Nucleic acid phase diagram analysis method based on variable-temperature ultraviolet absorption spectrum

Abstract

The invention belongs to the field of biomedicine, and discloses a nucleic acid phase diagram analysis method based on a variable-temperature ultraviolet absorption spectrum, which comprises the following steps: preparing buffer solutions with different gradient pH-ionic strength combinations, mixing the buffer solutions with a target structure, performing an annealing and melting procedure, and continuously collecting ultraviolet absorption spectrum data; matching the data of the temperature and the absorbance changing along with the time according to the time to obtain the data of the absorbance changing along with the temperature under the full wavelength; fitting and normalizing absorbance at the characteristic peak to obtain temperature dependence forming coefficients at different pH values and ion strengths, grouping the temperature dependence forming coefficients, and performing transposition treatment to obtain an ion strength dependence forming coefficient and a pH dependence forming coefficient; a single variable is fixed, and a temperature correlation phase diagram, a pH correlation phase diagram and an ion strength correlation phase diagram are drawn by utilizing dependency forming coefficients of other two variables, so that the limitation that the existing analysis method cannot reflect the stability of a nucleic acid structure in a complex environment is overcome.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and in particular relates to a nucleic acid phase diagram analysis method based on variable temperature ultraviolet absorption spectroscopy. Background Art

[0002] Nucleic acids include DNA and RNA, which are the carriers of genetic information in organisms. In vivo, they form the basis of nucleic acid chemical biology, and are mainly responsible for the storage, replication, transcription, and translation of genetic material. In vitro, nucleic acid bionanotechnology uses the programmability of nucleic acids to construct precise nanostructures, which are applied to biosensors and drug delivery systems. In addition, nucleic acid detection and nucleic acid drugs are also of great significance for epidemic prevention and control and disease treatment.

[0003] In addition to the typical right-handed double helix structure, DNA also has a variety of secondary structures, such as Z-type DNA, Holliday structure, triplex, G-quadruplex and i-motif structure. The secondary structure of DNA is sensitive to temperature and ionic strength, and some secondary structures (triplet and i-motif structures) are highly sensitive to pH.

[0004] Studying the stability of nucleic acids will help improve the efficacy of nucleic acid drugs, extend their shelf life, optimize their delivery systems, and promote technological innovation and interdisciplinary development. It is essential to ensuring the effectiveness and safety of nucleic acids in medical treatment, scientific research, and environmental monitoring.

[0005] At present, the effects of temperature, ionic strength and pH on nucleic acid stability are mostly studied separately, lacking a systematic evaluation of nucleic acid stability under complex environments using comprehensive means. Therefore, the present invention proposes a nucleic acid phase diagram analysis method based on variable temperature absorption spectroscopy, which is used to characterize the stability of nucleic acids under complex environments. Summary of the invention

[0006] In view of the technical problems existing in the above-mentioned prior art, the present invention provides a nucleic acid phase diagram analysis method based on variable temperature ultraviolet absorption spectroscopy.

[0007] In order to achieve the above object, the present invention is implemented by the following method: a nucleic acid phase diagram analysis method based on variable temperature ultraviolet absorption spectroscopy, the method comprising the following steps:

[0008] (1) preparing buffer solutions with different gradient pH-ionic strength combinations;

[0009] (2) mixing the target structure with the buffer solution prepared in step (1), performing an annealing and melting procedure, and continuously collecting ultraviolet absorption spectrum data, i.e., recording the data of temperature and absorbance changes over time in the wavelength range of 220-335 nm;

[0010] (3) matching the data of temperature and absorbance variation with time in the wavelength range of 220-335 nm according to time to obtain the data of absorbance variation with temperature of the target structure at all wavelengths;

[0011] (4) The absorbance at the characteristic peak is fitted and normalized as the temperature-dependent formation coefficient θ of the target structure at different pH and ionic strength. T , the temperature dependence of different pH and ionic strength is formed into coefficient θ T The set constitutes the temperature-dependent formation data under the full gradient of pH-ionic strength;

[0012] (5) According to the ionic strength gradient, the temperature-dependent formation coefficients under different pH conditions are grouped according to the fixed ionic strength conditions, and then the ionic strength-dependent formation coefficients θi are obtained by transposition. Similarly, according to the pH gradient, the temperature-dependent formation coefficients under different ionic strength conditions are grouped according to the fixed pH conditions, and then the pH-dependent formation coefficients θi are obtained by transposition. pH ;

[0013] (6) pH, ionic strength, and temperature are taken as three variables that affect the target structure dependence formation coefficient. The temperature dependence formation coefficient θ T , pH-dependent formation coefficient θ pH , the ionic strength dependence formation coefficient θi, and a single variable is fixed. The temperature-dependent phase diagram, pH-dependent phase diagram, and ionic strength-dependent phase diagram are drawn using the dependence formation coefficients of the other two variables. This means that the structural sensitivity of the target structure under complex conditions can be analyzed.

