A SNP molecular marker located on chromosome 5 of pigs and associated with the trait of piglets born alive and its application

Abstract

The present invention belongs to the field of molecular biotechnology and molecular marker technology, and specifically relates to a SNP molecular marker and application thereof located on chromosome 5 of pigs and associated with the trait of piglets born alive. The SNP site of the SNP molecular marker located on chromosome 5 of pigs and associated with the trait of piglets born alive corresponds to the T>G mutation at the 89503311bp position on chromosome 5 of the international pig reference genome version 11.1. The molecular marker was detected by whole genome association analysis and found that the molecular marker significantly affects the trait of piglets born alive. The present invention also provides a primer pair and a kit for identifying the molecular marker. The molecular marker, primer pair or kit can be used to establish an efficient and accurate molecular marker-assisted breeding technology, which can be applied to the genetic improvement of the piglet number trait of piglets born alive, thereby increasing the piglet number born alive, increasing corporate profits, and increasing core competitiveness.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and specifically relates to a SNP molecular marker located on chromosome 5 of pigs and associated with the trait of piglet number born alive and an application thereof. Background Art

[0002] In the process of pig farming, the number of piglets born alive is one of the important reproductive performances of pigs. The number of piglets born alive directly affects the production efficiency of pig farming enterprises. Genetic improvement of the number of piglets born alive is the focus of pig breeding. The number of piglets born alive is regulated by multiple factors such as genetics and environment. The genetic improvement of the number of piglets born alive through traditional breeding methods may have little effect. Therefore, if the molecular marker assisted selection (MAS) technology can be used to improve the number of piglets born alive in pigs, early selection of pigs at the molecular level will further accelerate the breeding improvement process of this trait, improve the reproductive efficiency of sows, and increase the economic benefits of pig farming enterprises.

[0003] Genome-wide association study (GWAS) is a statistical method to associate SNP markers covering the entire genome with complex phenotypes to detect genetic variations that are most likely to affect the relevant phenotypes. However, sample size and marker density are important factors that affect GWAS results. Generally speaking, the larger the sample size and the higher the marker density, the stronger the statistical power of GWAS. The size of the sample is mainly affected by objective factors such as experimental cost and experimental cycle, while marker density can be increased through genotype filling technology.

[0004] Landrace pigs are one of the main lean meat pig breeds introduced into my country. They have the characteristics of fast growth, high feed conversion rate, and strong reproductive performance. They are often used as the first maternal parent of Duroc × Landrace × Large White commercial pigs, and are also often used for crossbreeding with local pigs in my country. Therefore, genetic improvement of the number of live piglets born in the core group Landrace pigs can improve the reproductive performance of sows, thereby improving the competitiveness of pig breeding enterprises and bringing huge economic benefits to enterprises. Summary of the invention

[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary purpose of the present invention is to provide a SNP molecular marker located on chromosome 5 of the pig and related to the number of piglets born alive. The SNP molecular marker is obtained through whole genome association analysis and can significantly affect the number of piglets born alive.

[0006] Another object of the present invention is to provide an application of the above-mentioned SNP molecular marker.

[0007] Another object of the present invention is to provide a primer pair and a kit for detecting the above-mentioned SNP molecular markers.

[0008] The fourth object of the present invention is to provide an application of the above-mentioned primer pair and kit.

[0009] A fifth object of the present invention is to provide a method for genetic improvement of Landrace pigs.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A SNP molecular marker located on chromosome 5 of pigs and associated with the trait of piglets born alive, wherein the SNP site of the SNP molecular marker corresponds to the T>G mutation at 89503311bp on chromosome 5 of the international pig reference genome version 11.1; the polymorphism of the bases at this site affects the trait of piglets born alive, wherein the number of piglets born alive in pigs with the TT genotype is higher than that in pigs with the TG genotype and the GG genotype.

[0012] The nucleotide sequence of the SNP molecular marker is preferably as shown in SEQ ID NO.1, wherein M in the sequence is T or G.

[0013] The SNP site of the SNP molecular marker is the nucleotide mutation T134-G134 at position 134 of the sequence annotation of SEQ ID NO: 1 (a single base mutation of nucleic acid at position 134 of the sequence fragment, named: g.134 T>G).

