Method and system for detecting gene editing material

Abstract

The invention aims to provide a method for detecting a gene editing material. The method comprises the following steps: constructing a plurality of specific recognition sequences; sequencing the gene segments according to the specific recognition sequence; and carrying out decoding on a sequencing result by adopting SuperDecode software. According to the invention, gene editing results of a large batch of samples can be rapidly detected, all types of mutations in a gene editing material can be comprehensively detected, and meanwhile, scientific researchers who are not skilled in applying various computer programming languages can conveniently carry out mutation analysis on sequencing results within a short time.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing result detection, and in particular to a method for detecting gene editing materials. Background Art

[0002] The detection of gene editing results mainly includes amplicon detection based on Sanger sequencing and amplicon detection based on next-generation sequencing (NGS). Sanger sequencing technology can detect fragments with a length of 700 to 1000bp with high accuracy, so Sanger sequencing is currently the gold standard for genotype detection. At the same time, with the development of bioinformatics, various mutation analysis software based on Sanger sequencing have also been developed, such as TIDE, ICE, DSDecode, etc. However, Sanger sequencing can only detect one sample at a time. For the genotype identification of large-scale samples, its efficiency is low and the sequencing cost is high. In addition, for complex mutation types and polyploid samples, Sanger sequencing is difficult to detect its results, and cannot meet the various needs of various scientific research on genotype detection of edited materials. In 2006, the development of NGS technology solved the problem of low Sanger sequencing throughput and inability to detect complex mutation types. Its principle is to break the DNA fragments, connect them to the connectors, and fix them on the chip. Amplification is performed by adding dNTP containing fluorescent signals, and the fluorescent signals are detected to determine the genotype of the target sample. Long-fragment sequencing is also called third-generation sequencing technology (TGS), which is mainly divided into single-molecule fluorescence sequencing technology and nanopore single-molecule sequencing technology. It can detect fragments larger than 10kb and perform coverage sequencing on a wide range of genome fragments. Therefore, it can detect and analyze experimental results such as large-fragment deletion and tiled deletion. Even though long-fragment sequencing will produce various errors during the sequencing process, they can be corrected through sequencing depth, so that the accuracy of its sequencing results can reach more than 99%. For long-fragment sequencing technology, it is currently mainly used for genome assembly, methylation detection, genome structural variation detection, etc. of samples, but has not been fully applied to the analysis of gene editing variation types.

[0003] At present, various sequencing technologies are very mature, and the deficiencies of various technologies can be compensated by each other, and the cost is getting lower and lower, which provides convenience for gene editing detection. However, there is currently a lack of a method for building libraries for large quantities of samples, which makes the detection of large quantities of gene editing samples costly and time-consuming. At the same time, analyzing sequencing results requires certain bioinformatics analysis capabilities and certain computer programming capabilities, and it is necessary to learn how to use different software, etc., which will take a lot of time. Summary of the invention

[0004] The purpose of the present invention is to provide a method for detecting gene editing materials, which can quickly detect the gene editing results of large batches of samples, comprehensively detect all types of mutations in gene editing materials, and at the same time facilitate scientific researchers who are not proficient in using various computer programming languages ​​to analyze sequencing results in a short time.

[0005] A method for detecting gene editing materials, comprising:

[0006] Constructing multiple specific recognition sequences;

[0007] Sequencing the gene fragment according to the specific recognition sequence;

[0008] SuperDecode software was used to perform mutation analysis on the sequencing results.

[0009] Preferably, the construction of multiple specific recognition sequences comprises:

[0010] Add position-barcode, plate-barcode and library-barcode specific recognition sequence libraries to sample amplicons;

[0011] The position-barcode sequence library includes 192 specific position-barcode sequences, 96 specific recognition sequences for NGS library construction and 96 specific recognition sequences for TGS library construction;

[0012] The plate-barcode sequence library includes 102 specific plate-barcode sequences, 96 of which are used for NGS library construction and 6 for TGS library construction;

[0013] The library-barcode sequence library includes 20 specific library-barcode sequences, all of which are used for NGS library construction.

[0014] Preferably, sequencing the gene fragment according to the specific recognition sequence comprises:

[0015] The gene fragments were subjected to Sanger sequencing, NGS, and TGS.

[0016] Preferably, the use of SuperDecode software to perform mutation analysis on the sequencing results includes performing mutation analysis on the Sanger sequencing results, specifically:

[0017] Obtain the first project information of the current mutation analysis according to the file and settings input by the user;

[0018] Use the DsD (Degenerate Sequence Decoding) sequencing overlapping peak diagram decoding principle to read the overlapping peaks in the Sanger sequencing results;

[0019] Based on the sequence analysis software, the corresponding sequence is searched in the wild-type sequence, the Sanger sequencing results of the amplicon are subjected to mutation analysis, and the variation type of the target sample at the target sequence is read.

[0020] Preferably, the use of SuperDecode software to perform mutation analysis on sequencing results includes performing mutation analysis on NGS results, specifically:

[0021] Obtain the second project information of the current mutation analysis according to the file and settings input by the user;

[0022] Merge and complete paired reads in double-end sequencing into complete sequences, and split the library based on sample-specific recognition sequences;

[0023] The reads are mapped to specific samples, and the sample reads are compared with the reference sequence through sequence alignment methods to obtain the variation information of the sample.

[0024] Preferably, the use of SuperDecode software to perform mutation analysis on the sequencing results includes performing mutation analysis on the TGS results, specifically:

[0025] Obtain the third project information of the current mutation analysis according to the files and settings input by the user;

[0026] Split the library based on sample-specific recognition sequences and map reads to specific samples;

[0027] The common sequences in all reads of a specific sample are extracted to remove random mutations caused by sequencing. Finally, the reads of the sample are aligned with the reference sequence using a sequence alignment method to obtain sample variation information.

[0028] Preferably, the obtaining the first project information of the current mutation analysis according to the file and settings input by the user comprises:

[0029] The first project information includes: amplicon wild-type sequence information, a Sanger sequencing result file of the sample amplicon, and an optional first setting condition.

[0030] Preferably, the step of obtaining the second project information of the current mutation analysis according to the file and settings input by the user comprises:

[0031] The second project information includes: amplicon wild-type sequence information, gene editing target sequence information, sample NGS result information, specific identification sequence information corresponding to each sample, and optional second setting conditions;

[0032] The optional second setting condition is the setting of mutation analysis parameters, including:

[0033] Sample analysis mode, options include diploid, polyploid and low frequency;

[0034] Output threshold, used to set the threshold for result output;

[0035] The number of running threads is used to set the number of threads used for program running and adjust the HiDecode decoding running speed.