[0014] Furthermore, in step (2), the target structure is an i-motif DNA structure that is simultaneously sensitive to pH, temperature, and ionic strength.

[0015] Furthermore, the i-motif DNA structure is Tel21c, the sequence thereof is CCCTAACCCTAACCCTAACCC, and the characteristic peak in step (4) is 295 nm.

[0016] Furthermore, the buffer solution described in step (1) is a Britton-Robinson buffer solution with broad-spectrum buffering capacity, with a pH coverage range of 2.0-12.0, with an interval of 0.15, and an ionic strength coverage range of 0.01 to 1.0 M, which are 0.01, 0.02, 0.05, 0.075, 0.1, 0.15, 0.2, 0.3, 0.5, and 1 M, respectively. Different pH and ionic strength combinations obtain buffer solutions with different gradient pH-ionic strength combinations.

[0017] Furthermore, step (2) is specifically as follows: adding a mixture of the target structure and a buffer solution of different gradient pH-ionic strength combinations to a quartz cuvette with a sealing cover, sealing and placing it in a UV-visible spectrophotometer sample cell, using a circulating water bath temperature control system to control the temperature change rate of the sample cell, maintaining it at 95°C for 5-10 minutes, and performing an annealing and melting program of 95°C-5°C-95°C, with a temperature change rate of 0.1-0.5°C / min. During the entire annealing and melting program, the UV absorption spectrum changes at 220-335nm are continuously collected, the scanning speed is 1200nm / min, the scanning interval is 3nm, and the total scanning time is 825min.

[0018] Furthermore, in step (6), the ionic strength is fixed and the ionic strength dependence formation coefficient under different pH and temperature conditions is plotted to obtain an ionic strength-related phase diagram; the pH is fixed and the pH dependence formation coefficient under different ionic strength and temperature conditions is plotted to obtain a pH-related phase diagram; the temperature is fixed and the temperature dependence formation coefficient under different pH and ionic strength conditions is plotted to obtain a temperature-related phase diagram.

[0019] Furthermore, for the temperature dependence formation coefficient θ T , take θ T = 0.5 as the temperature denaturation midpoint T under different pH and ionic strength conditions. m , used to analyze the temperature stability of the target structure in complex environments;

[0020] For pH dependence the formation coefficient θ pH , take θ pH = 0.5 as the pH of the denaturation midpoint under different ionic strength and temperature conditions T , used to analyze the acid-base stability of the target structure in complex environments;

[0021] For the ionic strength dependence formation coefficient θi, the ionic strength corresponding to θi=0.5 is taken as the midpoint of ionic strength denaturation under different pH and temperature conditions, reflecting the corresponding ionic strength when the target structure is denatured, and is used to analyze the ionic strength stability of the target structure under complex conditions.

[0022] The present invention has the following beneficial effects: the present invention proposes for the first time a nucleic acid phase diagram analysis method based on variable temperature absorption spectroscopy. Compared with the existing experimental methods for analyzing DNA secondary structure, the present invention can accurately reveal the entire process of DNA structure change through full spectrum scanning by UV-visible spectrophotometer; the designed series of annealing and melting experiments, data processing and phase diagram drawing methods of pH gradient and ionic strength combination overcome the limitation of the existing analysis methods that cannot reflect the stability of nucleic acid structure under complex environment. The present invention provides a new experimental method for analyzing nucleic acid structure. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 :Schematic diagram of i-motif DNA structure formation in complex environment;

[0024] Figure 2 a. The full spectrum of UV absorption of ai-motif DNA; b. Schematic diagram of converting absorbance into temperature-dependent formation coefficient;

[0025] Figure 3 : Schematic diagram of data grouping and transposition;

[0026] Figure 4 :Panels a, b, and c are the ionic strength-dependent phase diagram, pH-dependent phase diagram, and temperature-dependent phase diagram, respectively;

[0027] Figure 5 : Panels a and b reflect the temperature stability and pH stability of the target structure, respectively. DETAILED DESCRIPTION

[0028] The following is a specific implementation method, which describes the specific implementation methods of the present invention in detail. These specific implementation methods are only for description and are not used to limit the scope or implementation principles of the present invention. The scope of protection of the present invention is subject to the claims, including obvious changes or modifications made on this basis.

