Cytochrome P450BM3 mutant and application thereof in synthesis of 2-hydroxy-1, 8-cineole

Abstract

The invention discloses a cytochrome P450BM3 mutant and application of the cytochrome P450BM3 mutant in high-selectivity oxidation of 1, 8-cineole to generate 2-hydroxy-1, 8-cineole, and the mutant is obtained by replacing at least one amino acid in the 171st site, the 87th site, the 307th site and the 437th site of an amino acid sequence shown as SEQ ID No.1; the amino acid sequence is mutated into alanine Ala, the 171st site histidine His mutated into leucine Leu, the 87th site phenylalanine Phe mutated into alanine Ala, the 307th site glutamine Gln mutated into histidine His, and the 437th site leucine Leu mutated into valine Val. According to the present invention, by carrying out mutation on the active site of the cytochrome P450BM3, the P450BM3 mutant capable of highly selectively oxidizing 1, 8-cineole to generate 2-hydroxy-1, 8-cineole is finally obtained;

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering and genetic engineering, and in particular to a cytochrome P450BM3 mutant and application thereof in synthesizing 2-hydroxy-1,8-cineole. Background Art

[0002] 1,8-cineole is a class of bicyclic monoterpene compounds. 1,8-cineole has a special scent of camphor and herbs and is often used as a flavor. In addition, 1,8-cineole has been shown to be involved in regulating pharmacological activities such as the Nrf2 signaling pathway. It can be used to treat a variety of diseases such as scabies, digestive system, respiratory system and neurodegenerative diseases, and is widely used in the fields of medicine, food and cosmetics. 2-Hydroxy-1,8-cineole, as the main metabolite of 1,8-cineole, can be developed into a value-added chemical with potential application value to solve the problems of environmental pollution and waste of natural resources generated during the production of 1,8-cineole.

[0003] One feasible strategy is to convert consumed biomass energy or waste into industrially relevant raw materials or value-added compounds through microbial fermentation, so as to achieve the production purpose of reduction, regeneration and reuse. For example, 1,8-cineole can be converted into two new aromatic compounds, 2-hydroxy-1,8-cineole and 2-carbonyl-1,8-cineole, by inoculating mushrooms such as oyster mushrooms with eucalyptus leaves for extracting essential oils as a matrix. Although this waste utilization strategy shows certain application prospects, the product's heterogeneity and the difficulty of separation and production cost caused by low yield limit the application scenarios of microbial fermentation. How to selectively produce 2-hydroxy-1,8-cineole and improve production efficiency is of great practical significance. Summary of the invention

[0004] Purpose of the invention: The first purpose of the present invention is to solve the problems of poor regioselectivity, non-single product and low catalytic efficiency in the process of cytochrome P450BM3 oxidation of 1,8-cineole, by directed evolution of the amino acids in the substrate binding pocket of cytochrome P450BM3, to achieve highly selective oxidation of 1,8-cineole by cytochrome P450BM3 to obtain a cytochrome P450BM3 mutant of 2-hydroxy-1,8-cineole; The second purpose of the present invention is to provide an application of the cytochrome P450BM3 mutant in the highly selective oxidation of 1,8-cineole to synthesize 2-hydroxy-1,8-cineole.

[0005] Technical solution: The cytochrome P450BM3 mutant described in the present invention is a mutant in which at least one amino acid is replaced in the four positions of position 171, position 87, position 307 and position 437 of the amino acid sequence shown in SEQ ID No.1; the histidine His at position 171 is mutated to leucine Leu, the phenylalanine Phe at position 87 is mutated to alanine Ala, the glutamine Gln at position 307 is mutated to histidine His, and the leucine Leu at position 437 is mutated to valine Val.

[0006] The wild-type cytochrome P450BM3 is an enzyme corresponding to PDB ID: 1FAG, originates from Bacillus megaterium, has an amino acid sequence of SEQ ID NO.1, and a gene sequence of SEQ ID NO.2.

[0007] Preferably, the mutants include H171L, H171L / F87A, H171L / F87A / Q307H or H171L / F87A / Q307H / L437V.

[0008] The mutant H171L, that is, the histidine His at position 171 is mutated to leucine Leu.

[0009] The mutant H171L / F87A, that is, the histidine His at position 171 is mutated to leucine Leu, and the phenylalanine Phe at position 87 is mutated to alanine Ala.