[0014] The pig is preferably American Landrace pig and its synthetic strain.

[0015] A primer pair for detecting the above-mentioned SNP molecular marker comprises primers primer-F and primer-R, and the nucleic acid sequences thereof are as follows:

[0016] Upstream primer primer-F: 5′-AGCCCATGTCTCCTTCATGC-3′;

[0017] Downstream primer primer-R: 5'-CCAAAAGAGCTTTCACGGGC-3'.

[0018] A kit for detecting the above-mentioned SNP molecular marker comprises the above-mentioned primer pair.

[0019] The SNP molecular marker, primer pair or kit is used in identifying the piglet number born alive trait or screening pig breeds with high piglet number born alive or in genetic breeding of pig piglet number born alive trait.

[0020] The genetic breeding is preferably molecular marker-assisted genetic breeding.

[0021] The pig is preferably American Landrace pig and its synthetic strain.

[0022] A method for detecting the trait of piglet number born alive, comprising the following steps:

[0023] The above-mentioned SNP molecular marker on pig chromosome 5 is detected, and the number of piglets born alive is determined according to whether the single nucleotide at the SNP site of the SNP molecular marker is T or G; among them, the number of piglets born alive by pigs with TT genotype is higher than that of pigs with TG genotype and GG genotype.

[0024] The pig is preferably American Landrace pig and its synthetic strain.

[0025] A method for screening a pig breed with high live piglet production comprises the following steps:

[0026] The above SNP molecular markers on pig chromosome 5 are detected, individuals with TG genotype and GG genotype at the SNP molecular marker are eliminated, and individuals with TT genotype at the SNP molecular marker are retained as breeding pigs.

[0027] The pig is preferably American Landrace pig and its synthetic strain.

[0028] The detection method comprises the following steps:

[0029] (1) Extracting genomic DNA from the pig to be tested;

[0030] (2) using the above primer pair or the primer pair in the above kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product;

[0031] (3) Sequencing the PCR amplification product to obtain sequencing results;

[0032] (4) Determine the genotype based on the sequencing results.

[0033] A method for genetic improvement of pigs, comprising the following steps:

[0034] Determine the above-mentioned SNP molecular markers of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: for the sub-breeding of breeding pigs, select the breeding pigs with the TT genotype at the 89503311bp on chromosome 5 of the international pig reference genome version 11.1, and eliminate the breeding pigs with the TG and GG genotypes at this site, so as to increase the frequency of the allele T at this site from generation to generation, thereby increasing the number of pigs born alive.

[0035] The pig is preferably American Landrace pig and its synthetic strain.

[0036] Compared with the prior art, the present invention has the following advantages and effects:

[0037] (1) The present invention studies and determines that the molecular markers that affect the piglet number born alive are located on the nucleotide sequence of chromosome 5 of the pig, verifies its effect on the piglet number born alive trait, and ultimately establishes a molecular marker-assisted selection breeding technology for rapid improvement of the piglet number born alive trait, and applies it to the genetic improvement of the piglet number born alive trait, thereby increasing the piglet number born alive, increasing corporate profits, and enhancing core competitiveness.

[0038] (2) The present invention provides a primer pair and a kit for detecting a SNP molecular marker located on chromosome 5 of pigs and associated with the trait of piglets born alive. Through the primer pair or the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select and breed for the trait of piglets born alive, thereby accelerating the breeding process. The technology can be applied to the genetic improvement of the trait of piglets born alive in breeding pigs, thereby increasing the number of piglets born alive and improving the reproductive efficiency of sows, thereby increasing corporate profits and core competitiveness.

[0039] (3) The present invention provides a method for pig breeding by optimizing the dominant allele of the molecular marker, which can accelerate the genetic progress of American Landrace pigs, shorten the time for improving American Landrace pigs, and thus effectively improve the economic benefits of breeding pigs. Among them, if the present invention selects all GG-type and TG-type individuals of the molecular marker that affects the number of piglets born alive into TT-type individuals, the number of piglets born alive in American Landrace pigs will increase by 0.74. A large-scale pig farm with 100,000 pigs, based on 5,000 breeding sows, can provide 0.74 more piglets per litter. If sows produce 2.2 litters a year, the farm will provide 8,140 more pigs per year, which will bring about 16.28 million yuan in income to the farm. It can be seen that the potential for high live piglets to provide benefits to the pig farming industry is huge. Therefore, by optimizing the dominant allele (T) of the SNP of American Landrace pigs, the reproductive efficiency of sows can be significantly improved, thereby improving the economic benefits of the pig farm. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a genome-wide association study (GWAS) analysis of pigs on chromosome 5 for the number of piglets born alive. The horizontal axis represents the chromosome number of the pig; the vertical axis represents -log 10 ( P- value).

