Primer for specifically detecting bacillus amyloliquefaciens and application thereof

Abstract

The invention belongs to the field of microbiological detection, and particularly relates to a primer for specifically detecting bacillus amyloliquefaciens and application of the primer. Specific primers are designed aiming at the gyrB gene of the bacillus amyloliquefaciens, a qPCR detection method of the bacillus amyloliquefaciens is established by utilizing a qPCR technology, and the bacillus amyloliquefaciens in a sample is specifically detected. Specificity and detection limit verification show that bacillus amyloliquefaciens in a sample can be rapidly and accurately identified by using the method, and compared with a traditional identification method which has the defects of errors and low efficiency, the method has the characteristics of rapid reaction and capability of realizing accurate qualitative and quantitative identification.

Description

Technical Field

[0001] The invention belongs to the field of microbial detection and relates to a primer for specifically detecting Bacillus amyloliquefaciens and an application thereof. Background Art

[0002] Bacillus, as a highly abundant functional microorganism in the high-temperature Daqu of Maotai liquor, has attracted widespread attention because it can produce amylase, saccharifying enzyme, protease, lactic acid, propionic acid, acetoin, pyrazines, etc. Among them, Bacillus amyloliquefaciens can hydrolyze different animal and plant products, synthesize different enzymes, proteins and carbohydrates, and play the role of prebiotics and probiotics. Its widespread presence in different environments and its ability to form spores enable it to withstand extreme conditions, which also gives it great value in food processing. Bacillus amyloliquefaciens is an important enzyme-producing and pyrazine-producing microorganism in liquor production. Accurately identifying Bacillus amyloliquefaciens and applying it to liquor production is of great significance to improving the quality of liquor.

[0003] At present, the identification and quantitative detection of Bacillus amyloliquefaciens are mainly carried out through the selection of culture media, physiological and biochemical identification, 16S rRNA sequencing identification and pure culture isolation and counting. However, some species of Bacillus are closely related, have similar phenotypes and extremely high 16S rRNA gene sequence homology, and are difficult to accurately distinguish. The traditional culture counting method takes a long time to culture, is easily affected by the external environment, and the test results lack stability and reliability.

[0004] Real-time fluorescence quantitative PCR (qPCR), also known as fluorescent quantitative polymerase chain reaction, is widely used for nucleic acid detection in the fields of medicine and food. Some existing methods for detecting and quantifying Bacillus amyloliquefaciens include conventional PCR, ARMS-qPCR (amplification retardation mutation system PCR), or qPCR detection using specific primers designed for other genes such as gyrA. Summary of the invention

[0005] In one aspect, the present invention provides a primer comprising a primer pair as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0006] On the one hand, the present invention provides the use of the primer, which is any one of the following a1-a8:

[0007] a1. Identify the gyrB gene;

[0008] a2. Preparation of products for identifying the gyrB gene;

[0009] a3. Identify whether the strain to be tested has the gyrB gene;

[0010] a4. Preparation of products for identifying whether the test strain has the gyrB gene;

[0011] a5. Identify whether there is a strain with the gyrB gene in the sample to be tested;

[0012] a6. Preparation of a product for identifying the presence of a strain having the gyrB gene in a test sample;

[0013] a7. Identify whether the strain to be tested is Bacillus amyloliquefaciens;

[0014] a8. Preparation of products for identifying whether the test strain is Bacillus amyloliquefaciens;

[0015] a9. Detecting whether Bacillus amyloliquefaciens is present in the sample to be tested;

[0016] a10. Prepare a product for detecting Bacillus amyloliquefaciens in a sample.

[0017] In one aspect, the present invention provides a reagent containing the primer, wherein the reagent is used for any one of the following b1-b5:

[0018] b1. Identification of gyrB gene;

[0019] b2. Identify whether the strain to be tested has the gyrB gene;

[0020] b3. Identify whether there is a strain with the gyrB gene in the sample to be tested;

[0021] b4. Identify whether the strain to be tested is Bacillus amyloliquefaciens;

[0022] b4. Identify whether the strain to be tested is Bacillus amyloliquefaciens;

[0023] b5. Detect Bacillus amyloliquefaciens in samples.

