Preparation method of high-purity circular RNA (Ribonucleic Acid)

Abstract

The invention discloses a preparation method of high-purity circular RNA (Ribonucleic Acid). The preparation method comprises the following steps: constructing a cyclization skeleton sequence with self-splicing activity; the cyclization skeleton sequence comprises the following modular elements from the 5'end to the 3 'end: a T7 promoter, a 5'-terminal homologous fragment, a 3 'intron-exon fragment, a 5'-internal homologous fragment, a 5 '-terminal spacer sequence, an IRES sequence, a target fragment, a 3'-terminal spacer sequence, a 3 '-internal homologous fragment, an exon fragment-5' intron, a 3 '-terminal homologous fragment and an Xba I endonuclease site; inserting the cyclized skeleton sequence into a pUC57 vector, and carrying out plasmid amplification; an Xba I incision enzyme linearization vector is utilized to obtain an in-vitro amplification template; the method comprises the following steps: carrying out an in-vitro amplification reaction by using dsRNA-free T7RNA polymerase to obtain dsRNA-free precursor RNA; cyclizing the precursor RNA to obtain crude circular RNA; treating the crude circular RNA by utilizing poly (A) or poly (U) polymerase, and adding poly (A) or poly (U) long tails to linear RNA in the crude circular RNA; and purifying by using an affinity chromatography column to obtain the high-purity circular RNA.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a method for preparing high-purity circular RNA. Background Art

[0002] Engineered circular RNA (circRNA) is an emerging class of RNA molecules that have a molecular form different from linear mRNA. Its head and tail are connected by a 3'-5' phosphodiester bond to form a ring. Since there are no free hydroxyl groups exposed in its molecules, circular RNA has stronger stability in cells than linear RNA molecules. If the circular RNA molecule sequence contains an internal ribosome entry site (IRES) and a coding sequence (CDS), the target protein can be efficiently expressed in mammals. Therefore, circular RNA is considered to be an emerging RNA drug molecule.

[0003] There are many methods for preparing circular RNA, such as chemical synthesis, nucleic acid ligase synthesis, and ribozyme self-splicing synthesis. The most widely used method is to use type I or type II introns, design them into permuted introns and exons (PIE) structures, and use the ribozyme activity of introns to obtain circular RNA through self-splicing. The circular RNA preparation process of this method is similar to that of traditional linear mRNA. First, the template sequence of circular RNA is designed downstream of the T7 promoter. Generally, it is necessary to include a group of intron fragments, which include 3' splicing site dinucleotides, internal ribosome entry sites (IRES), 5' and 3' homology arms, 5' and 3' UTR sequences and protein coding sequences. Then, through the in vitro transcription (IVT) process, the precursor of circular RNA is obtained, GTP is added to the system, and the reaction temperature is raised to 55°C for RNA cyclization to obtain circular RNA.

[0004] However, the obtained circular RNA is a mixture, which includes a variety of linear RNA impurities, such as short dsRNA, uncircularized precursor RNA, cut intron RNA, nicked cirRNA and other incorrectly cut RNA. These impurities must be removed through additional purification steps to obtain pure circular RNA for biomedicine.

[0005] There are currently many methods for the purification of circular RNA. For example, dsRNA can be removed by directly eliminating its production in the IVT step. The main methods include adding urea or chaotropic salt to the IVT system, increasing the IVT reaction temperature, or directly using dsRNA-free T7 RNA polymerase. There are also many methods for removing other impurities.

[0006] Using RNase R to degrade linear RNA is a common and simple method. However, while RNase R degrades linear RNA, it can often also degrade some circular RNA. Therefore, this method requires exploring the ratio of enzyme to RNA and the reaction time. In addition, since the designed engineered circular RNA sequences often contain special structures that prevent RNase R from degrading linear RNA, this method cannot obtain highly pure circular RNA.

[0007] The use of size exclusion chromatography (SEC) to purify circular RNA is also a common method for preparing circular RNA in large quantities. This method requires the use of chromatographic fillers with large pore sizes, such as SRT-SEC-1000 chromatographic fillers from Saifen Technology, which has been widely used. This method can perform well when separating impurities with large molecular weight differences, such as the removal of introns; but it performs poorly when separating molecules with small molecular weight differences, such as circular RNA with a gap. This impurity molecule has the same sequence and molecular weight as the target circular RNA, and its yield is very low. In addition, the amount of sample loaded in this method is limited, so this method is difficult to apply to large-scale production.

[0008] Compared with the molecular exclusion method, the use of reversed-phase high-performance liquid chromatography (RP-HPLC) for circular RNA purification has certain advantages, such as improved resolution and large-scale production due to large sample loading, but it still cannot separate nicked RNA well and has a low yield. In addition, this method uses toxic organic reagents, and its products are difficult to apply to biomedicine.

[0009] Therefore, the inability to obtain high-purity circular RNA has seriously affected its industrial application. Summary of the invention

[0010] In view of this, some embodiments disclose a method for preparing high-purity circular RNA, comprising the steps of:

[0011] S1. Construct a circularized backbone sequence with self-splicing activity; the circularized backbone sequence comprises the following modular elements from the 5' end to the 3' end: T7 promoter, 5' end homologous fragment, 3' intron-exon fragment, 5' internal homologous fragment, 5' end spacer sequence, IRES sequence, target fragment, 3' end spacer sequence, 3' internal homologous fragment, exon fragment-5' intron, 3' end homologous fragment, Xba I endonuclease cleavage site;

[0012] S2, inserting the circularized backbone sequence into the pUC57 vector for plasmid amplification;

[0013] S3, extract the plasmid, use Xba I endonuclease to linearize the vector, and obtain an in vitro amplification template;

[0014] S4, using dsRNA-free T7 RNA polymerase to perform an in vitro amplification reaction to obtain dsRNA-free precursor RNA;

[0015] S5, the precursor RNA is cyclized to obtain a crude circular RNA stock solution; the crude circular RNA stock solution contains circular RNA and linear RNA;

[0016] S6, treating the crude circular RNA stock solution with poly(A) or poly(U) polymerase to add poly(A) or poly(U) long tails to the linear RNA therein;

[0017] S7. Purify the crude circularized RNA stock solution using an affinity chromatography column to separate the linear RNA with added poly(A) or poly(U) long tail from the circular RNA to obtain high-purity circular RNA; the binding groups of the affinity layer filler of the affinity chromatography column include oligo(dT), oligo(dU), oligo(dA), oligo(dAT), oligo(dCT), oligo(dGT), oligo(dAC), oligo(dAG), oligo(dAU), oligo(dCU) or oligo(dGU).