[0041] Figure 2 This is an analysis chart of the number of piglets born alive in pigs with different genotypes. DETAILED DESCRIPTION

[0042] Example 1 Detailed explanation of the determination process of the factors affecting the number of piglets born alive in the present invention

[0043] (1) Experimental animals

[0044] The present invention uses a total of 495 purebred American Landrace pigs. The experimental pig group is a core breeding pig group of a national core breeding farm, and the herd pedigree is recorded in detail. The pigs are free to eat and drink water, and the entire feeding method, feeding conditions, etc. are always consistent, which is a conventional method.

[0045] (2) Phenotypic trait data

[0046] The phenotypic trait data of the present invention are derived from the reproductive data of all pigs recorded by the company, including the number of piglets born alive (the number of live piglets in the same litter within 24 hours of birth) and the like.

[0047] (3) Sample collection

[0048] The above-mentioned American Landrace pig ear-like tissues were collected and immersed in a 75% ethanol solution by volume, and stored in a -20°C refrigerator for later use.

[0049] Example 2 Detailed explanation of the invention process of obtaining the gene markers of the present invention

[0050] (1) Extraction of DNA from ear tissue of purebred American Landrace pigs: Whole genome DNA was extracted according to the standard phenol-chloroform method. The DNA of the American Landrace pig population was tested for quality and concentration using a Nanodrop-ND1000 spectrophotometer. The A260 / 280 ratio was between 1.8 and 2.0, and the A260 / 230 ratio was between 1.7 and 1.9, which was considered qualified. Finally, the qualified DNA samples were uniformly diluted to 50 ng / μL.

[0051] (2) 50K SNP genotyping of the whole genome of pigs: DNA samples were sent to Beijing Compson Biotechnology Co., Ltd., and chip hybridization and result scanning (i.e. genotype determination) were performed based on the SMIC-1 50K SNP typing platform using the instructions and standard procedures of Illumina Infinium. Finally, the genotype data were read using GenomeStudio software. PLINKv1.90 was used to perform quality control on the obtained genotype data, and the detection rate <95%, the allele frequency (MAF) <1% or deviation from Hardy-Weinberg Equilibrium (HWE) were eliminated. P ≤10 -6 SNP markers with a detection rate of <95% were excluded.

[0052] (3) Filling missing genotypes in pigs: Using the public data of 947 individuals (https: / / doi.org / 10.1038 / s41467-023-40434-3) as the filling reference population, the above-mentioned American Landrace 50K SNPs chip data were filled into whole genome sequencing data based on the reference haplotype library using Beagle v5.1 software. The genotype filling data was then quality controlled, and the specific quality control method was the same as step (2).

[0053] (4) Genome-wide association (GWAS) analysis: In order to eliminate the population stratification effect, the present invention uses linear mixed model single-point regression analysis combined with GEMMA software for GWAS analysis. The analysis model uses the similarity of the genome between individuals to correct the stratification effect. In addition, given the assumption that the number of independent haplotype boxes in pigs and humans is basically the same in the genome, the genomic significance threshold set for human-related GWAS analysis is 5.00×10 -8 The present invention refers to the significant threshold of the human genome, and the significant level threshold of the genome is 5.00×10 -8 The significant threshold at the chromosome level was 1.00×10 -6 .

[0054] GWAS analysis results Figure 1 As shown. Figure 1 It can be seen that there is a locus on chromosome 5 that significantly affects the number of live piglets born in purebred American Landrace pigs. The strongest associated SNP is g.134 T>G (corresponding to the T>G mutation at 89503311bp on chromosome 5 of the International Pig Reference Genome 11.1 version) ( P =7.08×10 -9 ).