[0036] Preferably, the step of obtaining the third item information of the current mutation analysis according to the file and settings input by the user includes:

[0037] The third project information includes: amplicon wild-type sequence information, gene editing target sequence information, sample TGS result information, specific recognition sequence information corresponding to each sample, and optional third setting conditions;

[0038] The optional third setting condition is the setting of mutation analysis parameters, including:

[0039] Sample analysis mode, options include diploid, polyploid and low frequency;

[0040] Output threshold, used to set the threshold for result output;

[0041] The number of running threads is used to set the number of threads used for program running and adjust the LaDecode decoding running speed.

[0042] A system for detecting gene editing materials, comprising:

[0043] A data acquisition module, used to construct a variety of specific recognition sequences;

[0044] A sequencing module, used for sequencing the gene fragments according to the specific recognition sequence;

[0045] The analysis module is used to perform mutation analysis on the sequencing results using SuperDecode software.

[0046] The beneficial effects of the present invention are as follows: 1. The present invention constructs amplicons for gene editing materials based on the PCR amplification method, and introduces specific recognition sequences, which quickly and cheaply realizes the construction of NGS and TGS libraries for large quantities of samples; 2. The present invention develops SuperDecode, a software for detecting gene editing materials, which can perform mutation analysis on the currently commonly used Sanger, NGS and TGS results, and can detect all types of mutations in samples, including large fragment deletions, sequence insertions, single base mutations, mosaic mutations, etc.; 3. SuperDecode developed by the present invention is a Window platform software. Compared with the web version tool, SuperDecode can quickly read the sequencing result files of a large number of samples and perform mutation analysis. For tools of the Linux system, SuperDecode provides a convenient and concise operational interface, which is convenient for scientific researchers to use and greatly improves the efficiency of gene editing material detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0048] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0049] Figure 1 A flow chart of a method for detecting gene editing materials of the present invention;

[0050] Figure 2 This is a flow chart of the NGS library construction of large quantities of samples of the present invention;

[0051] Figure 3 This is a graph showing the results of NGS sample library construction in the present invention;

[0052] Figure 4 This is a graph showing the results of HiDecode testing an NGS sample according to the present invention;

[0053] Figure 5 This is a diagram showing the detection results of rice protoplast samples using HiDecode in the present invention;

[0054] Figure 6 The flowchart of TGS sample library construction of the present invention;

[0055] Figure 7 This is a graph showing the detection results of TGS samples using LaDecode of the present invention;

[0056] Figure 8 This is a diagram of the rice Ehd1 promoter tiling deletion detection result based on LaDecode mutation analysis of the present invention. DETAILED DESCRIPTION

[0057] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0058] It should be noted that all directional indications in the embodiments of the present invention (such as up, down, left, right, front, back, etc.) are only used to explain the relative position relationship, movement status, etc. between the components under a certain specific posture (as shown in the accompanying drawings). If the specific posture changes, the directional indication will also change accordingly.

[0059] In addition, the descriptions of "first", "second", etc. in the present invention are only used for descriptive purposes and cannot be understood as indicating or implying their relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In addition, the technical solutions between the various embodiments can be combined with each other, but they must be based on the ability of ordinary technicians in the field to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0060] At present, various sequencing technologies are very mature, and the deficiencies of various technologies can be compensated by each other, and the cost is getting lower and lower, which provides convenience for gene editing detection. However, there is currently a lack of a method for building libraries for large quantities of samples, which makes the detection of large quantities of gene editing samples costly and time-consuming. At the same time, analyzing sequencing results requires certain bioinformatics analysis capabilities and certain computer programming capabilities, and it is necessary to learn how to use different software, etc., which will take a lot of time.

[0061] The present invention is based on the method of PCR amplification, constructs amplicons for gene editing materials, and introduces specific recognition sequences, and realizes the construction of NGS and TGS libraries of large quantities of samples quickly and at low cost; the present invention develops SuperDecode, a software for detecting gene editing materials, which can perform mutation analysis on the currently commonly used Sanger, NGS and TGS results, and can detect all types of mutations in samples, including large fragment deletion, sequence insertion, single base mutation, mosaic mutation, etc.; SuperDecode developed by the present invention is a Window platform software. Compared with the web version tool, SuperDecode can quickly read the sequencing result files of a large number of samples and perform mutation analysis. For tools of Linux system, SuperDecode provides a convenient and concise operational interface, which is convenient for scientific researchers to use and greatly improves the efficiency of gene editing material detection.

[0062] Example 1

[0063] A method for detecting gene editing materials, reference Figure 1 ,include:

[0064] S100, construction of multiple specific recognition sequences;

[0065] S200, sequencing of gene fragments according to specific recognition sequences;

[0066] S300, and SuperDecode software was used to perform mutation analysis on the sequencing results.

[0067] In order to quickly detect the gene editing results of large quantities of samples, comprehensively detect all types of mutations in gene editing materials, and facilitate scientific researchers who are not proficient in various computer programming languages ​​to analyze sequencing results in a short time, the present invention provides an NGS amplicon library construction method applicable to 9,216 samples, a TGS amplicon library construction method for 576 samples, and a method for using the software SuperDecode applicable to Sanger sequencing, NGS, and TGS result mutation analysis. SperDecode is software for Windows, macOS, and Linux systems, which can detect all types of mutations in samples and add a sequencing result quality control function to make the detection results more reliable.

[0068] Preferably, reference Figure 2 and Figure 6 , S100, construct a variety of specific recognition sequences including:

[0069] Add position-barcode, late-barcode and Library-barcode specific recognition sequence libraries to sample amplicons;

[0070] The position-barcode sequence library includes 192 specific position-barcode sequences, 96 specific recognition sequences for NGS library construction and 96 specific recognition sequences for TGS library construction;

[0071] The plate-barcode sequence library includes 102 specific plate-barcode sequences, 96 of which are used for NGS library construction and 6 for TGS library construction;

[0072] The library-barcode sequence library includes 20 specific library-barcode sequences, all of which are used for NGS library construction.

[0073] NGS library construction method for large-scale sample testing

[0074] The present invention can realize specific identification of up to 184,320 NGS amplicon samples by adding three specific identification sequences, namely position-barcode, plate-barcode and library-barcode, to the sample amplicon.