[0018] The method for preparing high-purity circular RNA disclosed in the embodiment of the present invention adds a poly(A) or poly(U) long tail to the end of the impure linear RNA, and uses an affinity chromatography column to effectively separate the circular RNA from the linear RNA, thereby obtaining high-purity circular RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 , a flow chart of the method for preparing high-purity circular RNA;

[0020] Figure 2 , agarose electrophoresis diagram of the circular RNA plasmid template and the linearized plasmid template of Example 1;

[0021] Figure 3 , Agarose electrophoresis diagram of eGFP circular RNA before and after circularization in Example 1;

[0022] Figure 4 Example 1: Using dsRNA antibodies to examine the level of dsRNA in eGFP circular RNA obtained by two T7 RNA polymerase IVTs;

[0023] Figure 5 , Agarose electrophoresis of eGFP circular RNA after poly (A) polymerase tailing treatment in Example 2;

[0024] Figure 6 , Example 2: eGFP circular RNA containing Poly(AC) sequence, after being tailed by Poly(A) polymerase, is purified by Oligo(dT) affinity chromatography; and different elution peaks are collected, and the purity of the circular RNA in the two elution peaks is checked by agarose electrophoresis;

[0025] Figure 7 , the eGFP circular RNA that does not contain Poly(AC) in the sequence of Example 3 is tailed by Poly(A) polymerase and then purified by Oligo(dT) affinity chromatography; after collecting the flow-through peak and the elution peak, the purity of the circular RNA in the flow-through peak and the elution peak is checked by agarose electrophoresis;

[0026] Figure 8 , Comparative Example 1: Circular eGFP RNA was purified by RNase R digestion method. After the same enzyme amount and different digestion time, the purification effect was detected by agarose electrophoresis;

[0027] Fig. 9 , Comparative Example 1: Circular eGFP RNA was purified by RNase R digestion method, and after being treated with different enzyme amounts and different digestion times, agarose electrophoresis was used to detect the purification effect;

[0028] Fig.10 Comparative Example 2: elution peak diagram of circular eGFP RNA purified by HPLC molecular exclusion method and agarose electrophoresis diagram of the corresponding sample;

[0029] Fig.11 , eGFP expression in BV-2 cells 24 hours after being transfected with eGFP circular RNA obtained by three different purification methods in Example 4.

[0030] Sequences disclosed herein:

[0031] The sequence of the pUC57-Kan vector is:

[0032] TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCC

[0033] CGGAGACgGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAA

[0034] GCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCT

[0035] TAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGG

[0036] TGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGC

[0037] CATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGG

[0038] GCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGG

[0039] CGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAA

[0040] ACGACGGCCAGTGAATTCGAGCTCGGTACCTCGCGAATGCATCTAGATA

[0041] TCGGATCCCGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCTTGGCT

[0042] CGAGCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAA

[0043] TTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTG

[0044] CCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGC

[0045] TTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCA

[0046] ACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTcTTCCGCTTCCTCG

[0047] CTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCA

[0048] GCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAAC

[0049] GCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACC

[0050] GTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTG

[0051] ACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCG

[0052] ACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTG

[0053] CGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTC

[0054] TCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCT

[0055] CAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACC

[0056] CCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAG

[0057] TCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGT

[0058] AACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTG

[0059] AAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCT

[0060] GCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGGTGGTAGCTCTT

[0061] GATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCA

[0062] AGCAGCAGATTACGCGCAGAAAAAGGATCTCAAGAAGATCCTTTGA

[0063] TCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG

[0064] GGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTA

[0065] AATTAAAATGAAGTTTTAAATCTAAGTAAGTATATGAGTAAACTTG

[0066] GTCTGACAGTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTT

[0067] ATTCATATCAGGATTCAATACCATTTTTGAAAAAGCCGTTTCTGTA

[0068] ATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCT

[0069] GGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAAT

[0070] TTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTG

[0071] ACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAG

[0072] ACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCAT

[0073] CAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAgACGAAATAC

[0074] GCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCG

[0075] GCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGG

[0076] ATATTCTTCTAATACCTGGAATGCTGTTTTCCCAGGGATCGCAGTGGTG

[0077] AGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGA

[0078] AGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAA

[0079] CATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGC

[0080] ATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACA

[0081] TTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTT

[0082] AATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATACTCT

[0083] TCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGC

[0084] GGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGC

[0085] GCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACATTATTAT

[0086] CATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC;

[0087] The sequence of the T7 promoter is:

[0088] TAATACGACTCACTATAAGG;

[0089] The sequence of the 5' end homology fragment is:

[0090] GGGAGACCCTCGACCGTCGATTGTCCACTGGTC;

[0091] The sequence of the 3' intron-exon fragment is:

[0092] AACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGG

[0093] AGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCA

[0094] AAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA;

[0095] The sequence of the 5' internal homology fragment is:

[0096] CGCCGGAAACGCAATAGCCG;

[0097] The 5' end spacer sequence is:

[0098] AAAAACAAAAAACAAAAAAAACAAAAAAAAAACCAAAAAAACAAA ACACA;

[0099] The IRES sequence is:

[0100] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTA

[0101] GCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCC

[0102] CAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCA

[0103] CACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATC

[0104] AATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCA

[0105] ACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCG

[0106] CTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCC

[0107] ACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAA

[0108] ACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCT

[0109] AGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAG

[0110] CACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTG

[0111] CAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACT

[0112] GGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATT

[0113] GGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTAT

[0114] ACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTG AATACAGCAAA;

[0115] The sequence of the target fragment is:

[0116] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcac

[0117] caccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa;

[0118] The 3'-end spacer sequence is:

[0119] AAAAAACAAAAAACAAAA;

[0120] The 3'-internal homologous fragment sequence is:

[0121] CGGCTATTATGCGTTACCGGC;

[0122] The exon fragment-5' intron sequence number is:

[0123] GAGACGCTACGGACTTAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGAC;

[0124] The sequence number of the 3' end homologous fragment is:

[0125] CAGTGGACAATCGACGGATAACAGCATATCTAG;

[0126] The sequence number of the Xba I restriction site is:

[0127] TCTAGA;

[0128]

[0129] DETAILED DESCRIPTION

[0130] The word "embodiment" used herein as an "exemplary" does not necessarily mean that any embodiment described is superior or better than other embodiments. Performance index tests in the embodiments of the present invention are performed using conventional test methods in the art unless otherwise specified. It should be understood that the terms described in the embodiments of the present invention are only used to describe specific implementation methods and are not intended to limit the contents disclosed in the embodiments of the present invention.