[0055] (5) Analysis of the association between different genotypes and the number of piglets born alive in American Landrace pigs:

[0056] According to Table 1 and Figure 2 It can be seen that the molecular marker SNP site g.134 T>G is extremely significantly correlated with the number of piglets born alive ( P =7.08×10 -9 ), among which the TT type pigs with this molecular marker have a higher number of live piglets than the TG and GG type pigs. The results show that the T of this molecular marker is a favorable allele and G is an unfavorable allele. Therefore, in the breeding process, it is necessary to gradually eliminate the GG and TG genotype pigs and retain the TT genotype pigs to increase the frequency of the allele T at this site generation by generation to increase the number of piglets born alive.

[0057] Table 1 Correlation between molecular marker SNP locus g.134 T>G and number of piglets born alive

[0058]

[0059] Example 3 Detailed explanation of the invention process of detecting SNP markers

[0060] (1) The target fragment containing the SNP site significantly associated with the number of piglets born alive in American Landrace pigs is a nucleotide sequence of 861 bp in chromosome 5 (SEQ ID NO: 1). The upstream and downstream primers for sequence amplification are primer-F and primer-R, and the nucleic acid sequence is as follows:

[0061] Upstream primer primer-F: 5′-AGCCCATGTCTCCTTCATGC-3′;

[0062] Downstream primer primer-R: 5'-CCAAAAGAGCTTTCACGGGC-3'.

[0063] (2) PCR amplification system and condition settings

[0064] Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, ddH 2 O 3.4μL, PCR reaction program was: 95°C 3min; 94°C 30s, 60°C 30s, 72°C 30s, 30 cycles; 72°C 10 min.

[0065] (3) DNA sequencing and identification: Sequencing was performed at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0066] AGCCCATGTCTCCTTCATGCAAAAGTCATTTCAATGTTTAATTACTGAAAAATCCAGTAAAGCTAAGAAGAGTGATTTCATGCACTCATTCCCTAAGATTTAAAAAAAAAAGAAGCAGACCAAGTATAAGCTG M(T / G)TAGATTTAGATGAATTACTATAAAAGTCAATTTAATGGCATTATCAATAATTGCAAATCTAAATAACAGGTTTCACATGAAGGCTGGTTATGTTAACACATCCAGGTAGTTGGTTATTGATGGCCCAAAGGGGGCATAGTTACTCATCGCCTTGGAGATGATGCTGATAGATTACCATGCT GATGGATATCATTAACCACATAAAAAAAGGAAGCCTGATTCATTTATTTAAGCCTCCATAGAAGGTAGTTCTTAACTTCTGTCCCTAAACAAAGAAAAAGAAAACAAAAAAAAACCCTTTTTTAATTTTTAATCATGAAGTTTAAAAACAGGGCACTTTTCTCCTTCTATGTCCTGGGTTTG TAAGACCACCTTCCAAGCCTTGCATGATCAGAAGCGTAGAGCAGCCCCCTACACATCCTTATTCTTCAGTTCCCGTAAACCCTGGGATTCAAACTGATGACACACAATATTAATTCTTCAAGAGTAGGGCGATAGTTCTTTCTACTGCTCTCCAGAGTTCCGTAACTCCAGCCTTAAGAG ACCATGCAAATGTCTTCTAACTGCAAATTCCTTCTCATAATCATTATATAACGACTCATTCACATAAGGATCTCTGTCAAAGTGAATGATCCTGTCACTGATACCTGAGCTGCTTTATTTCTGCAGGTGATGGATTTTTTGTTTTTTTTTTTTCTCCTATAGCCCGTGAAAGCTCTTTTGG

[0067] Note: The M marked in the sequence is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation), and the bold at the beginning and end of the sequence is the primer sequence binding position.

[0068] Example 4 Analysis of the effect of molecular marker SNP site g.134 T>G

[0069] The present invention provides a SNP molecular marker that can significantly increase the number of piglets born alive in American Landrace pigs. Using the SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of the number of piglets born alive in American Landrace pigs. If the present invention selects all GG-type and TG-type individuals of the molecular markers that affect the number of piglets born alive into TT-type individuals, the number of piglets born alive in American Landrace pigs will increase by 0.74. A large-scale pig farm with 100,000 pigs, based on 5,000 breeding sows, can provide 0.74 more piglets per litter. If the sows produce 2.2 litters a year, 8,140 more pigs will be provided to the pig farm each year, and each pig will be sold at 120 kg. Each pig costs 2,000 yuan, which will bring about 16.28 million yuan in income to the pig farm. It can be seen that genetic improvement of the number of piglets born alive in sows brings huge economic benefits to the pig farm. Among the individuals with this SNP molecular marker, by optimizing the dominant allele (T) of this SNP in the American Landrace sow population, it is ultimately possible to improve the reproductive performance of sows, thereby increasing the company's profits.

