A kit for detecting canine heart damage and its application

Abstract

The present invention belongs to the field of canine heart injury detection, and specifically relates to a kit for detecting canine heart injury and its application. The kit includes a probe, a conjugate or a kit that can realize cyclic amplification and quickly capture target miRNA under the assistance of DSN. The probe, conjugate and kit provided by the present invention can detect canine serum samples, and judge the canine heart injury according to the serum test results, and the accuracy is higher than that of conventional methods.

Description

Technical Field

[0001] The invention belongs to the field of canine heart injury detection, and particularly relates to a kit for detecting canine heart injury and an application thereof. Background Art

[0002] In dogs, valvular heart disease (VHD), also known as myxomatous mitral valve degeneration (MMVD), degenerative mitral valve disease (DMVD), valvular degenerative disease (VDD), or valvular disease, is a common heart disease caused by degeneration or pathology of the heart valves. This degeneration is often associated with valve impermeability, which in turn causes blood to backflow in the atrial appendages with each heartbeat. This results in a decrease in the amount of blood delivered to the arteries, which results in a large increase in the thickness of the mitral valve. The functional consequence of VHD is an increased volume and / or pressure load on the myocardium, leading to heart failure and its consequences: shortness of breath (or dyspnea), coughing, renal failure, or pulmonary edema. In addition, the disease can be exacerbated by genetics, stress, anxiety, hypoxia, infection, or endocrine disorders. In dogs, the degenerative changes of valvular disease are characterized by excessive production and deposition of extracellular matrix, disrupting the collagen content and organization in the leaflets and chordae tendineae (Serotonin concentrations in platelets, plasma, mitral valve leaflets, and left ventricular myocardial tissue in dogs with myxomatous mitral valve degeneration, SE Cremer et al., J Vet Intern Med 2014; 1-3). MMVD primarily affects small dogs such as Cavalier King Charles Spaniels, Yorkshire Terriers, and Poodles.

[0003] Cardiac troponin (cTnT) is a structural protein that exists in myofibril filaments. It has three subunits with different structures, troponin T (cTnT), troponin I (cTnI), and troponin C (cTnC), all encoded by different genes. Among them, cTnT is a specific antigen of the heart. It exists in the myocardium in two forms, free and bound, and is abundant. When the myocardium is damaged, it is rapidly released into the blood, with a half-life of 120 minutes in the blood. Its release kinetics are characterized by early appearance in the blood, long duration, and high peak concentration. As a marker of myocardial injury, it has very strong species specificity and almost no cross-reaction with skeletal muscle troponin. cTnT is currently considered to be one of the best direct pathological serum markers reflecting myocardial injury due to its high myocardial specificity, high sensitivity, and early diagnosis. Its diagnostic value far exceeds that of the previous creatine phosphoenzyme (CKMB) containing M and B subunits. Therefore, the determination of serum cTnT concentration can reflect the severity of myocardial damage. A high proportion of myocardial damage occurs in the early stages of critical illness, and it is believed that myocardial damage is associated with a high mortality rate in resuscitated patients. The success rate of resuscitation after cardiac arrest is low, and previous studies have shown that myocardial damage is one of the main causes of early death in patients after successful cardiopulmonary resuscitation. Summary of the invention

[0004] In view of this, the present invention provides a kit for detecting canine heart damage and its application.

[0005] One of the purposes of the present invention is to provide a probe for detecting canine cardiac injury, comprising:

[0006] Probe P208a-1:

[0007] Biotin-TTTTTTTTTACAAGCTTTTTGCTCGTCTTATCCCCCC-FAM,SEQ ID NO:3;

[0008] Probe P208b:

[0009] Biotin-TTTTTTTTTACAAACCTTTTGTTCGTCTTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-FAM, SEQ ID NO: 4.

[0010] One of the purposes of the present invention is to provide a conjugate for detecting canine cardiac injury, comprising streptavidin-coated nanomagnetic beads and the probe coupled to the nanomagnetic beads.

[0011] Wherein, the preparation method of the conjugate comprises:

[0012] The washed streptavidin-coated nanomagnetic beads were resuspended in buffer II, and the probe as described in claim 1 was added and gently shaken on a constant temperature shaker, and incubated for 20 minutes;

[0013] The obtained incubation product was magnetically separated, the supernatant was discarded, and the obtained precipitate was washed with buffer II to remove unbound probes, and then 1 mL of 6% BSA blocking solution was added and reacted for 2 h;

[0014] The product was washed with PBS buffer solution and resuspended with 100 μL of binding buffer II. The obtained conjugate was stored at 4°C.

[0015] Buffer II is 10 mM Tris-HCl, 1.0 mM EDTA, 2.0 M NaCl, pH 7.5.