[0075] Specifically, the NGS library of the present invention contains 96 specific position-barcode sequences, which can specifically correspond the samples to positions A1 to H12 on a 96-well PCR plate;

[0076] Specifically, the NGS library of the present invention includes 96 specific plate-barcode sequences, which can specifically correspond samples to different 96-well PCR plates;

[0077] Specifically, the NGS library construction of the present invention includes 20 specific library-barcode sequences, which can specifically correspond samples to different libraries.

[0078] TGS library construction method for large-scale sample detection

[0079] In a first aspect, the present invention can realize specific identification of up to 576 amplicon samples by adding two specific identification sequences, position-barcode and plate-barcode, to the sample amplicons.

[0080] Specifically, the TGS library construction described in the present invention contains 96 specific position-barcode sequences, which can specifically correspond the samples to positions A1 to H12 on a 96-well PCR plate;

[0081] Specifically, the TGS library construction described in the present invention includes 6 specific plate-barcode sequences, which can specifically correspond samples to different 96-well PCR plates.

[0082] Preferably, S200, sequencing the gene fragment according to the specific recognition sequence comprises:

[0083] The gene fragments were subjected to Sanger sequencing, NGS, and TGS.

[0084] Preferably, S300, performing mutation analysis on the sequencing results using SuperDecode software includes performing mutation analysis on the Sanger sequencing results, specifically:

[0085] Obtain the first project information of the current mutation analysis according to the file and settings input by the user;

[0086] Using the DsD sequencing overlapping peak diagram decoding principle, read the overlapping peaks in the Sanger sequencing results;

[0087] Based on the sequence analysis software, the corresponding sequence is searched in the wild-type sequence, the Sanger sequencing results of the amplicon are subjected to mutation analysis, and the variation type of the target sample at the target sequence is read.

[0088] A module DsDecodeMS for decoding Sanger sequencing results, wherein the analysis steps include:

[0089] According to the files and settings input by the user, the project information of the current analysis is obtained, including the wild-type sequence information of the amplicon, the Sanger sequencing result file of the sample amplicon, and the optional setting conditions;

[0090] The DsD sequencing overlapping peak diagram decoding principle is used to read the overlapping peaks in the Sanger sequencing results, and the corresponding sequence is searched in the wild-type sequence based on the sequence analysis software, so as to perform mutation analysis on the Sanger sequencing results of the amplicon and read the variation type of the target sample at the target sequence.

[0091] Specifically, the wild-type sequence of the amplicon is the gene sequence of the sample before gene editing.

[0092] Specifically, the optional setting conditions are settings for mutation analysis parameters, including:

[0093] Target sequence, used to quickly retrieve mutations at specific locations in target samples;

[0094] Fluorescence signal threshold, site sequencing confidence value. If the fluorescence signal value of a certain base is greater than the confidence value, it is a valid sequencing result. The default value is 0.25;

[0095] The length of the anchor sequence and the degenerate sequence, and the length of the sequences intercepted upstream and downstream of the mutation site;

[0096] The terminal sequence removal setting removes the low-quality terminal sequences based on the set ratio or Richard Mott algorithm to remove the influence of low-quality sequences on mutation analysis and improve the accuracy of mutation analysis.

[0097] Optionally, the Sanger sequencing file of the input sample amplicon can be used to detect the sequencing quality in the peak graph display area, and the sample target sequence can be quickly located in the peak graph display area through the sequence search function.

[0098] Preferably, reference Figure 4 and Figure 5 , S300, using SuperDecode software to perform mutation analysis on sequencing results, including mutation analysis on NGS results, specifically:

[0099] Obtain the second project information of the current mutation analysis according to the file and settings input by the user;

[0100] Merge and complete paired reads in double-end sequencing into complete sequences, and split the library based on sample-specific recognition sequences;

[0101] The reads are mapped to specific samples, and the sample reads are compared with the reference sequence through sequence alignment methods to obtain the variation information of the sample.

[0102] According to the files and settings entered by the user, the project information currently being analyzed is obtained, including amplicon wild-type sequence information, gene editing target sequence information, sample NGS result information, specific identification sequence information corresponding to each sample, and optional setting conditions. HiDecode will merge and complete the paired reads in double-end sequencing into a complete sequence, split the library based on the specific identification sequence of the sample, correspond the reads to the specific sample, and then compare the sample reads with the reference sequence through the sequence alignment method to obtain the sample variation information.

[0103] Specifically, the amplicon wild-type sequence is the DNA sequence of the sample before gene editing.

[0104] Specifically, the sample NGS result information is the sample second-generation sequencing result, usually a double-end sequencing result, including two sequencing files R1 and R2.

[0105] Specifically, the target sequence information for gene editing is the DNA sequence targeted by the gene editing tool.

[0106] Specifically, the sample-specific sequence is the position-barcode sequence and plate-barcode sequence used in NGS library construction, which are used for HiDecode to correspond the results to specific samples.

[0107] Preferably, reference Figure 7 and Figure 8 , S300, using SuperDecode software to perform mutation analysis on sequencing results, including mutation analysis on TGS results, specifically:

[0108] Get the third project information of the current analysis according to the files and settings input by the user;

[0109] Split the library based on sample-specific recognition sequences and map reads to specific samples;

[0110] The common sequences in all reads of a specific sample are extracted to remove random mutations caused by sequencing. Finally, the reads of the sample are aligned with the reference sequence using an alignment method to obtain sample variation information.

[0111] Specifically, the wild-type sequence of the amplicon is the DNA sequence of the sample before gene editing.

[0112] Specifically, the targeting sequence information of gene editing is the DNA sequence targeted by the gene editing tool.

[0113] Specifically, the sample-specific sequence is the position-barcode sequence and plate-barcode sequence used in TGS sample library construction, which are used for LaDecode to correspond the results to specific samples.

[0114] Preferably, obtaining the first project information currently being analyzed according to the file and settings input by the user includes:

[0115] The first project information includes: amplicon wild-type sequence information, a Sanger sequencing result file of the sample amplicon, and an optional first setting condition.

[0116] Preferably, obtaining the second project information of the current mutation analysis according to the file and settings input by the user includes:

[0117] The second project information includes: amplicon wild-type sequence information, gene editing target sequence information, sample NGS result information, specific identification sequence information corresponding to each sample, and optional second setting conditions;

[0118] The optional second setting condition is the setting of mutation analysis parameters, including:

[0119] Sample analysis mode, options include diploid, polyploid and low frequency;

[0120] Output threshold, used to set the threshold for result output;

[0121] The number of running threads is used to set the number of threads used for program running and adjust the HiDecode decoding running speed.