[0070] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A reagent for detecting a SNP molecular marker on chromosome 5 of a pig related to the piglet number born alive trait, for use in identifying the piglet number born alive trait or screening a pig breed with a high piglet number born alive or in genetic breeding of the piglet number born alive trait, characterized in that The SNP site of the SNP molecular marker corresponds to the T>G mutation at 89503311bp on chromosome 5 of the international pig reference genome version 11.1; the polymorphism of the base at this site affects the trait of the number of piglets born alive, wherein the number of piglets born alive by pigs with the TT genotype is higher than that of pigs with the TG genotype and the GG genotype; The pigs are American Landrace pigs and their synthetic strains.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is T or G.

3. A primer pair for detecting a SNP molecular marker on chromosome 5 associated with the piglet number born alive trait in identifying the piglet number born alive trait or screening a pig breed with a high piglet number born alive or in genetic breeding of the piglet number born alive trait, characterized in that The primer pair comprises primers primer-F and primer-R, and the nucleic acid sequences thereof are as follows: Upstream primer primer-F: 5′-AGCCCATGTCTCCTTCATGC-3′; Downstream primer primer-R: 5′-CCAAAAGAGCTTTCACGGGC-3′; The application includes sequencing the PCR amplification product obtained by amplification of the above primer pair, and determining the genotype based on the sequencing result; The SNP molecular marker is the SNP molecular marker described in claim 1; the number of piglets born alive by pigs with TT genotype at the molecular marker is higher than that of pigs with TG genotype and GG genotype; The pigs are American Landrace pigs and their synthetic strains.

4. A kit for detecting SNP molecular markers on chromosome 5 of pigs related to the number of piglets born alive, for use in identifying the number of piglets born alive trait of pigs or screening pig breeds with high number of piglets born alive or genetic breeding of pig number of piglets born alive trait, characterized in that The kit comprises the primer pair according to claim 3; The application includes sequencing the PCR amplification product obtained by amplification of the above primer pair, and determining the genotype based on the sequencing result; The SNP molecular marker is the SNP molecular marker described in claim 1; the number of piglets born alive by pigs with TT genotype at the molecular marker is higher than that of pigs with TG genotype and GG genotype; The pigs are American Landrace pigs and their synthetic strains.

5. A method for detecting the number of piglets born alive, characterized in that The following steps are included: Detecting the SNP molecular marker described in claim 1 on chromosome 5 of pigs, and judging the piglet number trait born alive according to whether the single nucleotide at the SNP site of the SNP molecular marker is T or G; wherein the piglet number born alive of the TT genotype is higher than that of the TG genotype and the GG genotype; The pigs are American Landrace pigs and their synthetic strains.

6. A method for selecting a pig breed with high live piglet production, characterized in that The following steps are involved: Detect the SNP molecular marker described in claim 1 on chromosome 5 of pigs, eliminate individuals whose SNP sites of the SNP molecular markers are TG genotype and GG genotype, and retain individuals whose SNP sites of the SNP molecular markers are TT genotype as breeding pigs; The pigs are American Landrace pigs and their synthetic strains.

7. The method according to claim 5 or 6, characterized in that: The detection method comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) Sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

8. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP molecular markers on chromosome 5 of the breeding pigs in the breeding pig core group that are related to the trait of the number of piglets born alive, and make corresponding selections based on the molecular markers: select the breeding pigs with the TT genotype at the 89503311bp position on chromosome 5 of the international pig reference genome version 11.1 for the successive breeding of the breeding pigs, and eliminate the breeding pigs with the TG and GG genotypes at the site, so as to increase the frequency of the allele T at the site from generation to generation, thereby increasing the number of piglets born alive; The pigs are American Landrace pigs and their synthetic strains.

Images