[0029] The nucleic acid phase diagram analysis method based on variable temperature ultraviolet absorption spectroscopy is as follows:

[0030] A series of 5mM Britton-Robinson buffer solutions with broad-spectrum buffering capacity were prepared with different pH and ionic strength combinations. The i-motif DNA sequence was dissolved in different buffer solutions to a system concentration of 1μM, vortexed and centrifuged, and then transferred into a quartz cuvette with a sealed lid using a pipette. The sealed cuvette was placed in a UV-visible spectrophotometer sample cell, maintained at 95°C for 5-10 minutes, and then an annealing and melting procedure was performed. The entire annealing and melting procedure was performed using a UV-visible spectrophotometer to collect full spectrum data.

[0031] The primary data obtained from the annealing and melting experiment of the UV-Vis spectrophotometer can be used to analyze the effect of temperature on the structural changes of the target i-motif DNA under different pH and ionic strength, that is, temperature-dependent formation data. The data can be transposed to obtain pH-dependent formation data and ionic strength-dependent formation data.

[0032] Draw phase diagrams: The temperature-dependent formation data are plotted as phase diagrams with formation coefficients of different pH and ionic strength at a fixed temperature. A set of temperature-dependent phase diagrams can be drawn by selecting different temperature conditions. Similarly, a set of pH-dependent phase diagrams and a set of ionic strength-dependent phase diagrams can be obtained. The above three phase diagrams can comprehensively and intuitively reveal the sensitivity of nucleic acid structures under complex conditions.

[0033] Experimental instruments:

[0034] UV-visible spectrophotometer (Cary 60, Agilent), circulating water bath temperature control system (CD-200F, Ulabo Technology Co., Ltd.), small multi-channel temperature measurement and acquisition instrument (1611A, Hefei Zhice Electronics), pH meter (PB-10, Sartorius), air compressor (DA5002DCS, DYNAIR / Dasheng), spiral sealed quartz cuvette (Wuxi Spectral Optics).

[0035] Experimental reagents:

[0036] Potassium chloride (Sigma-Aldrich (Shanghai) Trading Co., Ltd.), potassium hydroxide (Sigma-Aldrich (Shanghai) Trading Co., Ltd.), phosphoric acid (Nanjing Chemical Reagent Co., Ltd.), boric acid (Shanghai Lingfeng Chemical Reagent Co., Ltd.), acetic acid (Nanjing Chemical Reagent Co., Ltd.), hydrochloric acid (Nanjing Chemical Reagent Co., Ltd.), and water used were all deionized water (resistance 18.2 MΩ·cm).

[0037] The DNA was custom-synthesized by Shanghai Shenggong Biotechnology Co., Ltd. and its sequence is as follows:

[0038]

[0039] (1) Prepare samples with different pH and ionic strength

[0040] First, a series of Britton-Robinson buffer solutions with broad-spectrum buffering capacity were prepared (phosphoric acid, acetic acid and boric acid were weighed and dissolved in water, phosphoric acid and acetic acid were pure products, boric acid was solid, and the three acids were weighed according to the results of molar mass and mass fraction calculation, and the final concentrations of the three acids after being dissolved in water were all 5 mM), covering a pH range of 2.0-12.0, with an interval of 0.15, for a total of 67 groups of pH gradients (the pH of the buffer solution was adjusted by adding potassium hydroxide); then different volumes of KCl were added so that each group of pH ion strength covered 0.01 to 1.0 M, namely 0.01, 0.02, 0.05, 0.075, 0.1, 0.15, 0.2, 0.3, 0.5, 1 M, for a total of 10 ion strengths; after different pH and ionic strength combinations, buffer solutions with different gradient pH-ionic strength combinations were obtained, and the total number of buffer solutions was 670 groups. 7 μL of 100 μM Tel21c was dissolved in different buffer solutions with a total volume of 700 μL and a system concentration of 1 μM. The mixture was vortexed and centrifuged.