[0122] Sample analysis mode, this setting is located in the Model setting option of HiDecode, and there are three modes to choose from: diploid, polyploid, and low frequency. Diploid represents the diploid mode, which is used to detect the gene editing results of diploid samples, such as rice materials. The output results in this mode are the genotypes of alleles on a pair of chromosomes. The polyploid mode is used to detect the gene editing results of polyploid samples. The low frequency mode is mainly used to detect the gene editing results of cell lines, such as rice protoplasts, callus and other materials;

[0123] Output threshold, this setting is located in the Threshold setting option in HiDecode, which is used to set the threshold for result output. That is, if the percentage content of a certain genotype in the result is greater than the set threshold, the genotype is considered to be a reliable result in the sample test result. Genotypes below the threshold are caused by errors in PCR amplification or sequencing. The default output threshold is 0.25 in diploid mode, 0.1 in polyploid mode, and 0.0025 in low frequency;

[0124] The number of running threads is located in the CPU thread setting option in HiDecode. It can be used to set the number of threads used for program running and adjust the HiDecode decoding running speed.

[0125] Preferably, obtaining the third item information currently analyzed according to the file and settings input by the user includes:

[0126] The third project information includes: amplicon wild-type sequence information, gene editing target sequence information, sample TGS result information, specific recognition sequence information corresponding to each sample, and optional third setting conditions;

[0127] The optional third setting condition is the setting of mutation analysis parameters, including:

[0128] Sample analysis mode, options include diploid, polyploid and low frequency;

[0129] Output threshold, used to set the threshold for result output;

[0130] The number of running threads is used to set the number of threads used for program running and adjust the LaDecode decoding running speed.

[0131] According to the files and settings entered by the user, the project information of the current mutation analysis is obtained, including the wild-type sequence information of the amplicon, the targeted sequence information of the gene editing, the sample TGS result information, the specific recognition sequence information corresponding to each sample, and the optional setting conditions. LaDecode will split the library based on the specific recognition sequence of the sample, correspond the reads to the specific sample, and then extract the common sequence in all reads of the specific sample to remove the random mutations caused by sequencing. Finally, the reads of the sample are compared with the reference sequence using the sequence alignment method to obtain the sample variation information.

[0132] Specifically, the amplicon wild-type sequence is the DNA sequence of the sample before gene editing.

[0133] Specifically, the target sequence information for gene editing is the DNA sequence targeted by the gene editing tool.

[0134] Specifically, the sample-specific sequence is the position-barcode sequence and plate-barcode sequence used in TGS sample library construction, which are used for LaDecode to correspond the results to specific samples.

[0135] Specifically, the optional setting conditions are settings for mutation analysis parameters, including:

[0136] Sample analysis mode, this setting is located in the Model setting option of LaDecode, and there are three modes to choose from: diploid, polyploid, and low frequency. Diploid represents the diploid mode, which is used to detect the gene editing results of diploid samples, such as rice materials. The output results in this mode are the genotypes of alleles on a pair of chromosomes. The polyploid mode is used to detect the gene editing results of polyploid samples. The low frequency mode is mainly used to detect the gene editing results of cell lines, such as rice protoplasts, callus tissue and other materials;

[0137] Output threshold, this setting is located in the Threshold setting option in LaDecode, which is used to set the threshold for result output. That is, if the percentage content of a certain genotype in the result is greater than the set threshold, the genotype is considered to be a reliable result in the sample test result. Genotypes below the threshold are caused by errors in PCR amplification or sequencing. The result output threshold in diploid mode is 0.25, in polyploid mode is 0.1, and in low frequency is 0.0025;

[0138] The number of running threads is located in the CPU thread setting option in LaDecode. It can be used to set the number of threads used for program running and adjust the running speed of LaDecode.

[0139] Example 2

[0140] A system for detecting gene editing materials, comprising:

[0141] A data acquisition module, used to construct a variety of specific recognition sequences;

[0142] A sequencing module, used to sequence gene fragments according to specific recognition sequences;

[0143] The analysis module is used to perform mutation analysis on the sequencing results using SuperDecode software.

[0144] The sources of some reagents involved in the examples are as follows:

[0145] Manitol, NaCl, MES, KCl, MgCl2·6H2O, PEG4000, Bovine Serum Albumin, and CaCl2·2H2O were purchased from Sigma;

[0146] MES (0.2 M): weigh 3.9048 g of MES, dilute to 100 mL with sterile double distilled water, adjust the pH to 5.7 with 1 M KOH, and filter with a 0.22 μm filter membrane.

[0147] CaCl2·2H2O (1M): Weigh 14.701 g of CaCl2·2H2O, dilute to 100 mL with sterile double distilled water, and filter using a 0.22 μm filter membrane.

[0148] KCl (2M): Weigh 14.91 g of KCl, dilute to 100 mL with sterile double-distilled water, and filter using a 0.22 μm filter membrane.

[0149] MgCl2·6H2O (0.5M): Weigh 10.165 g of MgCl2·6H2O, dilute to 100 mL with sterile double distilled water, and filter using a 0.22 μm filter membrane.

[0150] MMG: Weigh 9.11 g of Manitol, 3 mL of MgCl2·6H2O (0.5 M), and 1 mL of MES (200 mM), mix, dilute to 100 mL with sterile double distilled water, and filter with a 0.22 μm filter membrane.

[0151] W5: Weigh 0.9 g of NaCl, 1.838 g of CaCl2·2H2O, 0.25 mL of KCl (2 M), and 1 mL of MES (0.2 M), mix, dilute to 100 mL with sterile double distilled water, and filter with a 0.22 μm filter membrane.

[0152] PEG4000: Weigh 40 g of PEG4000, 3.644 g of Manitol, and 10 mL of CaCl2·2H2O (1 M). Mix the mixture, make up to 100 mL with sterile double distilled water, and filter with a 0.22 μm filter membrane.

[0153] Enzyme Solution: Weigh 10.932 g of Manitol, 0.1 g of Bovine Serum Albumin, 5 mL of MES (0.2 M), 1.5 g of Cellulase RS, and 0.75 g of Macerozyme R10, mix, and dilute to 100 mL with sterile double distilled water. Adjust the pH to 5.7 with KOH, and filter with a 0.22 μm filter membrane.