[0016] One of the purposes of the present invention is to provide a kit for detecting canine cardiac injury, comprising the probe or the conjugate and a double-stranded specific nucleic acid cleavage enzyme.

[0017] Further, the kit also includes: buffer I: 5.0mM Tris-HCl, 0.5mM EDTA, 1.0M NaCl, pH 7.5; buffer II: 10mM Tris-HCl, 1.0mM EDTA, 2.0M NaCl, pH 7.5; hybridization buffer: 50mMTris-HCl, 25mM MgCl2, pH 8.0; TE buffer: 10mM Tris-HCl, 1mM EDTA-2Na, 12.5mM MgCl2, pH 8.0; sodium acetate buffer: 0.1M sodium acetate, 0.1M acetic acid, pH 3.5. Further, the kit also includes streptavidin-modified nanomagnetic beads.

[0018] Furthermore, the kit also includes: mobile phase A: 30mM ammonium dihydrogen phosphate + 10mM tetrabutylammonium bromide + 10mM L-3-bromocamphorsulfonic acid ammonium and 5% acetonitrile aqueous solution; mobile phase B: methanol + 10mM tetrabutylammonium dihydrogen phosphate.

[0019] One of the purposes of the present invention is to provide a method for detecting canine cardiac damage, comprising:

[0020] The conjugate is fully mixed with the sample to be tested, incubated at 40° C. for 180 min, and then the magnetic beads and unreacted DNA probes are separated from the solution using a magnet;

[0021] The supernatant was injected into the HPLC system for detection. The HPLC system included: A STAR RP-18 capped column (150 mm × 4.6 mm id, 5 μm) was used for the separation of miRNA, and the column temperature was maintained at 35°C; the fluorescence detector was set to an excitation wavelength of 495 nm and an emission wavelength of 520 nm; the flow rate was 1 mL / min; the injection volume was 2 μL; the same gradient elution was performed: gradient elution: the proportion of phase B changed from 10% to 60% within 20 min; mobile phase A: 30 mM ammonium dihydrogen phosphate + 10 mM tetrabutylammonium bromide + 10 mM L-3-bromocamphorsulfonic acid ammonium and 5% acetonitrile aqueous solution; mobile phase B: methanol + 10 mM tetrabutylammonium dihydrogen phosphate.

[0022] One of the purposes of the present invention is to provide the use of the probe or the conjugate in preparing a kit for detecting canine cardiac injury.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The probe provided by the present invention can be coupled to the surface of magnetic beads to form a conjugate, which is convenient for simultaneously detecting miRNA-208a and miRNA-208b.

[0025] The probe-coupled conjugate provided by the present invention can achieve cyclic amplification and quickly capture target miRNA with the assistance of DSN.

[0026] The probe, conjugate and kit provided by the present invention have a high degree of matching to the target miRNA and can counteract the interference of related mismatched sequences and other RNA sequences.

[0027] The probe, conjugate and kit provided by the present invention can detect canine serum samples, and can judge the canine heart damage according to the serum test results, and the accuracy is higher than that of conventional methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the fluorescence curve during the preparation of the conjugate of Preparation Group 1.

[0029] Figure 2 The fluorescence intensity of the target miRNA at different 20 pM was detected by using the conjugate prepared by preparation group 1.

[0030] Figure 3 The HPLC spectrum of the mixed solution of miRNA-208a and 100 pM miRNA-208b using the conjugate prepared by preparation group 1. Figure 3 A is the mobile phase 1, Figure 3 B is the mobile phase 2, Figure 3 C is using mobile phase 3, Figure 3 D: using mobile phase 4.

[0031] Figure 4 This is a statistical result graph of the sum of two chromatographic peak areas of HPLC detection of a mixed solution of 100 pM miRNA-208a and 100 pM miRNA-208b using the conjugates obtained from Preparation Group 1, Preparation Group 2, Preparation Group 3 and Preparation Group 4.

[0032] Figure 5 The HPLC chromatogram of the incubation supernatant when the conjugate prepared in preparation group 1 was used to detect the mixed solution of the positive sample of AMI dog. Figure 5 A is the mobile phase 1, Figure 5 B is the mobile phase 2, Figure 5 C is using mobile phase 3, Figure 5 D: using mobile phase 4.

[0033] Figure 6 This is a linear calibration curve of the logarithmic value (X) of the positive samples of AMI dogs with different dilutions detected by using the conjugate prepared in preparation group 1 and the sum of the chromatographic peak areas of miRNA-208a and miRNA-208b detected by HPLC (Y).