[0131] Unless otherwise specified, the technical and scientific terms used herein have the same meanings as commonly understood by ordinary technicians in the technical field to which the embodiments of the present invention belong; other experimental methods and technical means not specifically specified in the embodiments of the present invention refer to experimental methods and technical means commonly used by ordinary technicians in the field.

[0132] The terms "substantially" and "approximately" used herein are used to describe small fluctuations. For example, they can refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%. The numerical data represented or presented in the range format herein are used only for convenience and brevity, and should therefore be flexibly interpreted as including not only the values ​​clearly listed as the limits of the range, but also all independent values ​​or sub-ranges contained in the range. For example, the numerical range of "1-5%" should be interpreted as including not only the clearly listed values ​​of 1% to 5%, but also the independent values ​​and sub-ranges within the range shown. Therefore, independent values ​​such as 2%, 3.5% and 4% and sub-ranges such as 1%-3%, 2%-4% and 3%-5% are included in this numerical range. This principle also applies to the range of only one numerical value. In addition, such an interpretation applies regardless of the width of the range or the characteristics described.

[0133] In this document, including in the claims, transitional words such as "comprises," "includes," "with," "having," "containing," "involving," "accommodating," etc. are understood to be open-ended, i.e., meaning "including but not limited to." Only the transitional words "consisting of" and "composed of" are closed transitional words.

[0134] In order to better illustrate the present invention, numerous specific details are provided in the specific examples below. It should be understood by those skilled in the art that the present invention can be implemented without certain specific details. In the embodiments, some methods, means, instruments, equipment, etc. well known to those skilled in the art are not described in detail in order to highlight the gist of the present invention.

[0135] Under the premise of no conflict, the technical features disclosed in the embodiments of the present invention may be arbitrarily combined, and the resulting technical solutions belong to the contents disclosed in the embodiments of the present invention.

[0136] The technical details are further illustrated below in conjunction with embodiments.

[0137] In some embodiments, the method for preparing high-purity circular RNA can be applied to circular RNA produced by chemical synthesis, nucleic acid ligase synthesis, and ribozyme self-cleavage synthesis; Figure 1 As shown, the specific steps include:

[0138] S1. Construct a circularized backbone sequence with self-splicing activity; the circularized backbone sequence comprises the following modular elements from the 5' end to the 3' end: T7 promoter, 5' end homologous fragment, 3' intron-exon fragment, 5' internal homologous fragment, 5' end spacer sequence, IRES sequence, target fragment, 3' end spacer sequence, 3' internal homologous fragment, exon fragment-5' intron, 3' end homologous fragment, Xba I endonuclease cleavage site;

[0139] S2, inserting the circularized backbone sequence into the pUC57 vector for plasmid amplification;

[0140] S3, extract the plasmid, use Xba I endonuclease to linearize the vector, and obtain an in vitro amplification template;

[0141] S4, using dsRNA-free T7 RNA polymerase to perform in vitro amplification reaction to obtain dsRNA-free precursor RNA; generally, the circular RNA precursor sequence is prepared by dsRNA-free T7 RNA polymerase, thereby avoiding the introduction of dsRNA impurities in the initial stage; in some embodiments, step S4 specifically includes:

[0142] The in vitro amplified template was purified by phenol extraction and ethanol precipitation;

[0143] In vitro amplification reactions were performed using dsRNA-free T7 RNA polymerase, and the reactions were carried out for 2 to 3 hours;

[0144] The reaction solution was added with DNase I to digest the DNA template and obtain dsRNA-free precursor RNA.

[0145] In some embodiments, the method for preparing high-purity circular RNA disclosed in step S5 comprises:

[0146] The precursor RNA is precipitated and the RNA is dissolved in a cyclization buffer to obtain a reaction solution; the cyclization buffer contains 1.5-4.3 mM GTP and 10-60 mM Mg 2+ ;

[0147] Place the reaction solution in a 45-65°C water bath and incubate for 15-30 minutes to complete RNA circularization;

[0148] S5, the precursor RNA is cyclized to obtain a crude circular RNA stock solution; the crude circular RNA stock solution contains circular RNA and linear RNA; usually the circular RNA in the crude circular RNA stock solution is the target circular RNA for synthesis, and the linear RNA is a linear RNA impurity present in the stock solution, which needs to be removed in a subsequent process to obtain a high-purity circular RNA;

[0149] S6. Treating the crude circular RNA stock solution with poly(A) or poly(U) polymerase to add a poly(A) or poly(U) long tail to the linear RNA therein; generally, the amount of poly(A) polymerase and poly(U) polymerase used can be linearly scaled up to meet the actual need for adding a long tail; in some embodiments, step S6 specifically includes:

[0150] Mix 500 μg to 1 mg of crude circular RNA stock solution with 10x reaction buffer, 10 mM ATP or UTP, RNase Inhibitor, poly(A) polymerase or poly(U) polymerase to obtain a reaction solution; wherein the concentration of poly(A) polymerase or poly(U) polymerase is 0.25 to 2.25 U / μl;

[0151] The mixed reaction solution is incubated at 37°C for 2 to 3 hours to add a poly(A) or poly(U) long tail to the end of the linear RNA; the length of the poly(A) or poly(U) long tail can be controlled by controlling the time length and the amount of polymerase;

[0152] S7. Purify the crude circularized RNA stock solution using an affinity chromatography column, separate the linear RNA with added poly(A) or poly(U) long tail from the circular RNA, and obtain highly pure circular RNA; the binding groups of the affinity layer filler of the affinity chromatography column include oligo(dT), oligo(dU), oligo(dA), oligo(dAT), oligo(dCT), oligo(dGT), oligo(dAC), oligo(dAG), oligo(dAU), oligo(dCU) or oligo(dGU) sequences. Usually, the volume of the affinity chromatography column is linearly enlarged according to the purification requirements. The sequence length of the binding group of the affinity chromatography column can be 18 to 30 bp.