[0010] In the mutant H171L / F87A / Q307H, the histidine His at position 171 is mutated to leucine Leu, the phenylalanine Phe at position 87 is mutated to alanine Ala, and the glutamine Gln at position 307 is mutated to histidine His.

[0011] In the mutant H171L / F87A / Q307H / L437V, the histidine His at position 171 is mutated to leucine Leu, the phenylalanine Phe at position 87 is mutated to alanine Ala, the glutamine Gln at position 307 is mutated to histidine His, and the leucine Leu at position 437 is mutated to valine Val.

[0012] The coding gene of the cytochrome P450BM3 mutant of the present invention is obtained by the following method: using the recombinant plasmid pET22b-P450BM3 derived from the wild-type cytochrome P450BM3 gene of Bacillus megaterium as a template, using site-directed mutagenesis primers to perform PCR amplification, and screening the target mutant gene.

[0013] The gene described in the present invention is: a gene encoding the cytochrome P450BM3 mutant protein described in the present invention.

[0014] The recombinant plasmid described in the present invention is: a recombinant plasmid containing the gene described in the present invention.

[0015] Preferably, the expression vector of the recombinant plasmid is a PET series expression vector.

[0016] The recombinant bacteria of the present invention carry the gene of the mutant or the recombinant plasmid.

[0017] Preferably, the host is Escherichia coli.

[0018] The method for constructing the recombinant bacteria comprises the following steps:

[0019] (1) Construction of recombinant plasmid pET22b-P450BM3: connecting the cytochrome P450BM3 gene P450BM3 with the enzyme-cut plasmid pET22b to obtain the recombinant expression vector pET22b-cytochrome P450BM3;

[0020] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-P450BM3: The constructed recombinant expression vector pET22b-P450BM3 was thermally transferred into competent E. coli BL21(DE3), and the recombinant E. coli BL21(DE3) / pET22b-P450BM3 was obtained by culture and screening.

[0021] The invention discloses an application of the cytochrome P450BM3 mutant, the recombinant plasmid or the recombinant bacteria in highly selectively oxidizing 1,8-cineole to generate 2-hydroxy-1,8-cineole.

[0022] The application comprises the following steps: using a cytochrome P450BM3 mutant as a catalyst and 1,8-cineole as a substrate, highly selectively catalytically oxidizing the 2nd position to generate 2-hydroxy-1,8-cineole. The catalytic process is as follows:

[0023]

[0024] Preferably, the reaction temperature of the catalytic oxidation is 25-35°C and the pH is 6-8.

[0025] Invention mechanism: After in-depth and extensive research, the present invention provides a cytochrome P450BM3 and its preparation method and application. Specifically, by amplifying the cytochrome P450BM3 gene from Bacillus megaterium and using rational design to perform directed evolution transformation on it, a cytochrome P450BM3 mutant with improved regioselectivity for 1,8-cineole oxidation was finally obtained, thereby achieving efficient synthesis of 2-hydroxy-1,8-cineole.

[0026] In the present invention, the sequence and structural information of the publicly reported cytochrome P450BM3 are used, and non-redundant search is performed in databases such as NCBI, and some potential enzyme genes are screened out according to the principles of protein structure similarity, conservative site analysis and host source diversity. These genes are functionally expressed in an Escherichia coli expression system and then purified to obtain a pure enzyme. The preferred cytochrome P450BM3 is derived from Bacillus megaterium, which has certain catalytic activity and can catalyze the oxidation reaction of 1,8-cineole.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) by mutating the active site of cytochrome P450BM3, the mutant finally obtained improves the selectivity and catalytic efficiency in the biocatalytic reaction of oxidizing 1,8-cineole to 2-hydroxy-1,8-cineole; (2) the catalytic efficiency of the mutant H171L / F87A / Q307H / L437V is 96%, and the selectivity ratio of 2-hydroxy-1,8-cineole is as high as 9.3:1. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The diagrams are the yield and selectivity effect of highly selective oxidation of 1,8-cineole by the cytochrome P450BM3 mutants of Examples 1 to 4;

[0029] Figure 2 The NMR spectrum of the product 2-hydroxy-1,8-cineole produced by the highly selective oxidation of 1,8-cineole by the cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V);

[0030] Figure 3 The mass spectrum of the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by the cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V);

[0031] Figure 4This is a kinetic experimental diagram of the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by a cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V);

[0032] Figure 5 This is the Michaelis-Menten kinetic parameter diagram for the highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by the cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V). DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described below in conjunction with embodiments.