[0034] Figure 7 This is a statistical result of the relative expression values ​​of positive samples from different AMI dogs detected by real-time fluorescence quantitative PCR. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0036] 1. Instruments and reagents

[0037] Sigma 3-15 centrifuge (Osterodeam Harz, Germany). SX-610 digital pH meter (Shanghai Sanxin Electronic Equipment Co., Ltd.). FS5 fluorescence spectrophotometer (Edinburgh Instruments, UK). HPLC using LC-20A system (Shimadzu, Japan), equipped with Phenomenexclarity-3μmOligo-RP column, RP-20A fluorescence detector and LCsolution data analysis software. XL-30ESEMTEM microscope (Philips Co., Ltd.).

[0038] Double-strand specific nuclease (DSN, bEvrogen, Russia).

[0039] Tween20 (Annaiji Chemical Co., Ltd.). Tris(hydroxymethyl)aminomethane (Tris), MgCl2, NaCl, EDTA, HPLC-grade acetonitrile and methanol (Sinopharm Chemical Reagent Co., Ltd.). Triethylammonium acetate (TEAA) buffer (Sigma-Aldrich).

[0040] DNA and miRNA were synthesized by Shanghai Shengong Biotechnology Co., Ltd. and purified by HPLC. The sequences are shown in Table 1. NCodeTMEXPRESSSYBR GreenERTMmiRNAqRT-PCR Kit, NCode, TMVILO, TMmiRNAcDNA Synthesis Kit, EXPRESSSYBR GreenERTM qPCRSuperMixUniversal and ROX Reference Dye (Nanjing Shengong Medical Technology Co., Ltd.), and relevant data were obtained by qRT-PCR. All solutions were prepared with nuclease-free ultrapure water.

[0041] Buffer I: 5.0 mM Tris-HCl, 0.5 mM EDTA, 1.0 M NaCl, pH 7.5

[0042] Buffer II: 10 mM Tris-HCl, 1.0 mM EDTA, 2.0 M NaCl, pH 7.5

[0043] Hybridization buffer: 50 mM Tris-HCl, 25 mM MgCl2, pH 8.0 TE buffer: 10 mM Tris-HCl, 1 mM EDTA-2Na, 12.5 mM MgCl2, pH 8.0 Sodium acetate buffer: 0.1 M sodium acetate, 0.1 M acetic acid, pH 3.5

[0044] 2. Detection principle

[0045] Table 1 Target miRNA and probes

[0046]

[0047]

[0048] The present application utilizes the characteristics of DSN, which shows a strong cleavage preference for the DNA strand in the DNA-RNA hybrid, but does not cleave the RNA strand. Moreover, DSN can distinguish between perfectly matched double strands and incompletely matched double strands, which makes the detection based on DSN extremely selective.

[0049] This application integrates probes of different lengths with DSN-assisted target cyclic amplification to develop a highly sensitive HPLC-fluorescence detection method for simultaneous detection of multiple target miRNAs. This method enhances the signal of target miRNAs through DSN-mediated amplification and magnetic separation. After amplification, a very small amount of target miRNA is converted into a large amount of DNA cleavage probes, which are finally detected by HPLC.

[0050] This method has the following innovations: (1) It solves the difficulty of efficient detection of miRNA; (2) It is the first time to propose a sensitive miRNA detection method on a traditional HPLC-fluorescence platform (without the need for an expensive MS / MS system); (3) It can detect multiple miRNAs in a single test. Finally, the practicality and effectiveness of this method were verified by detecting miRNA-208a and miRNA-208b in canine serum samples.

[0051] When two target miRNAs (miRNA-208a and miRNA-208b) are added, the probes (P208a and P208b) fixed on the magnetic beads hybridize with their matching target miRNAs to form DNA / RNA heteroduplexes. DSN can selectively cut the probes in the heteroduplexes, release the target miRNA while maintaining the integrity of the target miRNA chain, and allow the target miRNA to participate in the hybridization reaction of the probes. Thus, each hybridization and one DSN cut constitutes a cycle, and after multiple reaction cycles, the solution contains a large number of fluorescently labeled probe fragments. After magnetic separation, the two fluorescently labeled probes of different lengths remain in the solution, while the magnetic beads and unreacted probes are completely removed.

[0052] Therefore, the fluorescence intensity of the solution is directly related to the concentration of the target miRNA, and the fluorescence signals of the two probes are different, which can be effectively distinguished by HPLC. Then, the solution after multiple reaction cycles is separated by magnetic beads and detected by HPLC with a fluorescence detector to achieve qualitative and quantitative detection of the target miRNA.

[0053] 2. Preparation of conjugates

[0054] The probes were coupled to the surface of streptavidin-coated nanomagnetic beads (Wuxi Biomag Biotechnology Co., Ltd.), and the binding ratio between the beads and the long and short probes was optimized. The specific operation is as follows:

[0055] Take 10 μL of 10 mg / mL streptavidin-modified nanomagnetic bead stock solution, perform magnetic separation, discard the supernatant, add 50 μL of binding buffer I to the precipitate, let it stand on the magnetic rack for 5 min, perform magnetic separation, discard the supernatant, and repeat washing 3 times.