[0153] In some embodiments of the method for preparing high-purity circular RNA, the 5' end spacer sequence and the 3' end spacer sequence of the circularized backbone sequence include a combination of one or more sequences of poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG); generally, the poly(A) sequence refers to a repeated A sequence, poly(AC) refers to a repeated AC sequence, poly(AG) refers to a repeated AG sequence, poly(U) refers to a repeated U sequence, poly(UA) is a repeated UA sequence, poly(UC) is a repeated UC sequence, and poly(UG) refers to a repeated UG sequence; step S7 specifically includes:

[0154] Recovering the crude circular RNA stock solution and dissolving it in ultrapure water treated with diethyl pyrocarbonate; the crude circular RNA stock solution contains linear RNA and circular RNA with poly(A) or poly(U) long tails added to the ends;

[0155] Dilute the crude circular RNA stock solution with binding buffer to a concentration of 1 μg / μl;

[0156] The affinity chromatography column is balanced with a binding buffer, and the sample is loaded for chromatography at a flow rate of 0.1 to 1 ml / min; the circular RNA and the linear RNA with a poly(A) or poly(U) long tail added to the end are bound to the affinity chromatography column;

[0157] After loading, wash with 3 to 5 column volumes of washing buffer, and finally elute the affinity column with ultrapure water treated with diethyl pyrocarbonate to obtain circular RNA. The circular RNA bound to the affinity column and the linear RNA with a poly(A) or poly(U) long tail at the end can be eluted step by step during the elution process of ultrapure water treated with diethyl pyrocarbonate to achieve separation.

[0158] In the method for preparing high-purity circular RNA disclosed in some embodiments, the 5' end spacer sequence and the 3' end spacer sequence of the circularized backbone sequence do not contain poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG); step S7 specifically comprises:

[0159] Recovering the crude circular RNA stock solution and dissolving it in ultrapure water treated with diethyl pyrocarbonate; the crude circular RNA contains a mixture of linear RNA and circular RNA with poly(A) or poly(U) long tails added to the ends;

[0160] Dilute the crude circular RNA stock solution with binding buffer to a concentration of 1 μg / μl;

[0161] The affinity chromatography column is balanced with a binding buffer and the sample is loaded for chromatography at a flow rate of 0.1 to 1 ml / min. During the loading process, the linear RNA with a poly(A) or poly(U) long tail at the end binds to the affinity chromatography column, while the circular RNA does not bind to the affinity chromatography column but flows out with the flow-through. The flow-through is collected and desalted to obtain high-purity RNA.

[0162] In some embodiments of the method for preparing high-purity circular RNA, the binding buffer contains 0.5-1.5M NaCl or 0.25-1M LiCl.

[0163] In some embodiments of the method for preparing high-purity circular RNA, the affinity layer filler matrix of the affinity chromatography column is agarose, dextran, SiO2 or other polymer gel; the length of the binding group is 18 to 30 bp.

[0164] In some embodiments of the method for preparing high-purity circular RNA, the length of poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC), and poly(UG) sequences in the cyclized backbone sequence is 10 to 60 bp.

[0165] In the method for preparing high-purity circular RNA disclosed in some embodiments, the length of the poly(A) or poly(U) long tail added to the end of the linear RNA is 2 to 10 times the length of the poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG) sequence in the circularized backbone sequence.

[0166] Example 1

[0167] (1) Preparation of dsRNA-free crude circular RNA 1, wherein the circular RNA comprises a poly (AC) sequence;

[0168] Constructing a circularized backbone sequence with self-splicing activity, comprising the following modular elements from 5' to 3': T7 promoter, 5' terminal homologous fragment, 3' intron-exon fragment, 5' internal homologous fragment, 5' terminal spacer sequence, IRES sequence, target fragment, 3' terminal spacer sequence, 3' internal homologous fragment, exon fragment-5' intron, 3' terminal homologous fragment, Xba I restriction site;

[0169] Insert the cyclized backbone sequence into the pUC57-Kan vector to obtain a gene vector; wherein the target fragment is a protein coding or non-coding sequence according to actual needs, and the sequence of the target fragment in this embodiment 1 is a commonly used eGFP fluorescent protein coding sequence;

[0170] The sequence number of the pUC57-Kan vector is SEQ No.001; the sequence number of the T7 promoter is SEQ No.002; the sequence number of the 5' terminal homologous fragment is SEQ No.003; the sequence number of the 3' intron-exon fragment is SEQ No.004; the sequence number of the 5' internal homologous fragment is SEQ No.005; the sequence number of the 5' terminal spacer is SEQ No.006; the sequence number of the IRES is SEQ No.007; the sequence number of the target fragment is SEQ No.008; the sequence number of the 3' terminal spacer is SEQ No.009; the sequence number of the 3' internal homologous fragment is SEQ No.010; the sequence number of the exon fragment-5' intron is SEQ No.011; the sequence number of the 3' terminal homologous fragment is SEQ No.012; the sequence number of the Xba I restriction site is SEQ No.013;

[0171] The intron of the cyclization backbone sequence is a leucine tRNA intron from Anabaena, and its sequence is from the literature Nat Commun. 2018 Jul 6; 9 (1): 2629 and Nat Biotechnol. 2023 Feb; 41 (2): 262-272; the cyclization backbone sequence was synthesized by Suzhou Hongxun Biotechnology Co., Ltd.;

[0172] The vector containing the circularized backbone sequence was transfected into Escherichia coli DH5α for plasmid amplification;

[0173] The template plasmid was extracted using a conventional plasmid extraction kit;

[0174] The template plasmid was linearized using the restriction endonuclease Xba I (NEB, R0145S). The reaction system was: 6 μg of template plasmid, 2 μl of Xba I restriction endonuclease, 10x rCutSmart TM Buffer 2μl, make up to 20μl with DEPC-treated water; incubate the reaction system at 37℃ for 2 hours; DEPC refers to diethyl pyrocarbonate;

[0175] The enzyme digestion effect was tested by agarose gel electrophoresis. If the electrophoresis band was a single band, it indicated that the enzyme digestion was complete. The template was purified by phenol extraction and ethanol precipitation and dissolved in DEPC treated water. Figure 2 As shown,

[0176] Lane 1 is an eGFP circular plasmid with a sequence containing Poly(AC), Lane 2 is an eGFP linearized plasmid with a sequence containing Poly(AC), Lane 3 is an eGFP circular plasmid without a sequence containing Poly(AC), Lane 4 is an eGFP circular plasmid without a sequence containing Poly(AC), and Lane 5 is a DNA marker; the results show that after single restriction digestion with Xba I, all circular template plasmids are linearized, and the digestion products can be used as in vitro amplification templates, i.e., IVT templates, for subsequent IVT RNA production; wherein the obtained IVT template is a complete eGFP circular RNA in vitro transcription template, which contains a poly(AC) sequence inside, and has a sequence number of SEQ No. 014;

[0177] After obtaining the IVT template, an IVT reaction was performed to prepare a circular RNA precursor. The reaction system was as follows: 1 μg of the linearized template, 2 μl of dsRNA-free T7 RNA Polymerase, 2 μl of each of 100 mM NTP, 1 μl of RNase Inhibitor, and 20 μl was made up with DEPC-treated water; wherein, the dsRNA-free T7 RNA Polymerase was a nearshore protein, Cat. No.: E122; incubated at 37°C for 2 hours to obtain an IVT reaction product. After the reaction was completed, 1 μl of DNase I was added to digest the DNA template, and finally a circular RNA precursor was obtained;