[0154] Example 1. NGS library construction for large-scale samples

[0155] In this example, NGS library was constructed for rice editing materials of OTUB1 gene, and the selected gene sequence was:

[0156] CTCCTTTATTGGTGCTTGATCTACAACTGGTGTTTTACTTTTTTACAAAAAAATGTAATCTCCTTGCAGTGCACTCAAATTATTGCAACCTCCTTCCTTATGTTCCCACCCTCATTATTTTCAGATATTCATTGATCAGCTGGAAAGTGTTCTG CAGGGACATGAATCCTCCATAGGGTAAATATCCTAGAGTTATATTTGTATCCTTAATGCATATGACCAATAATCATGTATTAACAACAAGCAATTTTTGTAATTGTTTATAAAGTATGGCATGTCCATCATAAATGTTTTCCTTCTGTAGTGAATCTATTTTGTTTTCCTG (the underlined region is the targeted region).

[0157] The amplicon of the gene editing material was constructed, and specific primers were designed at 80-160 bp upstream and downstream of the detection site. The sample amplicon specific amplification primers designed in this implementation case are:

[0158] Forward primer T#F: 5'-ctcggagtgatcgcacTTATTGCAACCTCCTTCCT-3' (concentration 10 μM)

[0159] Reverse primer T#R: 5'-ctgagaggctggatggATGATGGACATGCCATAC-3' (concentration 10 μM)

[0160] The amplification primer sequences used in the second / third round of PCR reactions in this case are:

[0161] Plate-01 (10 μM): CAGACGTGTGCTCTTCCGATCTctgtAGTTTTctgagaggctggatgg (the bold font is the Plate-01 specific recognition sequence)

[0162] Pos N -F (10 μM): CGCTCTTCCGATCTgtcaNNNNNNctcggagtgatcgcac (the italic part is Pos N -F specific recognition sequence)

[0163] Lib-F (10μM): AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCA

[0164] Lib-R (10 μM): CAAGCAGAAGACGGCATACGAGATGCAATCCAGTGACTGGAGTTCAGACGTGTGCTCTTC (the underlined dashed line is the library-specific recognition sequence)

[0165] The NGS sample library of the present invention is as follows Figure 2 As shown, it can be divided into a two-step method and a three-step method, where the two-step method steps are:

[0166] The number of samples tested in this implementation case is 10, and the samples to be tested are dispensed into each well of a 96-well PCR using a multichannel pipette or an ordinary pipette. The total PCR reaction solution is prepared according to the number of samples tested, and the PCR reaction system in each well is 15 μL. The content of each component in the system is: 2×Taq mix 7.5 μL, forward primer T#F and reverse primer T#R 0.3 μl each, double distilled water 5.9 μL, and the PCR reaction system is dispensed into each well of a 96-well PCR using a multichannel pipette or an ordinary pipette, and then the template DNA of the above-mentioned dispensed sample (approximately 0.5 μL-1 μL) is taken using a 96-well needle sampler and added to each PCR reaction system. The PCR reaction is carried out, and the PCR reaction program is: 94°C pre-denaturation for 3 minutes, 95°C denaturation for 15 seconds, 55°C annealing for 20 seconds, 72°C extension for 20 seconds, a total of 26-28 cycles, and 72°C final extension for 2 minutes.

[0167] The sequence of the fragment after the first round of PCR reaction amplification in this example is:

[0168] ctcggagtgatcgcacTTATTGCAACCTCCTTCCTTATGTTCCCACCCTCATTATTTTCAGATATTCATTGATCAGCTGGAAAGTGTTCTG CAGGGACATGAATCCTCCAT AGGGTAAATATCCTAGAGTTATATTTGTATCCTTAATGCATATGACCAATAATCATGTATTAACAACAAGCAATTTTTGTAATTGTTTATAAAGTATGGCATGTCCATCATccatccagcctctcag (the underlined area is the target area)

[0169] The first round PCR reaction product was diluted 10 times with double distilled water. N -F primer (10μM) was diluted to 1μM using 0.3×TE and then dispensed into a 96-well PCR plate. Then, the total PCR reaction solution was prepared according to the number of samples to be tested. The PCR reaction system in each well was 15μL. The content of each component in the system was: 2×Taq mix 7.5μL, Plate-01 (10μM) 0.08μL (the final concentration added to the reaction system was 0.05μM), Lib-F (10μM) and Lib-R (10μM) 0.4μL each (the final concentration added to the reaction system was 0.26μM), and double distilled water 4.62μL. Use a multichannel pipette or an ordinary pipette to dispense the PCR reaction system into each well of the 96-well PCR, and then use a 96-well needle sampler to take the above-dispensed Pos N-F primer (about 1 μL) was added to each PCR reaction system, and the 10-fold diluted first-round PCR product (about 0.5 μL-1 μL) was taken using a 96-well needle sampler and added to each PCR reaction system. PCR reaction was performed, and the PCR reaction program was: 94°C denaturation for 15s, 55°C annealing for 20s, 63°C extension for 3s, 70°C extension for 10s, 63°C extension for 3s, 70°C extension for 5s, a total of 8 cycles, 94°C denaturation for 15s, 63°C annealing / extension for 10s, 70°C extension for 10s, 63°C annealing / extension for 5s, 70°C annealing / extension for 5s, a total of 10-12 cycles, and 68°C final extension for 1min.

[0170] The sequence of the product amplified by the second round of PCR reaction in this example is:

[0171] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtcaNNNNNNctcggagtgatcgcacTTATTGCAACCTCCTTCCTTATGTTCCCACCCTCATTATTTTCAGATATTCATTGATCAGCTGGAAAGTGTTCTG CAGGGACATGAATCCTCCAT AGGGTAAATATCCTAGAGTTATATTTGTATCCTTAATGCATATGACCAATAATCATGTATTAACAACAAGCAATTTTTGTAATTGTTTATAAAGTATGGCATGTCCATCATccatccagcctctcagAAAACTACAGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC T GGATTGCATCTCGTATGCCGTCTTCTGCTTG (the underlined solid line area is the target area, and the italic part is Pos N -F specific recognition sequence, the bold font is the Plate-01 specific recognition sequence, and the underlined dotted part is the library specific recognition sequence)

[0172] Take 5 μL of the second round PCR reaction products and mix them in a 1.5mL-5mL centrifuge tube. Pipette 200 μL of the mixed product and perform 1% agarose gel electrophoresis to recover the target fragments and send them to the company for NGS.