[0034] Example 1

[0035] 1. Construction of cytochrome P450BM3 mutant plasmid

[0036] (1) Obtaining pET22b-P450BM3

[0037] The wild-type gene of cytochrome P450BM3 from Bacillus megaterium was synthesized by Jinweizhi (Suzhou) Company and constructed on the pET22b vector (the pET22b vector was provided by Jinweizhi Company), and the vector was transformed into the E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and the recombinant bacteria E. coli DH5α / pET22b-P450BM3 was inoculated into a 5mL test tube containing culture medium and cultured at 37°C and 220rpm for 12h. After the culture, the bacteria were centrifuged at 12,000rpm for 1min and the cells were collected. The plasmid was extracted from E. coli DH5α / pET22b-P450BM3 using a high-purity plasmid mini-extraction kit as a template for iterative mutation, and the plasmid pET22b-P450BM3 mutant was constructed.

[0038] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-P450BM3 mutant

[0039] The gene mutation was carried out by whole plasmid PCR method to obtain the target mutant gene. The required primers were specifically designed using H171L as an example. Other mutants were designed using this principle and single-point iterative mutation was performed.

[0040] H171L upstream primer: GATCAGCCTCTTCCATTTATTACAAG

[0041] H171L downstream primer: CTTGTAATAAATGGAAGAGGCTGATC

[0042] The PCR system is shown in Table 1.

[0043] Table 1 PCR reaction system

[0044]

[0045] The PCR reaction conditions are shown in Table 2.

[0046] Table 2 PCR reaction conditions

[0047]

[0048] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0049] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into E.coliDH5α competent cells, spread on the surface of LB solid culture medium containing 100μg / mL ampicillin, cultured at 37℃ for 12h, picked a single colony to LB liquid culture, identified the successfully constructed positive transformant by PCR, and verified the correctness of the mutation site by sequencing. After verification, a part of it was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80℃ for use, and a part of the bacteria was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20℃ refrigerator.

[0050] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) (E. coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-P450BM3.

[0051] 2. Cultivation of cytochrome P450BM3 mutant and preparation of crude enzyme solution

[0052] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-P450BM3 was spread on a plate containing ampicillin at a final concentration of 100 μg / mL, and a single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured at 37 ° C and 200 rpm / min overnight. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance and the OD was 0. 600 When the p-value reached about 0.6, IPTG and 0.3 mM δ-aminolevulinic acid (δ-ALA) were added at a final concentration of 0.04 mM and induced at 18°C ​​for about 36 h.

[0053] After obtaining the bacterial cells by centrifugation, resuspend them with buffer, break the cells by ultrasonication in an ice bath (working for 2s, interval for 5s, working time for 30min), and centrifuge at 12,000rpm / min for 20min at 4°C. After collecting the supernatant, filter it through a 0.22μm water filter to obtain the crude enzyme solution. Take 200μL of the supernatant to determine the P450 concentration, and add 200mM potassium phosphate buffer with pH=7.5 to dilute it to a P450 concentration of 5μM.

[0054] Example 2

[0055] The H171L / F87A mutant was prepared based on Example 1. The plasmid obtained in Example 1 was used as the DNA template in step (2). The primers were changed and the other conditions remained unchanged. The primers were as follows:

[0056] H171L / F87A upstream primer: GACGGGTTAGCGACAAGCTGGACGC

[0057] H171L / F87A downstream primer: GCGTCCAGCTTGTCGCTAACCCGTC.

[0058] Example 3

[0059] The H171L / F87A / Q307H mutant was prepared based on Example 1, using the plasmid obtained in Example 2 as the DNA template in step (2), changing the primers, and keeping the other conditions unchanged. The primers are as follows:

[0060] H171L / F87A / Q307H upstream primer

[0061] CCAAGCTACAAACATGTCAAACAGCTTAAATATG

[0062] H171L / F87A / Q307H downstream primers

[0063] CATATTTAAGCTGTTTGACATGTTTTGTAGCTTGG.