[0024] In one aspect, the present invention provides a reagent for specifically detecting Bacillus amyloliquefaciens, comprising the primers described above.

[0025] In one aspect, the present invention provides a method for identifying whether a strain to be tested or a sample to be tested is or is suspected to be, or has Bacillus amyloliquefaciens, comprising the following steps:

[0026] Using the nucleic acid of the strain to be tested or the sample to be tested as a template, the nucleic acid is contacted with the primers or the reagents, and the PCR reaction is performed and then the following evaluation is performed:

[0027] If the amplification curve is an S curve and the Ct value is <24, the strain to be tested is or is suspected to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens exists or is suspected to exist in the sample to be tested;

[0028] If there is no amplification, or

[0029] If the amplification curve is an S-curve and the Ct value is >28, the strain to be tested is not or is suspected not to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens does not exist or is suspected not to exist in the sample to be tested.

[0030] In some embodiments, the sample to be tested includes one or more of a strain, Daqu, fermented grains, soil, soybean meal, and culture medium.

[0031] In one aspect, a detection system for identifying whether a strain to be tested or a sample to be tested is or is suspected to be, or contains Bacillus amyloliquefaciens, comprises the following components:

[0032] 1) Detection component of gyrB gene;

[0033] 2) Data processing components;

[0034] 3) Result output component;

[0035] The detection component of the gyrB gene contains the primer or the reagent.

[0036] In some embodiments, the detection component comprises a detection instrument, which is a fluorescence quantitative PCR instrument and / or a sequencer.

[0037] In some embodiments, the data processing component is configured to:

[0038] According to whether the gyrB gene of the strain to be tested is detected by the detection component, it is determined whether the strain to be tested or the sample to be tested is or is suspected to be, or exists, Bacillus amyloliquefaciens.

[0039] In some embodiments, the data processing component determines in the following manner:

[0040] If the amplification curve is an S curve and the Ct value is <24, the strain to be tested is or is suspected to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens exists or is suspected to exist in the sample to be tested;

[0041] If there is no amplification, or

[0042] If the amplification curve is an S-curve and the Ct value is >28, the strain to be tested is not or is suspected not to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens does not exist or is suspected not to exist in the sample to be tested.

[0043] The traditional culture method identifies Bacillus amyloliquefaciens based on colony morphology combined with 16S sequencing, but cannot distinguish Bacillus amyloliquefaciens from its closely related Bacillus, and the traditional culture method requires at least 24 hours of growth time. The fluorescence quantitative detection method has high sensitivity, and the detection time is shortened to within 3 hours. It can specifically detect Bacillus amyloliquefaciens and achieve the purpose of accurate distinction. The number of colonies that can be accurately detected by the present invention is 4.5×10 7 CFU / mL to 23CFU / mL, the minimum detection limit is 23CFU / mL, with extremely high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a graph of specific fluorescence amplification of six closely related Bacillus species by the specific primers gyrB-F5 and gyrB-R5 of the present invention.

[0045] Figure 2 This is the fluorescence amplification graph of the detection limit of Bacillus amyloliquefaciens using specific primers gyrB-F5 and gyrB-R5.

[0046] Figure 3 This is the fluorescence quantitative standard curve of Bacillus amyloliquefaciens. DETAILED DESCRIPTION

[0047] The technical solution of the present invention is further described below by specific embodiments, which do not limit the protection scope of the present invention. Some non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the protection scope of the present invention.

[0048] The present invention uses a one-tube universal sample DNA extraction kit to extract the genomic DNA of the sample to be tested, uses universal primers for Bacillus to perform PCR amplification, and the amplified base sequence is blasted in NCBI to obtain the complete genome of Bacillus amyloliquefaciens. Specific primers are designed with gyrB as the target gene, and real-time fluorescent quantitative PCR is used to identify and quantitatively detect Bacillus amyloliquefaciens.

[0049] The method for identifying Bacillus amyloliquefaciens provided by the present invention comprises the following steps:

[0050] (1) A one-tube universal sample DNA extraction kit was used to extract genomic DNA from the samples to be tested, including 6 types of Bacillus.