[0041] (2) Annealing and melting experiments of i-motif DNA at different pH and ionic strengths

[0042] Use a pipette to add the above sample to a quartz cuvette with a capacity of 700μL and a sealed lid. After sealing, place it in the sample pool of the UV-visible spectrophotometer. Use a circulating water bath temperature control system to control the temperature change rate of the sample pool. Keep it at 95℃ for 5-10min, and perform an annealing and melting experiment at 95℃-5℃-95℃. The temperature change rate is 0.1-0.5℃ / min. An external multi-channel acquisition instrument is used to detect the liquid temperature of the sample pool in real time. The changes in the ultraviolet absorption spectrum at 220-335nm are continuously collected during the entire annealing and melting process. The scanning speed is 1200nm / min, the scanning interval is 3nm, and the total scanning time is 825min. The sample pool is continuously connected to stable and dry air to prevent condensation water from appearing on the outer wall of the cuvette at low temperatures and affecting the experimental results.

[0043] (3) Temperature-dependent formation coefficient of i-motif DNA at different pH and ionic strength

[0044] The temperature dependence formation coefficient is directly obtained from the results of the annealing melting experiment. Specifically, after the annealing melting experiment is completed, the data of temperature change over time and the data of absorbance change over time at all wavelengths are obtained ( Figure 2 a) Match the two data by time to obtain the data of the sample's absorbance variation with temperature at all wavelengths, fit and normalize the absorbance at the characteristic peak 295nm in the data of the absorbance variation with temperature at all wavelengths as the temperature dependence formation coefficient θ of the i-motif sequence at different pH and ionic strengths. T, the temperature dependence of different pH and ionic strength is formed into coefficient θ T The experimental process is as follows: Figure 2 As shown in b.

[0045] (4) pH-dependent formation coefficient and ionic strength-dependent formation coefficient

[0046] Temperature dependence coefficient θ of Tel21c at different pH and ionic strength T The pH-dependent formation coefficient θ was obtained by transposing the different grouping methods. pH Specifically, taking a set of ionic strength and pH conditions as an example, the temperature-dependent formation coefficients under different pH conditions are grouped according to the ionic strength gradient under fixed ionic strength conditions (the above 10 ionic strengths can be regarded as 10 sets of ionic strength-dependent data), and one set of data is transposed to obtain the ionic strength-dependent formation coefficient θi (such as Figure 3 Similarly, the temperature-dependent formation coefficients under different ionic strengths were grouped according to the pH gradient under fixed pH conditions, and one group of data was transposed to obtain the pH-dependent formation coefficient θ pH (like Figure 3 b).

[0047] (5) Drawing nucleic acid phase diagram

[0048] Drawing of nucleic acid phase diagrams under three different conditions. Taking the ionic strength-related phase diagram as an example, the phase diagram is drawn with different pH and temperature as the x-axis and y-axis respectively under the fixed ionic strength condition of 150mM; the corresponding θi is the z-axis data. The experimental results are shown in Figure 4 a (the z-axis value is represented by grayscale; the solid line in the figure represents the structural half-formation point of θi=0.5; the dotted line in the figure represents the structural transition point of θi=0.1 and θi=0.9). pH and temperature dependence forming coefficient θ T A set of pH-dependent phase diagrams and a set of temperature-dependent phase diagrams can be drawn respectively. The experimental results are as follows: Figure 4 As shown in b and 4c, as the ionic strength increases, both the acid-base stability and the thermal stability decrease.

[0049] refer to Figure 5 a, For temperature-dependent data, take θ T = 0.5 is the temperature at the turning point of the melting curve, which is recorded as Tm, that is, the pH-dependent Tm data under different ionic strengths, so that the temperature stability of the target structure under complex conditions can be fully analyzed;

[0050] refer to Figure 5 b, For pH-dependent data, take θ pH = 0.5 is the pH corresponding to the midpoint of the target structure's acid-base denaturation, denoted as pH T . That is, the temperature dependence of pH under different ionic strengths T The data can be used to comprehensively analyze the acid-base stability of the target structure under complex conditions.