[0064] Example 4

[0065] The H171L / F87A / Q307H / L437V mutant was prepared based on Example 1, using the plasmid obtained in Example 3 as the DNA template in step (2), changing the primers, and keeping the other conditions unchanged. The primers are as follows:

[0066] H171L / F87A / Q307H / L437V upstream primer:

[0067] GGATATTAAAGAAACTGTGACGTTAAAACCTG

[0068] H171L / F87A / Q307H / L437V downstream primers:

[0069] CAGGTTTTAACGTCACAGTTTCTTTAATATCC.

[0070] Performance Testing

[0071] 1. Cytochrome P450BM3 and its mutants highly selectively oxidize 1,8-cineole

[0072] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Examples 1 to 4 and the obtained crude enzyme solution was used as a catalyst.

[0073] The reaction system is: 5 μM protein concentration of crude enzyme solution, 1 mM 1,8-cineole, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer at pH = 7.5. The reaction temperature was controlled at 30°C in a water bath with magnetic stirring for 60 min.

[0074] Add an equal volume of ethyl acetate to the reaction solution, shake at 400 rpm for 10 minutes, and shake thoroughly. Centrifuge at 10000 rpm for 10 minutes. Take the upper ethyl acetate phase and use GC for detection. The GC analysis method is: chromatographic column Agilent CycloSil-B (30m×250μm×0.25μm); the operating program is to increase the temperature from 60℃ to 240℃ within 3.6 minutes, and keep it at 240℃ for 4 minutes.

[0075] The test results are shown in Table 3 and Figure 1 .

[0076] Table 3 Highly selective oxidation of 1,8-cineole by cytochrome P450BM3 and its mutants

[0077]

[0078] Depend on Figure 1 It can be seen that the catalytic conversion rates of all mutants are higher than that of wild-type cytochrome P450BM3, especially the mutant H171L / F87A / Q307H / L437V, which has a catalytic efficiency of 96% and an oxidation product selectivity ratio of up to 9.3:1.

[0079] 2. Characterization and verification of the physicochemical properties of the cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V) that highly selectively oxidizes 1,8-cineole to produce 2-hydroxy-1,8-cineole

[0080] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Example 4 and the obtained crude enzyme solution was used as a catalyst.

[0081] The reaction system is: 5 μM protein concentration of crude enzyme solution, 1 mM 1,8-cineole, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer at pH = 7.5, and the reaction was scaled up to 100 mL of reaction system. The reaction temperature was controlled at 30°C by water bath, and the reaction was terminated by magnetic stirring for 60 min.

[0082] After the reaction was completed, 100 mL of ethyl acetate was added for extraction and the extraction was repeated three times, and the mixture was washed once with a saturated sodium chloride solution. The organic phase was dried over anhydrous sodium sulfate, concentrated by rotary evaporation, and purified by column chromatography to obtain a selective oxidation product.

[0083] Property characterization: The NMR instrument model is 600MHz Bruker AVANCE III-600; the LCMS model is GCMS-QP2020 NX, and the chromatographic column is Rtx-5MS (30m×250μm×0.25μm).

[0084] NMR results are shown in Figure 2 , which is consistent with the NMR results of 2-hydroxy-1,8-cineole reported in the relevant literature (ChemPlusChem 2014, 79, 634–655); GCMS results are shown in Figure 3 , which is consistent with the mass spectrometry results of 2-hydroxy-1,8-cineole reported in the relevant literature (Folia Microbiol 2016, 61, 149–157). In summary, it can be confirmed that the product of cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V) highly selectively oxidizing 1,8-cineole is 2-hydroxy-1,8-cineole.

[0085] 3. Kinetics of highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V)

[0086] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Example 4 and the obtained crude enzyme solution was used as a catalyst.

[0087] The reaction system is: 5 μM protein concentration of crude enzyme solution, 1 mM 1,8-cineole, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer at pH = 7.5. The reaction temperature was controlled at 30°C by water bath, and magnetic stirring was performed to terminate the reaction at 0.5 min, 1 min, 2 min, 5 min, 10 min, 15 min, 20 min, 30 min, and 60 min.