[0051] (2) Establish a real-time fluorescence quantitative reaction system: Each 20 μL includes: FastSYBR qPCR Mix 10 μL, 10 μm upstream primer 0.4 μL, 10 μm downstream primer 0.4 μL, Rox 0.2 μL, genomic DNA of the sample to be tested 2 μL, ddH 2 O 7.0 μL.

[0052] (3) Establish a real-time fluorescence quantitative reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 5 s, annealing and extension at 55°C for 20 s, 40 cycles, and collect fluorescence signals at 55°C.

[0053] (4) Experimental setup of the real-time fluorescence quantitative PCR method:

[0054] Verification of qPCR primer validity: Bacillus amyloliquefaciens was used to verify the validity of 5 pairs of qPCR primers.

[0055] Specific detection: Select the effective primers obtained in "Validation of qPCR Primer Validity" and use the DNA of 6 Bacillus species, including Bacillus amyloliquefaciens, Bacillus velez, Bacillus cereus, Bacillus subtilis, Bacillus licheniformis, and Bacillus pumilus, as templates for qPCR experiments.

[0056] Detection limit detection: Bacillus amyloliquefaciens was diluted in a gradient manner and 8 groups of experiments were set up: each dilution gradient corresponded to a different total number of colonies, which were 4.5×10 7 CFU / mL, 4.5×10 6 CFU / mL, 4.5×10 5 CFU / mL, 4.5×10 4 CFU / mL, 4.5×10 3 CFU / mL, 4.5×10 2 CFU / mL, 45CFU / mL, 23CFU / mL, blank control with ddH 2 O was used as template for qPCR experiments.

[0057] (5) The qPCR method judgment criteria are:

[0058] When the sample was amplified using specific primers, the amplification curve of the target strain showed an S curve, and the Ct value was less than 24; the non-target strain was not amplified, or the amplification curve showed an S curve, and the Ct value was greater than 28. This shows that the primers are specific for the target strain and ineffective for the non-target strain. The primers can accurately identify Bacillus amyloliquefaciens; otherwise, it cannot be identified.

[0059] In order to better understand the technical solution provided by the present invention, the following uses a plurality of specific examples to illustrate the primers, identification methods, and performance tests for specific detection of Bacillus amyloliquefaciens provided by the above-mentioned embodiments of the present invention.

[0060] Example 1: Design of qPCR primers

[0061] (1) Primers PR-F and PR-R were used to amplify Bacillus amyloliquefaciens

[0062] Primer nucleotide sequence:

[0063] PR-F: GG(G / C / T / A)TA(T / C)AAA(A / T / C / G)A(G / A)GAGGAGCC(SEQ ID NO:3)

[0064] PR-R:TT(C / T)A(G / A)(C / T)TCATG(A / G)GA(A / C / G)ACATT(SEQ ID NO:4)

[0065] Amplified Bacillus amyloliquefaciens sequence:

[0066]

[0067] Copy this sequence and enter the National Center for Biotechnology Information (NCBI) website to obtain the whole genome information and download the gyrB gene sequence:

[0068]

[0069] (2) Five pairs of qPCR primers were designed using Primer Premier 5 using the above sequence (SEQ ID NO: 6). For the convenience of subsequent description, they are sorted as AE. The nucleotide sequences corresponding to each pair of primers are as follows:

[0070] A: gyrB-F1: ATCCATTATCAGGCGTATGAAC (SEQ ID NO: 7)

[0071] gyrB-R1:AACAAAGTGCGTAATCGTTCC (SEQ ID NO:8)

[0072] B: gyrB-F2: TAACATCAACACATACGAAGGC (SEQ ID NO: 9)

[0073] gyrB-R2: TCATCACCGCTCAGATTCG (SEQ ID NO:10)

[0074] C:gyrB-F3:ACCCGTGTCATAAACGACT(SEQ ID NO:11)

[0075] gyrB-R3: CTCACATCATCACCGCTCAG (SEQ ID NO:12)

[0076] D: gyrB-F4: CTTCCGCACTGGAAACATTC (SEQ ID NO: 13)

[0077] gyrB-R4: CTCACATCATCACCGCTCAG (SEQ ID NO:14)

[0078] E: gyrB-F5: GCGTAAAAGCGCACTTGAG (SEQ ID NO: 1)

[0079] gyrB-R5: TACAGCTCGGAAATGCTCG (SEQ ID NO: 2)

[0080] Example 2: Extraction of bacterial genomic DNA

[0081] (1) Liquid culture of strains: The strains purchased from the China Industrial Microbiological Culture Collection were activated and cultured and stored in glycerol tubes. Six strains were inoculated from the glycerol tubes and 100 μL of each strain was pipetted into liquid culture medium in an ultra-clean workbench to prepare pure culture solutions of the six strains.