[0056] Preparation group 1: Resuspend the washed magnetic beads in 50 μL of buffer II, add 5 μL of 10 μM P208a-1 and 5 μL of 10 μM P208b, shake gently on a constant temperature shaker, and incubate for 20 minutes. The obtained incubation product was magnetically separated, the supernatant was discarded, and the obtained precipitate was washed with buffer II to remove unbound probes, and then 1 mL of 6% BSA blocking solution was added and reacted for 2 hours. The product was washed with PBS buffer solution and resuspended with 100 μL of binding buffer II. The obtained conjugate was stored at 4°C. The fluorescence intensity of the supernatant was detected at an excitation wavelength of 495 nm and an emission wavelength of 518 nm.

[0057] Preparation group 2: Resuspend the washed magnetic beads in 50 μL of buffer II, add 5 μL of 10 μM P208a-2 and 5 μL of 10 μM P208b, shake gently on a constant temperature shaker, and incubate for 20 minutes. The obtained incubation product was magnetically separated, the supernatant was discarded, and the obtained precipitate was washed with buffer II to remove the unbound probe, and then 1 mL of 6% BSA blocking solution was added and reacted for 2 hours. The product was washed with PBS buffer solution and resuspended with 100 μL of binding buffer II. The obtained conjugate was stored at 4°C. The fluorescence intensity of the supernatant was detected at an excitation wavelength of 495 nm and an emission wavelength of 518 nm.

[0058] Preparation group 3: Resuspend the washed magnetic beads in 50 μL of buffer II, add 3 μL of 10 μM P208a-2 and 3 μL of 10 μM P208b, shake gently on a constant temperature shaker, and incubate for 20 minutes. The obtained incubation product was magnetically separated, the supernatant was discarded, and the obtained precipitate was washed with buffer II to remove unbound probes, and then 1 mL of 6% BSA blocking solution was added and reacted for 2 hours. The product was washed with PBS buffer solution and resuspended with 100 μL of binding buffer II. The obtained conjugate was stored at 4°C. The fluorescence intensity of the supernatant was detected at an excitation wavelength of 495 nm and an emission wavelength of 518 nm.

[0059] Preparation group 4: Resuspend the washed magnetic beads in 50 μL of buffer II, add 8 μL of 10 μM P208a-2 and 8 μL of 10 μM P208b, shake gently on a constant temperature shaker, and incubate for 20 minutes. The obtained incubation product was magnetically separated, the supernatant was discarded, and the obtained precipitate was washed with buffer II to remove unbound probes, and then 1 mL of 6% BSA blocking solution was added and reacted for 2 hours. The product was washed with PBS buffer solution and resuspended with 100 μL of binding buffer II. The obtained conjugate was stored at 4°C. The fluorescence intensity of the supernatant was detected at an excitation wavelength of 495 nm and an emission wavelength of 518 nm.

[0060] like Figure 1 As shown, the black color is the fluorescence curve before the probe is coupled, the pink color is the fluorescence curve after 5 minutes of probe coupling, the red color is the fluorescence curve after 15 minutes of probe coupling, and the blue color is the fluorescence curve after 20 minutes of probe coupling. Figure 1 It can be seen that the probe has a higher fluorescence intensity before coupling, and has a maximum fluorescence intensity at 520nm. As the coupling reaction with the magnetic beads proceeds, its fluorescence intensity continues to decrease, and at 20 minutes, the fluorescence intensity is almost the same as the background. This shows that the probe can be effectively coupled to the surface of the magnetic beads.

[0061] The conjugates obtained from preparation group 1 and preparation group 2 were subjected to Zeta potential detection. Results showed that the Zeta potential of the streptavidin-coated nanomagnetic beads was -4.81 mV, the Zeta potential of the conjugate obtained from preparation group 1 was -64.3 mV, the Zeta potential of the conjugate obtained from preparation group 2 was -56.7 mV, the Zeta potential of the conjugate obtained from preparation group 3 was -50.9 mV, and the Zeta potential of the conjugate obtained from preparation group 4 was -124.5 mV.

[0062] The conjugates obtained in preparation group 1 were used to detect 20 pM of target miRNA. The specific process is: 44 μL, 100 nM of the conjugate obtained in preparation group 1 was added to a centrifuge tube, and then 0.4 U of DSN, 5 μL 20 pM of miRNA-208a, miRNA-208a-1, miRNA-208a-2, miRNA-208b, miRNA-208b-1 or miRNA-208b-2 were added. In order to fully mix the reaction mixture, it was then shaken for about 2 seconds. After incubation at 40°C for 180 minutes, the magnetic beads and unreacted DNA probes were separated from the solution with a magnet. The fluorescence intensity of the supernatant was detected at an excitation wavelength of 495 nm and an emission wavelength of 520 nm.