[0173] The three-step method for NGS sample library construction of the present invention is as follows:

[0174] The number of samples tested in this implementation case is 10, and the samples to be tested are dispensed into each well of a 96-well PCR using a multichannel pipette or an ordinary pipette. The total PCR reaction solution is prepared according to the number of samples tested, and the PCR reaction system in each well is 15 μL. The content of each component in the system is: 2×Taq mix 7.5 μL, forward primer T#F and reverse primer T#R 0.3 μl each, double distilled water 5.9 μL. Use a multichannel pipette or an ordinary pipette to dispense the PCR reaction system into each well of a 96-well PCR, and then use a 96-well needle sampler to take the template DNA of the above-mentioned dispensed sample (approximately 0.5 μL-1 μL) and add it to each PCR reaction system. Perform PCR reaction, and the PCR reaction program is: 94°C pre-denaturation for 3 minutes, 95°C denaturation for 15 seconds, 55°C annealing for 20 seconds, 72°C extension for 20 seconds, a total of 26-28 cycles, and 72°C final extension for 2 minutes.

[0175] The sequence of the fragment after the first round of PCR amplification in this example is:

[0176] ctcggagtgatcgcacTTATTGCAACCTCCTTCCTTATGTTCCCACCCTCATTATTTTCAGATATTCATTGATCAGCTGGAAAGTGTTCTG CAGGGACATGAATCCTCCAT AGGGTAAATATCCTAGAGTTATATTTGTATCCTTAATGCATATGACCAATAATCATGTATTAACAACAAGCAATTTTTGTAATTGTTTATAAAGTATGGCATGTCCATCATccatccagcctctcag (the underlined area is the target area)

[0177] The first round PCR reaction product was diluted 10 times with double distilled water. N -F primer (10μM) was diluted to 3μM using 0.3×TE and then dispensed into a 96-well PCR plate. Then, the total PCR reaction solution was prepared according to the number of samples to be tested. The PCR reaction system in each well was 15μL, and the content of each component in the system was: 2×Taq mix 7.5μL, Plate-01 (10μM) 0.3μL, and double distilled water 5.9μL. Use a multichannel pipette or an ordinary pipette to dispense the PCR reaction system into each well of the 96-well PCR, and then use a 96-well needle sampler to take the above-dispensed Pos N-F primer (approximately 1 μL) was added to each PCR reaction system, and the 10-fold diluted first-round PCR product (approximately 0.5 μL-1 μL) was taken using a 96-well needle sampler and added to each PCR reaction system. PCR reaction was performed, and the PCR reaction program was: 95°C denaturation for 20 s, 55°C annealing for 20 s, 72°C extension for 25 s, for a total of 10 cycles, 94°C denaturation for 20 s, 60°C annealing for 20 s, 72°C extension for 25 s, for a total of 10 cycles, and 72°C final extension for 2 min.

[0178] The fragment sequence after the second round of PCR amplification in this example is:

[0179] CGCTCTTCCGATCTgtcaNNNNNNctcggagtgatcgcacTTATTGCAACCTCCTTCCTTATGTTCCCACCCTCATTATTTTCAGATAATTCATTGATCAGCTGGAAAGTGTTCTG CAGGGACATGAATCCTCCAT AGGGTAAATATCCTAGAGTTATATTTGTATCCTTAATGCATATGACCAATAATCATGTATTAACAACAAGCAATTTTTGTAATTGTTTATAAAGTATGGCATGTCCATCATccatccagcctctcagAAAACTACAGAGATCGGAAGAGCACACGTCTG (the underlined solid line area is the target area, and the italic part is Pos N -F specific recognition sequence, the bold font is the Plate-01 specific recognition sequence)

[0180] Take 2 μL of the second-round PCR reaction products and mix them (about 60-100 samples of the second-round PCR reaction amplification products are mixed into one group), and prepare the total PCR reaction solution according to the number of mixed groups. Each reaction system is 25 μL, and its components are: 2×Taq mix 12.5 μL, Lib-F (10 μM) 0.5 μL, Lib-R (10 μM) 0.5 μL, double distilled water 10 μL. The total reaction solution is divided into PCR plates, and 1.5 μL of the second-round PCR reaction mixed product is added to perform PCR reaction. The PCR reaction program is: 95℃ denaturation for 20s, 52℃ annealing for 20s, 72℃ extension for 30s, a total of 7 cycles, 96℃ denaturation for 20s, 63℃ annealing for 20s, 72℃ extension for 30s, a total of 8 cycles, and 72℃ final extension for 2min.

[0181] The results of the third round of PCR amplification in this example are as follows Figure 3 As shown, the sequence of the amplified fragment is as follows:

[0182] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtcaNNNNNNctcggagtgatcgcacTTATTGCAACCTCCTTCCTTATGTTCCCACCCTCATTATTTTCAGATATTCATTGATCAGCTGGAAAGTGTTCTG CAGGGACATGAATCCTCCAT AGGGTAAATATCCTAGAGTTATATTTGTATCCTTAATGCATATGACCAATAATCATGTATTAACAACAAGCAATTTTTGTAATTGTTTATAAAGTATGGCATGTCCATCATccatccagcctctcagAAAACTACAGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC T GGATTGCATCTCGTATGCCGTCTTCTGCTTG (the underlined solid line area is the target area, and the italic part is Pos N -F specific recognition sequence, the bold font is the Plate-01 specific recognition sequence, and the underlined dotted part is the library specific recognition sequence)

[0183] Take 15 μL of the third-round PCR reaction products and mix them in a 1.5mL-5mL centrifuge tube. Pipette 200 μL of the mixed product and perform 1% agarose gel electrophoresis to recover the target fragments and send them to the company for NGS.

[0184] Example 2. Detection of rice gene editing material results using HiDecode

[0185] The HiDecode module in SuperDecode is used to detect the NGS results in Example 1 of the present invention, and the steps are as follows:

[0186] (1) Upload the required files, including gene wild-type sequence file, target sequence file (optional), and NGS result file.

[0187] (2) Set the fragment recognition sequence information, including the specific recognition sequences from Pos-A01 to Pos-A10 and the specific recognition sequence of Plate-01.

[0188] (3) Set mutation analysis parameters, including analysis mode, which can be divided into polyploid, diploid and low-frequency mutation type samples. The material used in this embodiment is rice, which is diploid, so the parameter is selected as diploid; output threshold, the default value for diploid material is 0.25, the default value for polyploid is 0.1, and the default value for cell line sample is 0.0025. When the percentage content of reads is greater than the threshold, it is recorded as a valid mutation of the sample; the number of threads, which can be adjusted to adjust the running speed of HiDecode.

[0189] (4) Click the Run button to perform mutation analysis.

