an appropriate volume (50 μL) of streptavidin-coupled magnetic beads (10 mg / ml) and place them in a new centrifuge tube; add an equal volume of 1X B&W Buffer1 (2 mol / L NaCl: 0.01 mol / L Tris HCl: 0.001 mol / L EDTA) buffer to resuspend the magnetic beads; place on a magnetic stand for 1 min and discard the supernatant; add an equal volume of 1X B&W Buffer1 buffer to the initial volume (wash the magnetic beads 3 times in total) and discard the supernatant; add 50 μL of probe (10uM), 200ul 1X B&W Buffer1 buffer, which must be prepared in advance (so that the final concentration of the magnetic beads is 2 mg / ml), fully shake and mix the magnetic beads, place on a mixer, and mix at room temperature for 30 min; add 1 ml of 1X B&W Buffer1 buffer to wash the magnetic beads twice and discard the supernatant; add 50 μL1X B&W Buffer 1 buffer (the added volume is the same as the initial magnetic bead volume), resuspend the magnetic beads, and the capture agent preparation is completed.

[0062] Capture extraction: Fecal samples were collected and fecal preservation solution (0.3 mol / L EDTA, 0.05 mol / L Tris·HCl, 0.1 mol / L mannitol and 0.15 mol / L NaCl) (feces: feces preservation solution = 1:3), shake thoroughly (mix for 2-4 hours) to obtain a fecal dilution sample; take 40mL of fecal dilution sample into a clean 50mL centrifuge tube, centrifuge at 3500g for 10 minutes, gently remove the centrifuge tube from the centrifuge, and carefully pipette 30mL of supernatant into a clean 50mL centrifuge tube; add PVP (polyvinyl pyrrolidone, final concentration of 50mg / mL) for treatment, vortex to mix it thoroughly, and centrifuge at 3500g for 10 minutes; transfer the supernatant to a clean 50mL centrifuge tube, add an equal volume of 5mol / L guanidine isothiocyanate, and gently invert and mix (vertical mixer for 5 minutes); heat denaturation at 90℃ for 10 minutes; add an appropriate amount of capture agent, mix at room temperature for 40 minutes, magnetically absorb for 10 minutes, and discard the supernatant; wash 3 times with 600ul streptavidin magnetic bead binding washing buffer (1X B&W Buffer1 buffer); 50ul TE 80℃, 10min shaking and mixing + magnetic stand adsorption, collect the supernatant to obtain the captured DNA.

[0063] Bisulfite conversion: The bisulfite conversion used the EZ-96 DNA Methylation-Lightning TM Ma-gPrep Kit from ZYMO RESEARCH. Preparations before the experiment: prepare the magnetic beads used for desulfurization purification (prepare M-Binding Buffer: MagBinding Beads according to the volume ratio of 60:1, MagBingding is easy to precipitate, so mix thoroughly), 80% ethanol and M-Elution Buffer (TE); add 104ul Lightining Conversion Reagent to 16ul of the DNA sample to be treated with BS (keep away from light and record the opening date), mix thoroughly, and perform the following reaction on the PCR instrument: Reaction volume: 120ul, reaction conditions: hot cover 105℃, 98℃, 8min; 54℃, 60min; 4℃, keep (no more than 20h); Binding: add 488ul (M-Binding Buffer + MagBinding Beads) magnetic beads were gently pipetted and mixed, and then placed on a magnetic stand for 2-5 minutes until the solution was completely clear; washing: the supernatant was slowly aspirated and discarded with a pipette, and the tip of the pipette was prevented from disturbing the magnetic beads, and 200ul of freshly prepared 80% ethanol was added to gently wash the magnetic beads, and the supernatant was discarded after standing for 30S; desulfurization: 160ul L-Desulphonation Buffer, mix thoroughly by pipetting, let stand at room temperature for 15 minutes, place on a magnetic stand for 3 minutes, until the solution is clear and translucent (the total time of this step shall not exceed 25 minutes); Wash: Use a pipette to slowly discard the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette, add 200ul of freshly prepared 80% ethanol, gently wash the magnetic beads, let stand for 30S and discard the supernatant (wash twice); Dry: Place on a magnetic stand and let stand at room temperature for 1-5min to dry the magnetic beads, wait until the alcohol is completely evaporated, there are no obvious droplets on the tube wall, and the magnetic beads are matte and not cracked; Elution: Remove from the magnetic stand, add 80ul TE, mix by pipetting and let stand for 3-5min, adsorb on the magnetic stand for 1-3min, and after the solution is clear and translucent, aspirate the DNA solution into a new centrifuge tube.