[0063] Figure 2 The fluorescence intensity of the target miRNA at different 20 pM was detected by using the conjugate prepared by preparation group 1. Figure 2 As shown, miRNA-208a and miRNA-208b have higher fluorescence intensity, while miRNA-208a-1, miRNA-208a-2, miRNA-208b-1 or miRNA-208b-2 have no obvious fluorescence intensity, indicating that the conjugate provided by the present invention only has an obvious detection effect on the target miRNA, but has no obvious detection effect on the sequence with mismatched bases with the target miRNA.

[0064] In addition, combination 1 is a mixture of 5 μL 20 pM miRNA-208a and 5 μL 20 pM miRNA-208a-1, combination 2 is a mixture of 5 μL 20 pM miRNA-208a and 5 μL 20 pM miRNA-208a-2, combination 3 is a mixture of 5 μL 20 pM miRNA-208a, 5 μL 20 pM miRNA-208a-1 and 5 μL 20 pM miRNA-208a-2, combination 4 is a mixture of 5 μL 20 pM miRNA-208b and 5 μL 20 pM miRNA-208b-1, combination 5 is a mixture of 5 μL 20 pM miRNA-208b and 5 μL 20 pM miRNA-208b-2, and combination 6 is a mixture of 5 μL 20 pM miRNA-208a, 5 μL 20 pM miRNA-208a-2, 20pM miRNA-208b, 5μL 20pM miRNA-208b-1 and 5μL 20pM miRNA-208b-2. As a result, there was no significant difference in fluorescence intensity between combinations 1 to 3 and miRNA-208a, and there was no significant difference in fluorescence intensity between combinations 4 to 6 and miRNA-208b, which further indicated that the sequence with mismatched bases with the target miRNA had little interference with the detection of the target miRNA, indicating that the conjugate provided by the present invention not only has high selectivity for the target miRNA, but also can counteract the interference of related mismatched sequences and other RNA sequences.

[0065] 3. Detection

[0066] (1) Reaction

[0067] Before the target miRNA detection, all experimental conditions were optimized, including the dose of DSN, the concentration of magnesium ions, the incubation temperature and time. After optimization, it was found that the use of 0.4U of DSN to incubate the conjugate at 40℃ for 180min could best detect the target miRNA.

[0068] Detection process: 44 μL, 100 nM of the conjugate obtained from preparation group 1 was added to a centrifuge tube, followed by 0.4 U of DSN, 5 μL of 100 pM miRNA-208a, and 5 μL of 100 pM miRNA-208b. To fully mix the reaction mixture, it was then shaken for about 2 seconds. After incubation at 40°C for 180 minutes, the magnetic beads and unreacted DNA probes were separated from the solution with a magnet. Finally, the supernatant was injected into the HPLC system for separation and quantification.

[0069] (2)HPLC

[0070] HPLC analysis was performed using a Shimadzu LC-20A system equipped with a solvent delivery pump, autosampler, column oven, and Shimadzu RP-20A fluorescence detector. Data acquisition and processing were completed using LCsolution data analysis software. A STAR RP-18 capped column (150 mm × 4.6 mm id, 5 μm) was used for the separation of miRNA, and the column temperature was maintained at 35 °C. The fluorescence detector was set at an excitation wavelength of 495 nm and an emission wavelength of 520 nm. The flow rate was 1 mL / min. The injection volume was 2 μL. The same gradient elution was performed: the gradient elution was adopted: the proportion of phase B changed from 10% to 60% within 20 min. The retention time was calibrated by two-point calibration (RT-DPC).

[0071] (3) Mobile phase comparison

[0072] Mobile phase 1: Mobile phase A is composed of 50 mM triethylammonium acetate (TEAA) and 5% acetonitrile aqueous solution. Mobile phase B is methanol.

[0073] Mobile phase 2: Phase A: 40 mM ammonium acetate + 10 mM tetrabutylammonium bromide and 5% acetonitrile aqueous solution. Phase B: methanol + 10 mM tetrabutylammonium bromide.

[0074] Mobile phase 3: Phase A: 40 mM ammonium dihydrogen phosphate + 10 mM tetrabutylammonium bromide and 5% acetonitrile aqueous solution. Phase B: methanol + 10 mM tetrabutylammonium dihydrogen phosphate.

[0075] Mobile phase 4: Phase A: 30 mM ammonium dihydrogen phosphate + 10 mM tetrabutylammonium bromide + 10 mM L-3-bromocamphorsulfonic acid ammonium and 5% acetonitrile aqueous solution. Phase B: methanol + 10 mM tetrabutylammonium dihydrogen phosphate.