[0082] Liquid culture medium: peptone 10g, beef extract powder 3g, sodium chloride 5g, distilled water 1L, sterilize at 121℃ for 30min.

[0083] (2) 1 mL of bacterial culture solution cultured for 24 h was taken and centrifuged to obtain bacterial cells. DNA was extracted using a one-tube universal sample DNA extraction kit (Sangon Biotechnology) and stored at -20°C for later use.

[0084] The experimental strains include: Bacillus amyloliquefaciens CICC 23260, Bacillus velezensis CICC 24342, Bacillus cereus CICC 21290, Bacillus subtilis CICC 24713, Bacillus licheniformis ATCC 14580, and Bacillus pumilus ATCC 700814.

[0085] Example 3: Verification of the effectiveness of the five pairs of primers in Example 1

[0086] (1) Establishment of qPCR method:

[0087] PCR amplification system, each 20 μL includes: FastSYBR qPCRMix 10 μL, 10 μm upstream primer 0.4 μL, 10 μm downstream primer 0.4 μL, Rox 0.2 μL, genomic DNA of the sample to be tested 2 μL, ddH 2 O 7.2 μL. The genomic DNA is the DNA extracted from Bacillus amyloliquefaciens and Bacillus velez. The DNA extraction method is the same as that in Example 2.

[0088] It should be noted that the applicant compared the base sequences from the NCBI gene library in the early stage and found that the base sequences of Bacillus Velez and Bacillus amyloliquefaciens were very similar and difficult to distinguish; other strains such as Bacillus licheniformis had large differences in base sequences from Bacillus amyloliquefaciens and were easier to distinguish. Therefore, the first step to verify the effectiveness of the primers only required identification of Bacillus Velez and Bacillus amyloliquefaciens, which were the most difficult to distinguish. In the first step, only Bacillus Velez and Bacillus amyloliquefaciens were used to verify the effectiveness of the five pairs of primers AE in Example 1.

[0089] (2) Reaction procedures of Bacillus amyloliquefaciens and Bacillus velez:

[0090] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 5 s, annealing and extension at 55°C for 20 s, 40 cycles, and collection of fluorescence signals at 55°C.

[0091] (3) Result determination

[0092] The Ct values ​​of the five primer pairs for Bacillus amyloliquefaciens and Bacillus velez are shown in Table 1.

[0093] Table 1

[0094]

[0095] Note: Undetermined means that the antibody pair D did not amplify Bacillus velezensis

[0096] According to Table 1 and the result determination method, it can be seen from Table 1 that the Ct value of Bacillus amyloliquefaciens detection is <24, and the Ct value of non-target strain detection is >28, indicating that primer pair E can be used as a specific primer for distinguishing Bacillus amyloliquefaciens from Bacillus velezinoffei, and can also illustrate the effectiveness of the primer pair.

[0097] Example 4: Specific detection of five non-target strains by real-time fluorescence quantitative PCR

[0098] (1) Real-time fluorescence quantitative PCR was performed using DNA from Bacillus amyloliquefaciens, Bacillus velez, Bacillus subtilis, Bacillus licheniformis, Bacillus cereus, and Bacillus pumilus as templates.

[0099] (2) The establishment and reaction procedure of the real-time fluorescence quantitative PCR method are the same as those in Example 3.

[0100] (3) Result determination: Figure 1 As shown in Table 2, the Ct values ​​of other strains were all >28, indicating that the gyrB-F5 and gyrB-R5 primers can effectively distinguish Bacillus amylolyticus from other strains and have specificity.

[0101] Table 2 Ct values ​​of specific primers gyrB-F5 and gyrB-R5 for six closely related Bacillus species

[0102]

[0103]

[0104] Example 5: Detection limit of real-time fluorescence quantitative PCR method

[0105] (1) The establishment and reaction procedure of the real-time fluorescence quantitative PCR method were the same as those in Example 3.