[0178] Add 20 μl of DEPC-treated water and 20 μl of 7.5M LiCl solution to the system containing the circular RNA precursor, so that the final concentration of LiCl is 2.5M; place the system at -20°C and precipitate for 30 minutes; centrifuge at 16000g for 20 minutes, wash the precipitate with 75% ethanol precooled at -20°C, centrifuge again at 4°C and 12000g for 5 minutes, collect the precipitate, dry it, dissolve the RNA with a certain amount of cyclization buffer, and incubate the solution in a 55°C water bath for 30 minutes to obtain the circular RNA; wherein the cyclization buffer solution is composed of 50mMTris-HCl at pH 7.5, 50mM NaCl, 40mM MgCl2, and 2mM GTP;

[0179] The circularization efficiency of circular RNA was detected by 1.5% denaturing agarose gel electrophoresis (Urea-TBE). Figure 3; The results showed that after the template was linearized by Xba I, it was purified by phenol extraction and ethanol precipitation, and then IVT produced circular RNA precursors. The left lane in the figure is the initial IVT product; the IVT initial product was purified by LiCl precipitation method, and cyclization buffer was added, incubated at 55°C for cyclization, and finally the circular RNA was purified again by LiCl precipitation method; the right lane in the figure is the RNA after the cyclization reaction;

[0180] Add 20 μl of DEPC-treated water and 20 μl of 7.5M LiCl solution to the system containing circular RNA, so that the final concentration of LiCl is 2.5M; place the system at -20°C and precipitate for 30 minutes; centrifuge at 16000g for 20 minutes, wash the precipitate with 75% ethanol precooled at -20°C, centrifuge again at 4°C and 12000g for 5 minutes, collect the precipitate, dry it, and dissolve the RNA with a certain amount of DEPC-treated water; obtain crude circular RNA;

[0181] The dsRNA level in the crude circular RNA liquid-liquid system was detected by dot blot assay; the process included:

[0182] Incubate the RNA in a heat block at 95 °C for 3 min to disrupt secondary structures. Immediately after denaturation, cool the tube on ice to prevent the reformation of RNA secondary structure; cut the positively charged nylon membrane into appropriate sizes, which need to be large enough to form a 2 x 4 grid; drop 2 μL of RNA onto the nylon membrane and immediately transfer the culture dish with the nylon membrane to a UV crosslinker equipped with a 254 nM UV lamp to crosslink for 30 min; wash the nylon membrane with 10 mL TBST (1x TBS, 0.1% Tween-20) at room temperature for 5 minutes and shake gently to wash off unbound RNA; incubate the nylon membrane (RNA side down to prevent accidental drying of the membrane) in 10 ml blocking buffer (TBST + 2% BSA) for 1 hour at room temperature with gentle shaking; discard the blocking buffer and incubate the nylon membrane with Anti-dsRNA monoclonal antibody J2 (Jena Bioscience) at a dilution ratio of 1:250 in 10 ml TBST at +4°C overnight; wash the nylon membrane three times with TBST and add secondary antibody goat Anti-mouse IgG-HRP, incubate for 1 hour; wash the nylon membrane three times with TBST, develop with ECL reagent, and take photos for analysis. Figure 4 The results showed that the dsRNA level in the RNA produced by the ordinary T7 RNA polymerase was high (higher grayscale), while the dsRNA level in the RNA produced by the dsRNA-free T7 RNA polymerase was very low (very low grayscale).

[0183] (2) Preparation of a crude dsRNA-free circular RNA 2, wherein the circular RNA does not contain a poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG) sequence;

[0184] The preparation method is as described in Example (1), wherein the cyclization backbone sequence does not include the 3' end spacer sequence and the 5' end spacer sequence; wherein the obtained IVT template is a complete eGFP circular RNA in vitro transcription template, does not contain a poly (AC) sequence, and has a sequence number of SEQ No. 015.

[0185] Example 2

[0186] The crude circular RNA 1 obtained in Example 1 was purified by oligo(dT) affinity chromatography;

[0187] Add poly(A) long tails to the 3' ends of all linear RNA impurities in crude circular RNA as follows:

[0188] 1. Prepare 1 ml reaction system, including 500 μg crude circular RNA stock solution, 100 μl 10x reaction buffer (500 mM Tris-HCl (pH 8.1, 25°C), 2.5 M NaCl, 100 mM MgCl2), 20 μl 100 mM ATP, 1000 U RNase inhibitor, 250 U poly (A) polymerase, and make up 1 ml system with DECP-treated water;

[0189] 2. Place the reaction system at 37°C for 3 hours;

[0190] 3. Add 20 μl 500 mM EDTA to terminate the reaction;

[0191] 4. Add 500 μl of 7.5 M LiCl solution to the reaction system to make the final concentration of LiCl 2.5 M. Place the solution at -20°C overnight to precipitate RNA. Recover the RNA in the system by precipitation to obtain RNA with a poly(A) tail.

[0192] 5. Detect the effect of adding poly(A) tail to RNA by 1.5% denaturing agarose gel electrophoresis (Urea-TBE); the test results are as follows: Figure 5As shown, Poly(A) polymerase can add a poly(A) tail to the 3'-OH end of any linear RNA; in the RNA that has undergone the cyclization reaction, except for the successfully cyclized RNA, all others have been added with poly(A) tails of different lengths, causing the movement of their agarose electrophoresis bands to slow down, while the circular RNA remains in its original position; lanes 1 and 3 in the figure are the RNA mixture obtained after cyclization, in which the precursor RNA and introns can be clearly seen, and the nicked RNA is more difficult to observe because of its molecular size being the same as that of the circular RNA; lanes 2 and 4 are the RNA mixture treated with poly(A) polymerase, and it can be seen that the circular RNA band is still in its original position, while the band positions of other linear impurities have all moved significantly upward;

[0193] 6. Dissolve the precipitated poly(A)-mixed RNA in DEPC-treated water for subsequent purification; the steps are as follows:

[0194] 1) Clean the GE AKTAPurifier 100FPLC system with DEPC-treated water for 10 min at a flow rate of 1 ml / min;

[0195] 2) 1 ml POROS TM GoPure TM Oligo(dT)25 prepacked column was installed on GE AKTA Purifier 100FPLC system according to the instruction manual, and the entire system was flushed with loading buffer (10 mM Tris-HCl, 5 mM EDTA, 1.0 M NaCl, pH 7.0) to equilibrate the affinity chromatography column at a flow rate of 0.5 ml / min;