[0076] (4) Results

[0077] When the conjugate prepared in Preparation Group 1 was used to detect a mixed solution of 100 pM miRNA-208a and 100 pM miRNA-208b, the HPLC results of the incubation supernatant were as follows: Figure 3 shown. Figure 3 A shows the detection results using mobile phase 1, Figure 3 B shows the detection results using mobile phase 2, Figure 3 C shows the detection results using mobile phase 3, Figure 3 D shows the detection result using mobile phase 4.

[0078] The results show that when the mixed solution of miRNA-208a and 100pM miRNA-208b is detected using mobile phase 1, the retention time of miRNA-208a is 4.6min, and the retention time of miRNA-208b is 6.2min. Although the elution peaks of miRNA-208a and miRNA-208b are baseline separated, the retention time difference is small and the retention time is short. In the actual sample detection process, it may not be possible to effectively separate and realize the simultaneous detection of miRNA-208a and miRNA-208b.

[0079] When the mixed solution of miRNA-208a and 100 pM miRNA-208b was detected using mobile phase 2, the retention time of miRNA-208a was 9.1 min, and the retention time of miRNA-208b was 10.3 min. However, the elution peak of miRNA-208a had a long tail, and it was not baseline-separated from the elution peak of miRNA-208b.

[0080] When the mixed solution of miRNA-208a and 100pM miRNA-208b was detected using mobile phase 3, the retention time of miRNA-208a was 11.3min, and the retention time of miRNA-208b was 12.7min. However, the elution peak of miRNA-208a had a long tail, and its retention time was not much different from that of miRNA-208b. In the actual sample detection process, it may not be possible to effectively separate and realize the simultaneous detection of miRNA-208a and miRNA-208b.

[0081] When the mixed solution of miRNA-208a and 100 pM miRNA-208b was detected using mobile phase 4, the retention time of miRNA-208a was 9.05 min, and the retention time of miRNA-208b was 13.4 min. Not only were their retention times large, but the retention time difference was large, and the elution peaks were baseline separated, which is very beneficial for the detection of actual samples.

[0082] In addition, when the conjugates obtained from preparation group 1, preparation group 2, preparation group 3 and preparation group 4 were used to detect the mixed solution of 100 pM miRNA-208a and 100 pM miRNA-208b, the incubation supernatant was tested by HPLC using mobile phase 4, and the peak areas of the two chromatographic peaks of HPLC were counted. The results are as follows: Figure 4As shown, the chromatographic peak area of ​​the conjugate obtained in preparation group 1 is the largest during detection, indicating that the conjugate obtained in preparation group 1 has the greatest reaction sensitivity with miRNA-208a and miRNA-208b, which is very beneficial for the detection of actual samples and avoids interference or coverage of other impurity peaks or noise due to too small chromatographic peaks.

[0083] 4. Testing of canine serum samples

[0084] (1) Preparation of canine serum samples

[0085] RNA purification kit was used to extract miRNA from serum samples of healthy dogs and AMI dogs. Canine serum and Trizol reagent (total RNA extraction kit, AN51L758, Heyuan Liji (Shanghai) Biology) (1:5 volume ratio) were added to the same centrifuge tube and mixed, and then allowed to stand for 5 minutes to completely separate the protein and nucleic acid complexes. After adding 200 μL of chloroform, centrifuge and take the supernatant, then add 300 μL of anhydrous ethanol and mix well, transfer the solution to the adsorption column RM, and discard the adsorption column RM after centrifugation. 600 μL of anhydrous ethanol was added again, mixed and transferred to the adsorption column RS, and the adsorption column RS was retained after centrifugation, and the waste liquid was discarded. Then 700 μL RWT buffer and 500 μL RW2 buffer were added successively and centrifuged to wash the RS column. Then the adsorption column RS was placed at room temperature for a few minutes to completely dry. Finally, 50 μL of RNase-free water was added, and the RNA solution was collected after centrifugation at room temperature for 1 minute, which was used as the negative sample of the healthy dog ​​and the positive sample of the AMI dog.

[0086] The mass concentration of the total RNA solution and the absorbance values ​​at wavelengths of 260 nm and 280 nm were measured using an ultra-micro spectrophotometer. The RNA concentration in the positive samples of AMI dogs was determined to be 1253.67 ng / μL based on the size of A260 nm / A280 nm (for evaluation of protein contamination) and A260 nm / A230nm (for evaluation of organic solvent residues).

[0087] Diagnostic criteria for AMI in dogs: abnormal changes in the dog's electrocardiogram, with Q waves or QS waves appearing for more than one day; persistent abnormal myocardial enzyme spectrum or elevation followed by a decrease.