[0190] The results are as follows Figure 3 As shown, among the 10 samples detected by HiDecode, there was 1 sample with a wild-type genotype (wt), that is, no editing occurred; 2 samples had heterozygous mutations (het), that is, one chain was wild-type and the other chain was mutated after editing; 7 samples had heterozygous mutations (bia), that is, both chains of the sample were edited and mutated, and the mutation types were inconsistent.

[0191] Detection of rice protoplast editing results using HiDecode

[0192] This implementation case uses LbCas12a to edit the protoplasts of rice, and the selected target sequence is: ATCTCCTTCTAGAAGCACAAGCGC. The specific steps are:

[0193] (1) The rice codon-optimized LbCas12a was loaded into a 1300 vector, and the crRNA was co-loaded into a 1300 vector containing the LbCas12a gene. The crRNA sequence is: AATTTCTACTAAGTGTAGAT ATCTCCTTCTAGAAGC ACAAGCGC (The underlined area is the target area)

[0194] (2) Peel the rice seeds and place them in a sterilized small triangular bottle. Add 75% ethanol and shake well for 1 minute, then wash with sterilized double distilled water for 3 times. Add an appropriate amount of 2% sodium hypochlorite, place in a dark environment, 28°C, 150rpm for 30 minutes, wash with sterilized double distilled water for 5 times, and disinfect again with an appropriate amount of 2% sodium hypochlorite. Use sterilized tweezers to place the seeds in 1 / 2MS culture medium and culture in a dark environment for 13-15 days.

[0195] (3) Cut off the root and leaves of the seedlings, keep the leaf sheath, cut the leaf sheath into small pieces of about 0.5 mm using a sharp blade, and place them in W5 solution in the dark for 30 min. After removing the W5 solution, add an appropriate amount of Enzyme Solution and shake in the dark at 28°C and 50 rpm for 4 h.

[0196] (4) Remove the Enzyme Solution and use W5 solution to wash the leaf sheath tissue. Filter the wash solution using 300-mesh and 400-mesh sieves. Collect the wash solution in a 50-mL centrifuge tube and centrifuge at 150 g for 5 min. Remove the supernatant and use W5 to wash the precipitated cells. Centrifuge at 150 g for 5 min. Remove the supernatant and suspend the cells with 2 mL of W5. Centrifuge at 200 g for 10 min. Suspend the cells with MMG and adjust the concentration to 10 5 / mL.

[0197] (5) Pipette 10 μg of the vector into 100 μL of suspended cells and mix gently. Add 110 μL of PEG4000, mix well, and let stand at 23°C in the dark for 20 min.

[0198] (6) Add 900 μL of W5 solution for washing, centrifuge at 300 g for 10 min, remove the supernatant, add 900 μL of W5 solution again to suspend the cells, and culture them in the dark for 60 h.

[0199] (7) DNA was extracted from the protoplasts after 60 h of culture, and the NGS library of the protoplast samples was constructed using the NGS library construction method in Example 1, and the samples were sent to the company for sequencing.

[0200] (8) In the HiDecode module of SuperDecode, upload the required files, including the gene wild-type sequence file, the target sequence file (optional), and the NGS result file. Set the fragment recognition sequence information, including the Pos-A01 specific recognition sequence and the Plate-01 specific recognition sequence. Set the mutation analysis parameters. The mode selected in this embodiment is a low-frequency mutation type sample, that is, the output reads percentage content is greater than 0.0025 of the mutation type. The results are as follows Figure 4 As shown, after LbCas12a treatment, about 35.7% of the cells had a wild-type genotype, and the remaining cells showed large-fragment deletions, which was consistent with the mutation type produced after LbCas12a editing, indicating that HiDecode can quickly and accurately verify the editing results in protoplasts.

[0201] TGS library construction for large batches of samples

[0202] In this example, a TGS sample amplicon library was constructed for the rice editing materials with 22 Ehd1 gene promoter tile deletions, and amplicon construction was performed on the gene editing materials. Specific primers were designed at the upstream and downstream bp positions of the detection site. The sample amplicon specific amplification primers designed in this implementation case are:

[0203] Forward primer Target-F: 5'-atcgcctggctccacgctccgagttTCCCTTCATTCCGATGAGGCCCACGATT-3' (concentration 10 μM)

[0204] Reverse primer Target-R: 5'-cctggctccacgctccgagttCCCTTGTAGCTGCACTTCAGAAGTAAATCTTCC-3' (concentration 10 μM)

[0205] Plate-02 (10 μM): cgacGGGGTTTTGGGGtacgcctggctccacgctccgtaga (the bold font is the Plate-02 specific recognition sequence)

[0206] Pos N -F (10μM): cttgNNNNNNNNNNNNNNNNNNNNNNNNatcgcctggctccacgctccgagtt (italics are Pos N -F specific recognition sequence)

[0207] The TGS large-scale sample library construction process of the present invention is as follows Figure 6 As shown, it is mainly divided into two PCR reactions, and its main steps are:

[0208] (1) Use a multichannel pipette or an ordinary pipette to dispense the sample to be tested into each well of a 96-well PCR. Prepare the total PCR reaction solution according to the number of samples to be tested. The PCR reaction system for each well is 15 μL. The components of each PCR system are: 7.5 μL of 2×PhantaMax Buffer, 0.3 μL of dNTP, 0.3 μL of Phanta Max Polymerase, 0.6 μL of forward primer Target-F and reverse primer Target-R, and 4.7 μL of double distilled water. Use a multichannel pipette or an ordinary pipette to dispense the PCR reaction system into each well of a 96-well PCR, then use a 96-well needle sampler to take the DNA of the sample to be tested (about 0.5 μL-1 μL) that has been dispensed above and add it to each PCR reaction system, and perform PCR amplification reaction. The PCR amplification program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 2 min, for a total of 30 cycles, and final extension at 72°C for 5 min.

[0209] (2) Dilute the first round PCR reaction product ten-fold. N -F primer (10μM) was diluted to 3μM with 0.3×TE and then dispensed into a 96-well PCR plate. Then, the total PCR reaction solution was prepared according to the number of samples to be tested. The PCR reaction system for each well was 15μL. The content of each component in the system was: 7.5μL 2×Phanta Max Buffer, 0.3μL dNTP, 0.3μL Phanta Max Polymerase, 0.6μL Plate-02 primer, and 4.3μL double distilled water. Use a multichannel pipette or an ordinary pipette to dispense the PCR reaction system into each well of the 96-well PCR, and then use a 96-well needle sampler to take the above-dispensed Pos N -F primer (approximately 1 μL) was added to each PCR reaction system, and the 10-fold diluted first-round PCR product (approximately 0.5 μL-1 μL) was taken using a 96-well needle sampler and added to each PCR reaction system. PCR reaction was performed, and the PCR reaction program was: 94°C pre-denaturation for 3 min, 94°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 2 min, a total of 30 cycles, and 72°C final extension for 5 min.