[0196] 3) Prepare loading buffer: 200 μl RNA (~500 μg) + 200 μl 2x loading buffer, mix well;

[0197] 4) Use a 1ml disposable syringe to draw 0.6ml of 1x loading solution, then draw 0.4ml of sample, insert the syringe into the loading port, slowly push the syringe, and finally push 0.8ml of liquid into the loading loop;

[0198] 5) Set the machine flow rate to 0.1 ml / min, change the program to inject mode, start loading, and observe the changes in UV and conductivity detectors for about 30 to 50 minutes;

[0199] 6) Change the mobile phase to washing solution (10 mM Tris-HCl, 5 mM EDTA, 0.2 M NaCl, pH 7.0) at a flow rate of 0.5 ml / min for washing; continue for 5 column volumes;

[0200] 7) Change the mobile phase to DEPC-treated water to elute the sample at a flow rate of 0.5 ml / min. At the same time, open some collectors to collect the eluate and observe the changes in the UV and conductivity detectors;

[0201] 8) Two elution peaks will appear during the entire elution process. The first and second elution peaks are collected separately, wherein the first elution peak is the purified circular RNA, and the second elution peak is the linear RNA mixture with poly(A) added;

[0202] 9)Use ultrafiltration tube ( Ultra Centrifugal Filter, 30kDa MWCO) was used to concentrate the first elution peak sample to obtain high-purity circular RNA, which was then stored at -80°C. At this point, the circular RNA was eluted with DEPC-treated water, and the circular RNA sample could be directly used in subsequent cell and animal experiments;

[0203] Depend on Figure 6 It can be seen that the circular RNA in Example 2 contains a 50bp Poly (AC) structure, which can bind to Oligo (dT); the linear RNA impurity with added poly (A) can also bind to Oligo (dT), but after 2 to 3 hours of reaction, about 200 to 300 A are added to the end of the linear RNA impurity, resulting in the impurity binding to Oligo (dT) being much greater than the circular RNA; therefore, when eluted with DEPC-treated water, the retention time of circular RNA is short, while the retention time of linear RNA is long. It can also be seen from the agarose electrophoresis that the RNA eluted first is a very pure single-band circular RNA, and the RNA impurity eluted later may also contain a small amount of circular RNA; according to the peak area, it can be estimated that the purification yield of this method is above 70%.

[0204] Example 3

[0205] The crude circular RNA 2 obtained in Example 1 was purified by oligo(dT) affinity chromatography;

[0206] Add poly(A) tails to the 3' ends of all linear RNA impurities in crude circular RNA as follows:

[0207] 1) Prepare 1 ml reaction system, including 500 μg crude circular RNA stock solution, 100 μl 10x reaction buffer (500 mM Tris-HCl (pH 8.1, 25°C), 2.5 M NaCl, 100 mM MgCl2), 20 μl 100 mM ATP, 1000 U RNase inhibitor, 250 U poly(A) polymerase (NEB, E. coli Poly(A) Polymerase, M0276L), and make up 1 ml system with DECP-treated water;

[0208] 2) Place the reaction system at 37°C for 3 hours;

[0209] 3) Add 20 μl 500 mM EDTA to terminate the reaction;

[0210] 4) Add 500 μl of 7.5 M LiCl solution to the reaction system to make the final concentration of LiCl 2.5 M, place the solution at -20°C, and precipitate RNA for 1 hour; centrifuge at 16000 g for 20 min, wash the precipitate with -20°C precooled 75% ethanol, centrifuge again at 4°C and 12000 g for 5 min, collect the precipitate, and dry it to obtain the poly(A) mixed RNA;

[0211] 5) Dissolve the obtained poly(A)-added mixed RNA in DEPC-treated water for subsequent purification.

[0212] The obtained poly(A)-added mixed RNA was purified by oligo(dT) affinity chromatography, the steps are as follows:

[0213] 1) Clean the GE AKTA Purifier 100FPLC system with DEPC-treated water for 10 min at a flow rate of 1 ml / min;

[0214] 2) 1 ml POROS TM GoPure TM Oligo(dT)25 prepacked column was installed on GE AKTA Purifier 100FPLC system according to the instruction manual, and the entire system was flushed with loading buffer (10 mM Tris-HCl, 5 mM EDTA, 1.0 M NaCl, pH 7.0) to equilibrate the affinity chromatography column at a flow rate of 0.5 ml / min;

[0215] 3) Prepare loading buffer: 200 μl RNA (~500 μg) + 200 μl 2x loading buffer, mix well;

[0216] 4) Use a 1ml disposable syringe to draw 0.6ml of 1x loading solution, then draw 0.4ml of sample, insert the syringe into the loading port, slowly push the syringe, and finally push 0.8ml of liquid into the loading loop;

[0217] 5) Set the machine flow rate to 0.1 ml / min, change the program to inject mode, start loading, and observe the changes in UV and conductivity detectors for about 30 to 50 minutes;

[0218] 6) Start some collectors to collect the flow-through while loading the sample. Since circular RNA does not contain poly(A) sequence, it cannot be captured on the affinity chromatography column and will all flow through.

[0219] 7) Change the mobile phase to DEPC-treated water to elute the affinity chromatography column at a flow rate of 0.5 ml / min. There is only one elution peak in this process, which is all a linear RNA mixture with poly(A) added;

[0220] Since the purified circular RNA is in the flow-through solution, the salt concentration is 1M, so it is necessary to replace the solution; use an ultrafiltration tube ( Ultra Centrifugal Filter, 30kDa MWCO) was used for solution replacement, and finally all of them were replaced with DEPC-treated aqueous solution and stored at -80°C. The obtained circular RNA samples can be directly used in subsequent cell and animal experiments;

[0221] like Figure 7 As shown, the circular RNA of Example 3 does not contain a 50 bp Poly (AC) structure and cannot bind to Oligo (dT). Only the linear RNA impurities with added poly (A) can bind to Oligo (dT). During the chromatography purification process, in the loading step, the circular RNA directly flows through, while the linear RNA impurities bind to the Oligo (dT) filler. Finally, the Oligo (dT) filler can be regenerated by elution with DEPC-treated water. It can also be seen from the agarose electrophoresis that the RNA that flows through is a very pure single-band circular RNA, and what is eluted later is RNA impurities, which may also contain a small amount of circular RNA. According to the peak area, it can be estimated that the purification yield of this method is above 50%.