[0088] (2) Detection of positive samples of AMI dogs using different mobile phases

[0089] The above mobile phases 1 to 4 were also used to detect the positive samples of the AMI dogs. Detection process: 44 μL, 100 nM of the conjugate obtained from preparation group 1 was added to a centrifuge tube, and then 0.4 U of DSN and 10 μL of the positive sample of the AMI dog were added. In order to fully mix the reaction mixture, it was then shaken for about 2 seconds. After incubation at 40°C for 180 minutes, the magnetic beads and unreacted DNA probes were separated from the solution with a magnet. Finally, the supernatant was injected into the HPLC system for separation.

[0090] When the conjugate prepared in Preparation Group 1 was used to detect the mixed solution of the positive samples of AMI dogs, the HPLC results of the incubation supernatant were as follows: Figure 5 shown. Figure 5 A shows the detection results using mobile phase 1, Figure 5 B shows the detection results using mobile phase 2, Figure 5 C shows the detection results using mobile phase 3, Figure 5 D shows the detection result using mobile phase 4.

[0091] The results showed that two obvious baseline separation peaks could be obtained by using mobile phase 4, which had the best detection effect on positive samples of AMI dogs.

[0092] (3) Quantitative detection

[0093] The above-mentioned mobile phase 1 was used to detect the positive samples of the AMI dogs. Detection process: 44 μL, 100 nM of the conjugate obtained from preparation group 1 was added to a centrifuge tube, and then 0.4 U of DSN and 10 μL of the positive sample of the AMI dog (diluted with buffer II to 1253.67 ng / μL, 12.54 ng / μL, 1.25 ng / μL, 12.5 pg / μL, 0.125 pg / μL, 12.5 fg / μL and 1.25 fg / μL) were added. In order to fully mix the reaction mixture, it was then shaken for about 2 seconds. After incubation at 40°C for 180 minutes, the magnetic beads and unreacted DNA probes were separated from the solution with a magnet. Finally, the supernatant was injected into the HPLC system (mobile phase 4) for detection.

[0094] like Figure 6 The linear calibration curve of the logarithmic value (X) of the positive samples of AMI dogs at different dilutions and the sum of the chromatographic peak areas of miRNA-208a and miRNA-208b detected by HPLC (Y) is shown, Y=46523X+290470, R 2=0.9938, indicating a good linear relationship between the two. It can be seen that the method provided by the present invention can detect the concentrations of miRNA-208a and miRNA-208b in positive samples of AMI dogs with an RNA content of 1.25 fg / μL, and the detection is extremely sensitive.

[0095] (4) Real-time fluorescence quantitative PCR detection of MiR-208b

[0096] Real-time fluorescence quantitative PCR was used to detect the relative expression of MiR-208b in positive samples of AMI dogs (diluted with buffer II to 1253.67 ng / μL, 12.54 ng / μL, 1.25 ng / μL, 12.5 pg / μL, 0.125 pg / μL, 12.5 fg / μL and 1.25 fg / μL). U6snRNA was used as an internal reference. U6snRNA forward primer: CTCGCTYCGGCAGCACA, SEQ ID NO: 10, reverse primer: AACGCTCTCACGAATTTGCGT, SEQ ID NO: 11. MiR-208b forward primer: GCGCGATAAGACGAACAAAA, SEQ ID NO: 12, reverse primer: GTGCAGGGTCCGAGGT, SEQ ID NO: 13. Primer synthesis company: Nanjing GenScript Technology Co., Ltd. RNA concentration and purity determination: According to the cDNA first-strand synthesis kit (ThermoFisher K1622, USA), the reverse transcription system (two-step method) was prepared to a total volume of 20 μL. After mixing, the reaction was carried out on a common PCR instrument at 42°C for 1 hour, 70°C for 10 minutes, and 4°C for 5 minutes. The above products can be immediately used for the next PCR reaction or stored at -20°C. The PCR product was identified by agarose electrophoresis and the amplified fragment size was consistent with the target gene. -△△Ct The relative expression level of MiR-208b was detected by the method.

[0097] like Figure 7 As shown, the real-time fluorescence quantitative PCR detection has a large relative expression value only for 1253.67ng / μL and 12.54ng / μL, but has no obvious relative expression value for 1.25ng / μL, 12.5pg / μL, 0.125pg / μL, 12.5fg / μL and 1.25fg / μL, indicating that the real-time fluorescence quantitative PCR detection cannot detect the positive samples of AMI dogs of 1.25ng / μL, 12.5pg / μL, 0.125pg / μL, 12.5fg / μL and 1.25fg / μL, and its detection results are easily interfered by the reference gene and the test sample, and the detection sensitivity is obviously not as good as the probe, conjugate and kit provided by the present invention.