[0064] qPCR reaction solution preparation: Prepare the volume required for amplification of each component according to Table 3 (if the number of samples is n, prepare n+3 copies), the final concentration of each primer is 200-400nM, the final concentration of the probe is 100-200nM, mix the prepared PCR reaction solution, centrifuge it, and dispense it into PCR reaction tubes, 20μL per tube:

[0065]

[0066]

[0067] Table 3. Primer probe MIX table

[0068] Components 1 serving (μL) 2×TaqManqPCRMix 12.5 Primer probe MIX 6 ddH2O 1.5 Total 20

[0069] Table 4. Component ratio

[0070] Sample addition: Add the prepared DNA sample (5 μL) into the PCR reaction tube. Add the positive quality control and negative quality control in the same way as the sample. After adding the sample, cover the centrifuge tube cap, mix well and centrifuge briefly.

[0071] Perform qPCR amplification according to the procedure in Table 5 below:

[0072]

[0073]

[0074] Table 5. Amplification reaction table

[0075] Threshold setting: The threshold line is automatically generated by the instrument and adjusted manually. The validity of the test kit is judged as follows: the internal reference gene of the negative quality control product is amplified and the CT value is ≤30, and the methylation gene detection site is not amplified; the internal reference gene and the methylation gene of the positive quality control product are both amplified and the CT value is ≤35. The judgment of the methylation detection result: if two or all three of the three methylation targets are detected and the CT is ≤35, the sample to be tested is judged to be methylation positive; if only one of the three methylation targets or no methylation target is amplified, the sample to be tested is judged to be methylation negative.

[0076] Embodiment 2:

[0077] In the present invention, 54 human stool samples (18 cases of colorectal cancer and 36 normal cases, all diagnosed by pathology) were collected, and DNA extraction and detection were performed according to the above scheme. The test results are shown below. As shown in Table 6, the methylation levels of the three targets in colorectal cancer tissue (tCRC) are significantly higher than those in paracancerous tissue (tCRN) and white blood cells (tBcell). The following Table 7 shows the CT value of the three-target combined detection. The dot plot and ROC curve of the three-target combined detection are as follows Figure 7 As shown in A and B, the specificity of the combined detection was 100% (36 / 36), the sensitivity was 88.89% (16 / 18), and the area under the ROC curve was 0.9275 (95% CI: 0.818-1, P < 0.0001). The results showed that the colorectal cancer methylation detection kit provided by the present invention has high detection sensitivity and specificity in detecting gene methylation in colorectal cancer stool samples, and the result interpretation is simple and convenient.

[0078]

[0079]

[0080] Table 6. Site information and average methylation levels of the three candidate targets screened for bioinformatics analysis

[0081]

[0082]

[0083]

[0084]

[0085]

[0086] Table 7. Results of three-target combined detection

[0087] When calculating ΔCT, NoCt defaults to 45. Figure 7 A and B are typical amplification results of colorectal cancer positive samples, C and D are typical amplification results of normal human samples. Figure 8 , A is the dot plot of the three-target combined detection, B is the ROC curve of the three-target combined detection.