[0222] Comparative Example 1

[0223] Purify the crude circular RNA 1 obtained in Example 1 using the RNase R method;

[0224] The method for purifying crude circular RNA1 using the RNase R method includes:

[0225] 1) Prepare a 20 μl reaction system and optimize the reaction conditions; the reaction system includes 50 μg of crude circular RNA 1 stock solution (4-4.5 μg / μl RNA), 2 μl 10x reaction buffer (200 mM Tris-HCl (pH8.0@25°C), 1 M KCl, 1 mM MgCl2), 10-15 U RNase R enzyme (Baorui Bio, BP-E08), and DEPC-treated water to make up to 20 μl;

[0226] 2) Incubate the reaction system at 37°C for 30-120 min;

[0227] 3) Add 20 μl of DEPC-treated water and 20 μl of 7.5 M LiCl solution to the reaction system to make the final concentration of LiCl 2.5 M; place the reaction system solution at -20°C for 1 hour to precipitate RNA; centrifuge at 16000 g for 20 min, wash the precipitate with -20°C precooled 75% ethanol, centrifuge again at 4°C 12000 g for 5 min, collect the precipitate, dry it, and obtain circular RNA1, and dissolve RNA1 with a certain amount of DEPC-treated water;

[0228] 4) The purification efficiency of circular RNA1 was detected by 1.5% denaturing agarose gel electrophoresis (Urea-TBE).

[0229] Test results see Figure 8 , Fig. 9 The results showed that the purification of circular RNA by RNase R enzyme is related to the amount of enzyme used and the digestion time. In addition, RNase R will digest circular RNA while digesting linear RNA. If relatively pure circular RNA is to be obtained, a stronger digestion is required, and the yield is also very low.

[0230] Comparative Example 2

[0231] The crude circular RNA 1 obtained in Example 1 was purified by HPLC size exclusion method;

[0232] The method for purifying crude circular RNA 1 using HPLC-size exclusion method comprises:

[0233] 1) Clean the GE AKTA Purifier 100FPLC system with DEPC-treated water for 10 min at a flow rate of 1 ml / min;

[0234] 2) Install SRT SEC-1000 (5μm, 21.2x300mm, 215950-21230) chromatographic column to FPLC system;

[0235] 3) Use 10 mM phosphate buffer (PH=7) as the mobile phase at a flow rate of 3 ml / min to flush the system and balance the chromatographic column;

[0236] 4) Dilute 500 μg of circular RNA stock solution to a concentration of 1 μg / μl with 10 mM phosphate buffer;

[0237] 5. Use a 1ml disposable syringe to draw 0.5ml of 10mM phosphate buffer, then draw 0.5ml of sample, insert the syringe into the sample loading port, slowly push the syringe, and finally push 0.8ml of liquid into the sample loading loop;

[0238] 5) Change the program to inject mode, start loading samples, and observe the changes in UV detector signals;

[0239] 6) When an elution peak is found, open some collectors and automatically collect samples at a rate of 1 ml per tube until the UV signal returns to the baseline, indicating that the sample elution is complete;

[0240] 7) Determine the tube number for collecting samples according to the elution peak, select several representative samples for 1.5% denaturing agarose gel electrophoresis (Urea-TBE) to detect the purification efficiency of circular RNA;

[0241] 8) Combine the samples with better purity according to the electrophoresis diagram and use ultrafiltration tube ( Ultra CentrifugalFilter, 30kDa MWCO) was used to concentrate the sample, exchange the liquid, and finally the purified circular RNA was placed in DEPC-treated water and stored at -80°C. The sample can be directly used in subsequent cell and animal experiments. Fig.10 As shown in the figure, the results show that size exclusion chromatography is separated and purified according to molecular size. The RNA mixture after circularization contains a variety of linear RNAs of different lengths, such as unconverted precursor RNA, excised introns, nicked RNA, and other incorrectly sheared sequences, so there will be multiple elution peaks. The RNA of each elution peak was examined by agarose electrophoresis, and the circular RNA in the second half of the third elution peak had a higher purity, but the figure showed that there was still a small amount of impurities.

[0242] Example 4

[0243] Comparison of the expression of purified circular eGFP RNA in cells obtained in Example 2 and Comparative Examples 1 and 2

[0244] Methods for expressing circular eGFP RNA in cells include:

[0245] 1) Using conventional cell passage operation methods, the well-growing BV-2 cells were washed twice with PBS, digested with an appropriate amount of trypsin for 3 minutes, neutralized the trypsin reaction with DMEM, centrifuged at 1200r for 5 minutes, and resuspended with DMEM (15% fetal bovine serum and double antibody). 10,000 cells were inoculated in a 24-well culture plate, and 1 ml of DMEM (15% fetal bovine serum and double antibody) medium was added, and the plate was cultured in a carbon dioxide incubator (5% CO2, 37°C) for 24 hours;

[0246] 2) Take two new 1.5 ml centrifuge tubes, add 125 μl DMEM medium (serum-free and without double antibody) to each tube, add 4.5 μl lipo6000 transfection reagent (Biyuntian, C0526) to one tube, and add 3 μg purified circular RNA to the other tube, mix them well and leave them at room temperature for 5 minutes;

[0247] 3) Use a pipette to transfer all RNA mixture into the transfection reagent mixture, mix well and leave at room temperature for 5 minutes;

[0248] 4) Aspirate the culture medium in the 24-well plate, add 1 ml of new DMEM (15% fetal bovine serum and double antibody) culture medium, and add 250 μl of the mixture of transfection reagent and RNA into the cell culture medium and mix well;

[0249] 5) The circular eGFP RNAs from three different purification processes were all transfected into BV-2 cells cultured in 24-well plates at 3 μg according to the above process;

[0250] 6) After 24 hours, observe and take pictures using a fluorescence microscope to compare the fluorescence intensity.

[0251] The results are as follows Fig.11 As shown in the figure, the agarose electrophoresis on the left side shows the conditions of several circular RNAs in transfected cells, among which the IVT stock solution has the most impurities (introns have run out of the gel), the circular RNAs purified by RNase R and molecular exclusion method SCE have a small amount of obvious impurities, and the circular RNA purified by Oligo (dT) has only a single band in the first elution peak, and multiple bands in the second elution peak.

[0252] Equal amounts of circular RNA (3 μg) obtained by different purification methods were transfected into BV-2 cells, and it was found that the first elution peaks from RNase R, SCE and Oligo (dT) purification all had obvious eGFP protein expression, among which the circular RNA expression obtained by this method was the highest; while the second elution peak purified by Oligo (dT) only had a trace amount of eGFP protein expression. Our results are also consistent with literature reports that the purity of RNA has a great relationship with the expression of protein. The higher the RNA purity, the higher the protein expression.

[0253] In summary, the results of Example 4 show that the circular RNA obtained using the purification method of Example 2 has higher purity, and after transfecting cells with the same amount of RNA, the protein expression level is also higher.