[0098] (5) Comparison of myocardial injury detection

[0099] Mice with abnormal electrocardiogram changes and Q waves or QS waves for more than one day were selected as AMI mice. Venous blood was drawn from AMI dogs during electrocardiogram and fasting venous blood from healthy dogs, centrifuged at 3000rpm for 10min, and serum was separated and tested within 2h. cTnT, cTnI and CK-MB kits were used to detect cTnT, cTnI and CK-MB on Olympus 5400 automatic biochemical analyzer, respectively. cTnT, cTnI and CK-MB detection kits were provided by Abbott Trading (Shanghai) Co., Ltd. and Witman (Nanjing) Co., Ltd., respectively. Reference range: CK-MB: 0-24U / L. The diagnostic values ​​of AMI were cTnT>0.1ng / mL and cTnI>0.5ng / mL. T test was used for inter-group test, and p<0.05 was considered statistically significant.

[0100] Table 2 shows the number of samples detected by using cTnT, cTnI, and CK-MB test kits to detect serum samples of AMI group and healthy dogs, respectively, to determine whether they are AMI dogs or healthy dogs. In addition, the probe and conjugate provided by the present invention are used to detect miRNA-208a and miRNA-208b to determine whether they are AMI dogs or healthy dogs. As shown in Table 1, the results of using the probe and conjugate provided by the present invention to detect miRNA-208a and miRNA-208b are consistent with the results of using cTnT, cTnI, and CK-MB test kits. However, the number of samples detected by using the probe and conjugate provided by the present invention for MI dogs or healthy dogs is more than these conventional test kits, and its detection accuracy is higher.

[0101] cTnT, cTnI, and CK-MB are conventional indicators for detecting myocardial injury. CK-MB is currently a commonly used indicator for diagnosing AMI, but CK-MB is not specific to the heart and is also present in small amounts in normal bones. False positives can also occur in renal failure and skeletal muscle diseases. Troponin is a contraction regulatory protein of myocardial and skeletal muscles, consisting of three subunits: troponin T (cTnT), troponin I (cTnI), and troponin C (cTnC). cTnT and cTnI combine to form a complex, which cannot penetrate the cell membrane into the blood circulation when the myocardial cell membrane is intact, so the content in the blood is extremely low. Moreover, cTnT and cTnI have a high tissue-to-serum concentration ratio. When the myocardium is damaged, they are quickly released from the cytoplasm and the concentration in the blood increases rapidly. Although cTnT and cTnI have a short half-life, the degradation process from the locally necrotic myofibrils lasts for a long time and can be maintained in the blood for a long time. Therefore, cTnT and cTnI are considered to be the best definitive markers of myocardial injury. However, due to the long window period of cTn, it is not effective in diagnosing recent infarction.

[0102] This shows that the probe, conjugate and test kit composed of the same provided by the present invention can be used to combine with specific miRNA in canine serum to achieve efficient detection of miRNA-208a and miRNA-208b. The determination of whether a dog has myocardial damage and the degree of myocardial damage based on the detection results of miRNA-208a and miRNA-208b is obviously higher than conventional indicators, and the detection accuracy is higher.

[0103] Table 2

[0104] AMI group healthy dog Number of samples 36 21 TvT 32 2 TnI 34 4 CK-MB 29 3 miRNA-208a 35 34 miRNA-208b 36 34

[0105] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A kit for detecting canine cardiac injury, comprising: Probe P208a-1: Biotin-TTTTTTTTTACAAGCTTTTTGCTCGTCTTATCCCCCC-FAM, SEQ ID NO: 3; Probe P208b: Biotin-TTTTTTTTTACAAACCTTTTGTTCGTCTTATTTTTTTTTTTTTTTTTTTTTTTTTTTTT-FAM, SEQ ID NO:4; Streptavidin-modified nanomagnetic beads; Double-strand specific nuclease; Buffer I: 5.0 mM Tris-HCl, 0.5 mM EDTA, 1.0 M NaCl, pH 7.5; Buffer II: 10 mM Tris-HCl, 1.0 mM EDTA, 2.0 M NaCl, pH 7.5; Hybridization buffer: 50 mM Tris-HCl, 25 mM MgCl2, pH 8.0; TE buffer: 10 mM Tris-HCl, 1 mM EDTA-2Na, 12.5 mM MgCl2, pH 8.0; Sodium acetate buffer: 0.1 M sodium acetate, 0.1 M acetic acid, pH 3.5; Mobile phase A: 30 mM ammonium dihydrogen phosphate, 10 mM tetrabutylammonium bromide, 10 mM L-3-bromocamphorsulfonic acid ammonium and 5% acetonitrile aqueous solution; Mobile phase B: methanol solution containing 10 mM tetrabutylammonium dihydrogen phosphate.

Images