[0088] Add an equal volume of ethyl acetate to the reaction solution, oscillate at 400 rpm for 10 minutes, and shake thoroughly. Centrifuge at 10000 rpm for 10 minutes. Take the upper ethyl acetate phase and use GC for detection. The GC analysis method is: chromatographic column Agilent CycloSil-B (30m×250μm×0.25μm); the operating program is to increase the temperature from 60℃ to 240℃ within 3.6 minutes, and keep at 240℃ for 4 minutes. The kinetic curve of the highly selective synthesis of 2-hydroxy-1,8-cineole by the obtained cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V) is shown in Figure 4 .

[0089] Depend on Figure 4 It can be seen that as the reaction proceeds, the concentration of 2-hydroxy-1,8-cineole product gradually increases, and the yield reaches 96% at 60 min.

[0090] 4. Determination of Michaelis-Menten kinetic parameters for highly selective oxidation of 1,8-cineole to 2-hydroxy-1,8-cineole by cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V)

[0091] The corresponding engineered bacteria expressing cytochrome P450BM3 and its mutants were cultured according to the construction of Example 4 and the obtained crude enzyme solution was used as a catalyst.

[0092] The reaction system is: 5 μM protein concentration of crude enzyme solution, 100 mM glucose, 5 mg / mL glucose dehydrogenase, 80 μM NADP + The reaction buffer was 200 mM potassium phosphate buffer at pH = 7.5, and the concentrations of the substrate 1,8-cineole were 1 mM, 1.5 mM, 2 mM, and 5 mM, respectively. The reaction temperature was controlled at 30°C by water bath, and magnetic stirring was applied. The reaction was terminated after 1 min of reaction.

[0093] Add an equal volume of ethyl acetate to the reaction solution, oscillate at 400rpm for 10min, and shake thoroughly. Centrifuge at 10000rpm for 10min. Take the upper ethyl acetate phase and use GC detection. The GC analysis method is: chromatographic column Agilent CycloSil-B (30m×250μm×0.25μm); the operating program is to increase the temperature from 60℃ to 240℃ within 3.6min, and maintain at 240℃ for 4min. Determine the enzyme reaction rate, and draw a double reciprocal curve based on the reciprocal of the reaction rate and substrate concentration, and calculate the Michaelis-Menten kinetic parameters. The test results are shown in Figure 5 .

[0094] Depend on Figure 5 The Michaelis-Menten kinetic parameters for the highly selective synthesis of 2-hydroxy-1,8-cineole by the cytochrome P450BM3 mutant (H171L / F87A / Q307H / L437V) were K m =1.1mM, K cat =13.4s -1 .

Claims

1. A cytochrome P450BM3 mutant, characterized in that: The mutant is a mutant in which at least one amino acid is replaced in the four positions of position 171, position 87, position 307 and position 437 of the amino acid sequence shown in SEQ ID No.1; the histidine His at position 171 is mutated to leucine Leu, the phenylalanine Phe at position 87 is mutated to alanine Ala, the glutamine Gln at position 307 is mutated to histidine His, and the leucine Leu at position 437 is mutated to valine Val.

2. The cytochrome P450BM3 mutant according to claim 1, characterized in that: The mutants include H171L, H171L / F87A, H171L / F87A / Q307H or H171L / F87A / Q307H / L437V.

3. A gene encoding the cytochrome P450BM3 mutant protein according to any one of claims 1 to 2.

4. A recombinant plasmid containing the gene according to claim 3.

5. The recombinant plasmid according to claim 4, characterized in that: The expression vector of the recombinant plasmid is a PET series expression vector.

6. A recombinant bacterium carrying the gene of the mutant according to claim 3 or the recombinant plasmid according to claim 4.

7. The recombinant bacterium according to claim 6, characterized in that: The host is Escherichia coli.

8. Use of the cytochrome P450BM3 mutant according to claim 1 or 2, the recombinant plasmid according to claim 4, or the recombinant bacteria according to claim 6 in highly selective oxidation of 1,8-cineole to produce 2-hydroxy-1,8-cineole.

9. The use according to claim 8, characterized in that: The application comprises the following steps: using a cytochrome P450BM3 mutant as a catalyst and 1,8-cineole as a substrate, and highly selectively catalyzing and oxidizing position 2 to generate 2-hydroxy-1,8-cineole.

10. The use according to claim 9, characterized in that: The reaction temperature of the catalytic oxidation is 25-35°C, and the pH is 6-8.

Images