[0254] The method for preparing high-purity circular RNA disclosed in the embodiment of the present invention adds a poly(A) or poly(U) long tail to the end of the impure linear RNA, and uses an affinity chromatography column to effectively separate the circular RNA from the linear RNA, thereby obtaining high-purity circular RNA.

[0255] The technical solutions disclosed in the embodiments of the present invention and the technical details disclosed in the embodiments are merely illustrative of the inventive concept of the present invention and do not constitute a limitation on the technical solutions of the embodiments of the present invention. Any conventional changes, replacements or combinations of the technical details disclosed in the embodiments of the present invention have the same inventive concept as the present invention and are within the protection scope of the claims of the present invention.

Claims

1. A method for preparing high-purity circular RNA, characterized in that: Includes steps: S1. Construct a circularized backbone sequence with self-splicing activity; the circularized backbone sequence comprises the following modular elements from the 5' end to the 3' end: T7 promoter, 5' end homologous fragment, 3' intron-exon fragment, 5' internal homologous fragment, 5' end spacer sequence, IRES sequence, target fragment, 3' end spacer sequence, 3' internal homologous fragment, exon fragment-5' intron, 3' end homologous fragment, Xba I endonuclease cleavage site; S2, inserting the circularized backbone sequence into the pUC57 vector for plasmid amplification; S3, extract the plasmid, use Xba I endonuclease to linearize the vector, and obtain an in vitro amplification template; S4, using dsRNA-free T7 RNA polymerase to perform an in vitro amplification reaction to obtain dsRNA-free precursor RNA; S5, the precursor RNA is cyclized to obtain a crude circular RNA stock solution; the crude circular RNA stock solution contains circular RNA and linear RNA; S6, treating the crude circular RNA stock solution with poly(A) or poly(U) polymerase to add poly(A) or poly(U) long tails to the linear RNA therein; S7. Purify the crude circularized RNA stock solution using an affinity chromatography column to separate the linear RNA with added poly(A) or poly(U) long tail from the circular RNA to obtain high-purity circular RNA; the binding groups of the affinity layer filler of the affinity chromatography column include oligo(dT), oligo(dU), oligo(dA), oligo(dAT), oligo(dCT), oligo(dGT), oligo(dAC), oligo(dAG), oligo(dAU), oligo(dCU) or oligo(dGU).

2. The method for preparing high-purity circular RNA according to claim 1, characterized in that: Step S4 includes: The in vitro amplified template was purified by phenol extraction and ethanol precipitation; In vitro amplification reactions were performed using dsRNA-free T7 RNA polymerase, and the reactions were carried out for 2 to 3 hours; Add DNase I to treat the reaction solution to digest the DNA template and obtain dsRNA-free precursor RNA.

3. The method for preparing high-purity circular RNA according to claim 1, characterized in that: Step S5 includes: The precursor RNA is precipitated and the RNA is dissolved in a cyclization buffer to obtain a reaction solution; the cyclization buffer contains 1.5-4.3 mM GTP and 10-60 mM Mg 2+ ; The reaction solution was placed in a water bath at 45-65°C and incubated for 15-30 min to complete RNA circularization.

4. The method for preparing high-purity circular RNA according to claim 1, characterized in that: Step S6 includes: Mix 500 μg to 1 mg of crude circular RNA stock solution with 10x reaction buffer, 10 mM ATP or UTP, RNase Inhibitor, and poly(A) polymerase or poly(U) polymerase to obtain a reaction solution; wherein the concentration of poly(A) polymerase or poly(U) polymerase is 0.25 to 2.25 U / μl; The mixed reaction solution is incubated at 37°C for 2 to 3 hours to add a poly(A) or poly(U) long tail to the end of the linear RNA.

5. The method for preparing high-purity circular RNA according to claim 1, characterized in that: In step S1, the 5'-end spacer sequence and the 3'-end spacer sequence of the cyclized backbone sequence include a combination of one or more sequences of poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG); Step S7 specifically includes: Recovering the crude circular RNA stock solution and dissolving it in ultrapure water treated with diethyl pyrocarbonate; the crude circular RNA stock solution contains linear RNA and circular RNA with poly(A) or poly(U) long tails added to the ends; Dilute the crude circular RNA stock solution with binding buffer to a concentration of 1 μg / μl; The affinity chromatography column is balanced with a binding buffer and the sample is loaded for chromatography at a flow rate of 0.1 to 1 ml / min; the circular RNA and the linear RNA with a poly(A) or poly(U) long tail added to the end are bound to the affinity chromatography column; After loading, the column was washed with 3 to 5 column volumes of washing buffer, and finally the affinity chromatography column was eluted with ultrapure water treated with diethyl pyrocarbonate to obtain circular RNA.

6. The method for preparing high-purity circular RNA according to claim 1, characterized in that: In step S1, the 5'-terminal spacer sequence and the 3'-terminal spacer sequence of the cyclized backbone sequence do not contain poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG); Step S7 specifically includes: Recovering the crude circular RNA stock solution and dissolving it in ultrapure water treated with diethyl pyrocarbonate; the crude circular RNA stock solution contains linear RNA and circular RNA with poly(A) or poly(U) long tails added to the ends; Dilute the crude circular RNA stock solution with binding buffer to a circular RNA concentration of 1 μg / μl; The affinity chromatography column is balanced with a binding buffer and the sample is loaded for chromatography at a flow rate of 0.1 to 1 ml / min. During the loading process, the linear RNA with a poly(A) or poly(U) long tail at the end is bound to the affinity chromatography column, and the circular RNA flows out with the flow-through liquid. The flow-through liquid is collected and desalted to obtain high-purity RNA.

7. The method for preparing high-purity circular RNA according to claim 5 or 6, characterized in that: The binding buffer contains 0.5-1.5M NaCl or 0.25-1M LiCl.

8. The method for preparing high-purity circular RNA according to claim 5 or 6, characterized in that: The affinity layer filler matrix of the affinity chromatography column is agarose, dextran, SiO2 or other high molecular gel; the length of the binding group is 18 to 30 bp.

9. The method for preparing high-purity circular RNA according to claim 5, characterized in that: The length of the poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG) sequence in the cyclization backbone sequence is 10 to 60 bp.

10. The method for preparing high-purity circular RNA according to claim 9, characterized in that: The length of the poly(A) or poly(U) long tail added at the end of the linear RNA is 2 to 10 times the length of the poly(A), poly(AC), poly(AG), poly(U), poly(UA), poly(UC) or poly(UG) sequence in the circularized backbone sequence.

Images