[0051] The above description is only an embodiment of the present invention, but is not intended to limit the present invention. Those skilled in the art may make possible changes and modifications to the present invention using the technical contents disclosed above without departing from the scope of the technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A method for analyzing nucleic acid phase diagram based on variable temperature ultraviolet absorption spectroscopy, characterized in that: The method comprises the following steps: (1) preparing buffer solutions with different gradient pH-ionic strength combinations; (2) mixing the target structure with the buffer solution prepared in step (1), performing an annealing and melting procedure, and continuously collecting ultraviolet absorption spectrum data, i.e., recording the data of temperature and absorbance changes over time in the wavelength range of 220-335 nm; (3) matching the data of temperature and absorbance variation with time in the wavelength range of 220-335 nm according to time to obtain the data of absorbance variation with temperature of the target structure at all wavelengths; (4) The absorbance at the characteristic peak is fitted and normalized as the temperature-dependent formation coefficient θ of the target structure at different pH and ionic strength. T , the temperature dependence of different pH and ionic strength is formed into coefficient θ T The collection constitutes the temperature-dependent formation data under the full gradient of pH-ionic strength; (5) According to the ionic strength gradient, the temperature-dependent formation coefficients under different pH conditions are grouped according to the fixed ionic strength conditions, and then the ionic strength-dependent formation coefficients θi are obtained by transposition. Similarly, according to the pH gradient, the temperature-dependent formation coefficients under different ionic strength conditions are grouped according to the fixed pH conditions, and then the pH-dependent formation coefficients θi are obtained by transposition. pH ; (6) pH, ionic strength, and temperature are taken as three variables that affect the target structure dependence formation coefficient. The temperature dependence formation coefficient θ T , pH-dependent formation coefficient θ pH , the ionic strength dependence formation coefficient θi, and a single variable is fixed. The temperature-dependent phase diagram, pH-dependent phase diagram, and ionic strength-dependent phase diagram are drawn using the dependence formation coefficients of the other two variables. This means that the structural sensitivity of the target structure under complex conditions can be analyzed.

2. The method for analyzing nucleic acid phase diagram based on variable temperature ultraviolet absorption spectroscopy according to claim 1, characterized in that: In step (2), the target structure is an i-motif DNA structure that is sensitive to pH, temperature, and ionic strength.

3. The nucleic acid phase diagram analysis method based on variable temperature ultraviolet absorption spectroscopy according to claim 2, characterized in that: The i-motif DNA structure is Tel21c, and its sequence is CCCTAACCCTAACCCTAACCC. The characteristic peak in step (4) is 295 nm.

4. The method for analyzing nucleic acid phase diagram based on variable temperature ultraviolet absorption spectroscopy according to claim 1, characterized in that: The buffer solution described in step (1) is a Britton-Robinson buffer solution with broad-spectrum buffering capacity, with a pH coverage range of 2.0-12.0, with an interval of 0.15, and an ionic strength coverage range of 0.01 to 1.0 M, which are 0.01, 0.02, 0.05, 0.075, 0.1, 0.15, 0.2, 0.3, 0.5, and 1 M, respectively. Different pH and ionic strength combinations obtain buffer solutions with different gradient pH-ionic strength combinations.

5. The method for analyzing nucleic acid phase diagram based on variable temperature ultraviolet absorption spectroscopy according to claim 1, characterized in that: Step (2) is specifically as follows: adding a target structure and a buffer solution mixture of different gradient pH-ionic strength combinations into a quartz cuvette with a sealing cover, sealing and placing the mixture in a UV-visible spectrophotometer sample cell, using a circulating water bath temperature control system to control the temperature change rate of the sample cell, maintaining the temperature at 95°C for 5-10 minutes, and performing an annealing and melting program of 95°C-5°C-95°C, with a temperature change rate of 0.1-0.5°C / min. During the entire annealing and melting program, the UV absorption spectrum changes at 220-335nm are continuously collected, the scanning speed is 1200nm / min, the scanning interval is 3nm, and the total scanning time is 825min.

6. The method for analyzing nucleic acid phase diagram based on variable temperature ultraviolet absorption spectroscopy according to claim 1, characterized in that: In step (6), the ionic strength is fixed and the ionic strength dependence formation coefficient under different pH and temperature conditions is plotted to obtain an ionic strength-related phase diagram; the pH is fixed and the pH dependence formation coefficient under different ionic strength and temperature conditions is plotted to obtain a pH-related phase diagram; the temperature is fixed and the temperature dependence formation coefficient under different pH and ionic strength conditions is plotted to obtain a temperature-related phase diagram.

7. The method for analyzing nucleic acid phase diagram based on variable temperature ultraviolet absorption spectroscopy according to claim 1, characterized in that: For the temperature dependence of the formation coefficient θ T , take θ T = 0.5 as the temperature denaturation midpoint T under different pH and ionic strength conditions. m , used to analyze the temperature stability of the target structure in complex environments; For pH dependence the formation coefficient θ pH , take θ pH = 0.5 as the pH of the denaturation midpoint under different ionic strength and temperature conditions T , used to analyze the acid-base stability of the target structure in complex environments; For the ionic strength-dependent formation coefficient θi, the ionic strength corresponding to θi=0.5 is taken as the midpoint of ionic strength denaturation under different pH and temperature conditions, which is used to analyze the ionic strength stability of the target structure under complex conditions.

Images