[0106] The Bacillus amyloliquefaciens bacterial solution was diluted in a gradient manner, and each dilution gradient corresponded to a different bacterial concentration. Eight groups of experiments were set up: 4.5×10 7 CFU / mL, 4.5×106 CFU / mL, 4.5×10 5 CFU / mL, 4.5×10 4 CFU / mL, 4.5×10 3 CFU / mL, 4.5×10 2 CFU / mL, 4.5×10 CFU / mL, 23 CFU / mL, negative control with ddH 2 O was used as template for qPCR experiments.

[0107] After the reaction is completed, a standard curve is drawn: based on the Ct values ​​corresponding to the different concentrations of the standard template obtained above, the Ct value of the cycle number when the fluorescence value in each reaction tube reaches the threshold is used as the vertical axis, and the logarithm of the different concentrations of the standard template is used as the horizontal axis to draw a quantitative standard curve, such as Figure 3 shown.

[0108] (2) Result determination

[0109] like Figure 2 As shown in Table 3, the Ct value of 23 CFU / mL was lower than the Ct value of the negative control; Figure 3 As shown, the R 2 >0.9, amplification efficiency (E) is 95.11%, E=10 -1\斜率 -1, between 90-110%, indicating that this method can detect 23 CFU / mL of Bacillus amyloliquefaciens, with good standard curve and amplification efficiency, and can achieve accurate quantification.

[0110] Table 3 Ct values ​​of the detection limits of specific primers gyrB-F5 and gyrB-R5 for different concentrations of Bacillus amyloliquefaciens

[0111]

[0112] The traditional method of distinguishing Bacillus amyloliquefaciens from its closely related strains from the perspective of colony morphology, microscopic observation of the bacteria, and physiological and biochemical experiments is time-consuming, cumbersome, and has large errors. As can be seen from the above examples, the real-time fluorescence PCR detection method established by the present invention requires simple equipment and produces accurate and rapid results. This indicates that the method can be applied to the specific quantitative detection of Bacillus amyloliquefaciens.

[0113] Example 6: Repeatability test of real-time fluorescence quantitative PCR method

[0114] Repeatability is also one of the important indicators for judging the quality of an identification method. Good repeatability is an important guarantee for the correctness of the identification results.

[0115] 1. The experiment was repeated four times, and the steps of each repetition were as follows: The establishment and reaction procedure of the real-time fluorescence quantitative PCR method were the same as in Example 3, and the template was Bacillus amyloliquefaciens at different concentration gradients, which were 4.5×10 6 CFU / mL, 4.5×10 5 CFU / mL, 4.5×10 3 CFU / mL.

[0116] 2. Count the Ct values ​​generated by four replicates and calculate the coefficient of variation.

[0117] The test results are shown in Table 4.

[0118] Table 4

[0119]

[0120] According to the above method, the results showed that the reproducibility of the Ct values ​​of the four replicates was also good, and the coefficient of variation was between 0.61% and 1.14%. This shows that the method has good reproducibility within and between groups.

[0121] Example 7: Application of real-time fluorescence quantitative PCR method in Daqu

[0122] (1) Extraction of genomic DNA from Daqu samples

[0123] 1 g of sterilized Daqu sample was added with 0.5 mL of different dilutions of Bacillus amyloliquefaciens (initial concentration 1.0×10 7 CFU / mL-10CFU / mL), after standing for 15min, add 3.5mL sterile water, vortex mix, shake for 15min, stand for 1mL of supernatant, centrifuge at 10000r / min for 5min, discard the supernatant, and extract genomic DNA according to the method in Example 2. Genomic DNA of pure bacterial solution of Bacillus amyloliquefaciens with different dilutions was used as a control, and real-time fluorescence quantitative PCR was performed, and the concentration of the detected bacterial solution was the final concentration of Bacillus amyloliquefaciens in the sample system. Each dilution was tested 3 times. The establishment and reaction procedure of the real-time fluorescence quantitative PCR method were the same as in Example 3.