[0088] Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer, characterized in that: The following steps are involved: Step 1: Sample collection: Through preliminary hybridization capture sequencing and multiple data filtering and analysis, three colorectal cancer hypermethylation biomarkers were screened out; Step 2: DNA extraction: DNA extraction is performed on the collected samples, specifically including capture agent preparation, capture extraction and bisulfite conversion; Step 3, design methylation primer probes: design specific methylation detection primer probes for multiple methylation sites on the three screened high methylation targets, and design detection primer probes and capture probes for each target for the internal reference gene ACTB. All primer probes are biosynthesized, and all detection probes have corresponding fluorescent labeling groups at their 5' ends and corresponding fluorescent quenching groups at their 3' ends. Capture probes are all labeled with biotin; Step 4: Establishment of qPCR amplification system: Detect and quantify the target sequence using the DNA extracted in step 2; Step 5: Interpretation of test results: Interpret the application results after the reaction in step 4.

2. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: In the step 1, the sample collection specifically includes a positive quality control product of human methylated standard DNA, a negative quality control product of human non-methylated standard DNA, and a sample to be tested of human feces sample.

3. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: The specific process of preparing the capture agent in step 2 is as follows: S1, liquid injection: take an appropriate volume (50 μL) of streptavidin-coupled magnetic beads (10 mg / ml) and place them in a new centrifuge tube; S2, reagent addition: add an equal volume of 1X B&W Buffer 1 (2 mol / L NaCl: 0.01 mol / LTris HCl: 0.001 mol / L EDTA) buffer to resuspend the magnetic beads; S3, first reagent mixing: place on the magnetic stand for 1 min, and discard the supernatant; S4, second reagent mixing: add an equal volume of 1X B&W Buffer 1 buffer to the initial volume, wash the magnetic beads 3 times in total, and discard the supernatant; S5, third reagent mixing: add 50 μL probe (10 uM), 200 ul 1X B&W Buffer 1 buffer, which must be prepared in advance (so that the final concentration of the magnetic beads is 2 mg / ml), fully shake and mix the magnetic beads, place on a mixer, and mix at room temperature for 30 min; S6, fourth reagent mixing: add 1 ml 1X B&W Wash the magnetic beads with Buffer 1 buffer twice and discard the supernatant; S7, complete the capture: add 50 μL 1X B&W Buffer 1 buffer, the added volume is the same as the initial magnetic bead volume, resuspend the magnetic beads, and complete the capture agent preparation.

4. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: The capture extraction in step 2 is specifically as follows: S1. Dilute the sample: collect the fecal sample, add fecal preservation solution (0.3 mol / L EDTA, 0.05 mol / L Tris·HCl, 0.1 mol / L mannitol and 0.15 mol / L NaCl) in proportion (feces: fecal preservation solution = 1:3), fully oscillate and mix (mix for 2-4 hours) to obtain a fecal dilution sample; S2. First sample centrifugation: take 40 mL of the fecal dilution sample into a clean 50 mL centrifuge tube, centrifuge at 3500g for 10 minutes, gently remove the centrifuge tube from the centrifuge, and carefully pipette 30 mL of the supernatant into a clean 50 mL centrifuge tube; S3. Second sample centrifugation: add PVP (polyvinyl pyrrolidone, final concentration of 50 mg / mL) for treatment, vortex Oscillate to mix thoroughly, centrifuge at 3500g for 10min; S4, reagent mixing: transfer the supernatant to a clean 50mL centrifuge tube, add an equal volume of 5mol / L guanidine isothiocyanate, and gently invert to mix (vertical mixer for 5min); S5, heat denaturation: heat denaturation at 90℃ for 10min; S6, magnetic separation: add appropriate amount of capture agent, mix at room temperature for 40min, magnetically absorb for 10min, and discard the supernatant; S7, reagent washing: wash 3 times with 600ul streptavidin magnetic beads combined with washing buffer (1X B&W Buffer1 buffer); S8. Capture DNA: 50ul TE at 80℃, shake and mix for 10min + adsorb on magnetic rack, collect the supernatant to obtain the captured DNA.

5. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: The bisulfite conversion in step 2 is specifically as follows: S1. Preparation before the experiment: prepare the magnetic beads used for desulfurization purification and prepare M-Binding Buffer: MagBinding Beads in a volume ratio of 60:

1. MagBingding is easy to precipitate, so it is necessary to fully mix, 80% ethanol and M-Elution Buffer (TE); S2. Experimental reaction: add 104ul Lightining Conversion Reagent (keep away from light, record the opening date) to 16ul of the DNA sample to be treated with BS, mix well, and react on a PCR instrument. The reaction volume is 120ul, and the reaction conditions are hot cover 105℃, 98℃, 8min; 54℃, 60min; 4℃, keep (no more than 20h); S3. Binding: add 488ul (M-Binding Buffer+MagBindingBeads) magnetic beads, gently pipette and mix, let stand for 5min, and then place on a magnetic stand for 2-5min until the solution is completely clear; S4. First wash: Use a pipette to slowly discard the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette. Add 200ul of freshly prepared 80% ethanol, gently wash the magnetic beads, and discard the supernatant after standing for 30S; S5. Desulfurization: Add 160ul L-Desulphonation Buffer, mix thoroughly by pipetting, let stand at room temperature for 15min, place on a magnetic stand for magnetic absorption for 3min, until the solution is clear and transparent (the total time for this step does not exceed 25min); S6. Second wash: Use a pipette to slowly discard the supernatant, and avoid disturbing the magnetic beads with the tip of the pipette. Add 200ul of freshly prepared 80% ethanol, gently wash the magnetic beads, and discard the supernatant after standing for 30S, and wash twice; S7. Drying: Place on a magnetic stand at room temperature for 1-5min to dry the magnetic beads, wait until the alcohol is completely evaporated, there are no obvious droplets on the tube wall, and the magnetic beads are matte and not cracked; S8. Elution: Remove from the magnetic stand and add 80ul TE, mix by pipetting and let stand for 3-5 minutes, adsorb on a magnetic rack for 1-3 minutes, and when the solution is clear and transparent, pipette the DNA solution into a new centrifuge tube.

6. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: In step 1, the colorectal cancer hypermethylation biomarkers are specifically SLC8A3, MGAT3 and METTL24.

7. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: The fluorescent labeling group in step three is specifically FAM, HEX, CY5 and ROX, and the fluorescent quenching group in step three is specifically BHQ1, BHQ2 and BHQ3.

8. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: The specific process of establishing the qPCR amplification system in step 4 is as follows: S1, qPCR reaction solution preparation: SLC8A3-F1 (10 μM), SLC8A3-R1 (10 μM), SLC8A3-P1 (10 μM), MGAT3-F1 (10 μM), MGAT3-R1 (10 μM), MGAT3-P1 (10 μM), METTL24-F1 (10 μM), METTL24-R1 (10 μM), METTL24-P1 (10 μM), ACTB-F1 (10 μM), ACTB-R1 (10 μM) and ACTB-P1 (10 μM) according to the volume required for amplification of each component. If the number of samples is n, then n+3 copies are prepared. The final concentration of each primer is 200-400nM, and the final concentration of the probe is 100-200nM. The prepared PCR reaction solution is mixed and centrifuged, and then dispensed into PCR reaction tubes, with 20 μL dispensed into each tube; S2, sample addition: 5 μL of the prepared DNA sample is added to the PCR reaction tube, and the sample addition of the positive quality control and the negative quality control is the same as the sample. After adding the sample, cover the centrifuge tube cap, mix well and centrifuge briefly; S3, amplification reaction: pre-denaturation, annealing and extension are performed in sequence for qPCR amplification reaction.

9. The use of the SLC8A3, MGAT3, and METTL24 biomarkers in the diagnosis of colorectal cancer according to claim 1, characterized in that: The interpretation of the test results in step 5 is specifically as follows: S1, threshold setting: the threshold line is automatically generated by the instrument or manually adjusted; S2, the effectiveness of the test kit is determined: the internal reference gene of the negative quality control product is amplified and the CT value is ≤30, and the methylation gene detection site is not amplified; the internal reference gene and the methylation gene of the positive quality control product are both amplified and the CT value is ≤35; S3, the determination of the methylation test result: if two or all three of the three methylation targets are detected and the CT is ≤35, the sample to be tested is determined to be methylation positive; if only one of the three methylation targets or no methylation target is amplified, the sample to be tested is determined to be methylation negative.

Images