[0124] (2) The test results are shown in Table 5

[0125] Table 5 Ct values ​​of Bacillus amyloliquefaciens in Daqu

[0126]

[0127] The results showed that the detection limit of pure bacterial solution was 10-10 2 CFU / mL, which is consistent with the results in Example 5, while the minimum detection limit of the mixture of bacterial liquid and Daqu at the same concentration is 10 2 -103 CFU / mL. The results showed that this method can be used for quantitative detection of Bacillus amyloliquefaciens in Daqu. However, due to the complexity of the Daqu system, there are many interferences. The concentration of Bacillus amyloliquefaciens in Daqu is higher than 10 2 CFU / mL, accurate quantification can be achieved.

Claims

1. A primer comprising a primer pair as shown in SEQ ID NO: 1 and SEQ ID NO:

2.

2. The use of the primer according to claim 1, which is any one of the following a1-a10: a1. Identify the gyrB gene; a2. Preparation of products for identifying the gyrB gene; a3. Identify whether the strain to be tested has the gyrB gene; a4. Preparation of products for identifying whether the test strain has the gyrB gene; a5. Identify whether there is a strain with the gyrB gene in the sample to be tested; a6. Preparation of a product for identifying the presence of a strain having the gyrB gene in a test sample; a7. Identify whether the strain to be tested is Bacillus amyloliquefaciens; a8. Preparation of products for identifying whether the test strain is Bacillus amyloliquefaciens; a9. Detecting whether Bacillus amyloliquefaciens is present in the sample to be tested; a10. Prepare a product for detecting Bacillus amyloliquefaciens in a sample.

3. The use according to claim 2, characterized in that The sample to be tested includes one or more of strains, Daqu, fermented grains, soil, soybean meal, and culture medium.

4. A reagent containing the primer according to claim 1, wherein the use of the reagent is any one of the following b1-b5: b1. Identification of gyrB gene; b2. Identify whether the strain to be tested has the gyrB gene; b3. Identify whether there is a strain with the gyrB gene in the sample to be tested; b4. Identify whether the strain to be tested is Bacillus amyloliquefaciens; b5. Detect Bacillus amyloliquefaciens in samples.

5. A reagent for specifically detecting Bacillus amyloliquefaciens, characterized in that: Comprising the primer according to claim 1.

6. A method for identifying whether a strain to be tested or a sample to be tested is or is suspected to be, or has Bacillus amyloliquefaciens, characterized in that: The following steps are involved: Using the nucleic acid of the strain to be tested or the sample to be tested as a template, the nucleic acid is contacted with the primers described in claim 1, or the reagents described in claim 4 or 5, and the PCR reaction is performed and then the following evaluation is performed: If the amplification curve is an S curve and the Ct value is <24, the strain to be tested is or is suspected to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens exists or is suspected to exist in the sample to be tested; If there is no amplification, or If the amplification curve is an S-curve and the Ct value is >28, the strain to be tested is not or is suspected not to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens does not exist or is suspected not to exist in the sample to be tested.

7. A detection system for identifying whether a strain to be tested or a sample to be tested is or is suspected to be, or exists, Bacillus amyloliquefaciens, characterized in that: The detection system comprises the following components: 1) Detection component of gyrB gene; 2) Data processing components; 3) Result output component; The detection means for the gyrB gene comprises the primer according to claim 1 , or the reagent according to claim 4 or 5 .

8. The detection system according to claim 7, characterized in that: The detection component comprises a detection instrument, and the detection instrument is a fluorescence quantitative PCR instrument and / or a sequencer.

9. The detection system according to claim 7, characterized in that: The data processing component is configured to: According to whether the gyrB gene of the strain to be tested or the sample to be tested is detected by the detection component, it is determined whether the strain to be tested or the sample to be tested is or is suspected to be, or exists, Bacillus amyloliquefaciens.

10. The detection system according to claim 7, characterized in that: The judgment method of the data processing component is: If the amplification curve is an S curve and the Ct value is <24, the strain to be tested is or is suspected to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens is present or is suspected to be present in the sample to be tested; If there is no amplification, or If the amplification curve is an S-curve and the Ct value is >28, the strain to be tested is not or is suspected not to be Bacillus amyloliquefaciens; or Bacillus amyloliquefaciens does not exist or is suspected not to exist in the sample to be tested.

Images