[0210] Take 5 μL of the second round PCR reaction products and mix them in a 1.5mL-5mL centrifuge tube. Pipette 200 μL of the mixed product and use 1% agarose gel electrophoresis to recover the target fragments and send them to the company for TGS library construction and sequencing.

[0211] Detecting tile deletion using LaDecode

[0212] The LaDecode module in SuperDecode is used to detect the TGS result in Example 5 of the present invention, and the steps are as follows:

[0213] (1) Upload the required files, including gene wild-type sequence file, target sequence file (optional), and TGS result file.

[0214] (2) Set the fragment identification sequence information, including Pos N -F specific recognition sequence and Plate-02 specific recognition sequence.

[0215] (3) Setting mutation analysis parameters, including sample analysis mode, which can be divided into polyploid, diploid and low-frequency mutation analysis modes. The material used in this embodiment is rice, which is diploid, so the parameter diploid is selected; output threshold, the default value for diploid material is 0.25, the default value for polyploid is 0.1, and the default value for low-frequency mutation sample is 0.0025. When the percentage content of the number of reads is greater than the threshold, it is recorded as a valid mutation of the sample; the number of threads, the running speed of LaDecode can be changed by adjusting the number of threads.

[0216] (4) Click the Run button to perform mutation analysis.

[0217] The results are as follows Figure 7 and Figure 8 shown.

[0218] The present invention is based on the method of PCR amplification, constructs amplicons for gene editing materials, and introduces specific recognition sequences, and realizes the construction of NGS and TGS samples of large quantities of samples quickly and at low cost; the present invention develops SuperDecode, a software for detecting gene editing materials, which can perform mutation analysis on the currently commonly used Sanger, NGS and TGS results, and can detect all types of mutations in samples, including large fragment deletion, sequence insertion, single base mutation, mosaic mutation, etc.; SuperDecode developed by the present invention is a Window platform software. Compared with the web version tool, SuperDecode can quickly read the sequencing result files of a large number of samples and perform mutation analysis. For tools of Linux system, SuperDecode provides a convenient and concise operational interface, which is convenient for scientific researchers to use and greatly improves the efficiency of gene editing material detection.

[0219] The foregoing is merely a specific embodiment of the present invention, which enables those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. A method for detecting gene editing materials, characterized in that: include: Constructing multiple specific recognition sequences; Sequencing the gene fragment according to the specific recognition sequence; SuperDecode software was used to perform mutation analysis on the sequencing results.

2. A method for detecting gene editing materials according to claim 1, characterized in that: The construction of multiple specific recognition sequences includes: Add position-barcode, plate-barcode and library-barcode specific recognition sequence libraries to sample amplicons; The position-barcode sequence library includes 192 specific position-barcode sequences, 96 specific recognition sequences for NGS library construction and 96 specific recognition sequences for TGS library construction; The plate-barcode sequence library includes 102 specific plate-barcode sequences, 96 of which are used for NGS library construction and 6 for TGS library construction; The library-barcode sequence library includes 20 specific library-barcode sequences, all of which are used for NGS library construction.

3. A method for detecting gene editing materials according to claim 1, characterized in that: The sequencing of gene fragments according to the specific recognition sequence comprises: The gene fragments were subjected to Sanger sequencing, NGS sequencing, and third-generation TGS.

4. A method for detecting gene editing materials according to claim 1, characterized in that: The use of SuperDecode software to perform mutation analysis on the sequencing results includes performing mutation analysis on the Sanger sequencing results, specifically: Obtain the first project information of the current mutation analysis according to the file and settings input by the user; Using the DSD sequencing overlapping peak diagram decoding principle, read the overlapping peaks in the Sanger sequencing results; Based on the sequence analysis software, the corresponding sequence is searched in the wild-type sequence, the Sanger sequencing results of the amplicon are decoded, and the variation type of the target sample at the target sequence is read.

5. A method for detecting gene editing materials according to claim 1, characterized in that: The use of SuperDecode software to perform mutation analysis on sequencing results includes performing mutation analysis on NGS results, specifically: Obtain the second project information of the current mutation analysis according to the file and settings input by the user; Merge and complete paired reads in double-end sequencing into complete sequences, and split the library based on sample-specific recognition sequences; The reads are mapped to specific samples, and the sample reads are compared with the reference sequence through the alignment method to obtain the variation information of the sample.

6. A method for detecting gene editing materials according to claim 1, characterized in that: The use of SuperDecode software to perform mutation analysis on sequencing results includes performing mutation analysis on TGS results, specifically: Obtain the third project information of the current mutation analysis according to the files and settings input by the user; Split the library based on sample-specific recognition sequences and map reads to specific samples; Extract the common sequences in all reads of a specific sample to remove random mutations caused by sequencing. Finally, align the reads of the sample with the reference sequence to obtain sample variation information.

7. A method for detecting gene editing materials according to claim 4, characterized in that: The obtaining of the first project information of the current mutation analysis according to the file and settings input by the user comprises: The first project information includes: amplicon wild-type sequence information, a Sanger sequencing result file of the sample amplicon, and an optional first setting condition.

8. A method for detecting gene editing materials according to claim 5, characterized in that: The obtaining of the second project information of the current mutation analysis according to the file and settings input by the user comprises: The second project information includes: amplicon wild-type sequence information, gene editing target sequence information, sample NGS result information, specific identification sequence information corresponding to each sample, and optional second setting conditions; The optional second setting condition is the setting of mutation analysis parameters, including: Sample analysis mode, options include diploid, polyploid and low frequency; Output threshold, used to set the threshold for result output; The number of running threads is used to set the number of threads used for program running and adjust the HiDecode decoding running speed.

9. A method for detecting gene editing materials according to claim 5, characterized in that: The step of obtaining the third item information of the current mutation analysis according to the file and settings input by the user includes: The third project information includes: amplicon wild-type sequence information, gene editing target sequence information, sample TGS result information, specific recognition sequence information corresponding to each sample, and optional third setting conditions; The optional third setting condition is the setting of mutation analysis parameters, including: Sample analysis mode, options include diploid, polyploid and low frequency; Output threshold, used to set the threshold for result output; The number of running threads is used to set the number of threads used for program running and adjust the LaDecode decoding running speed.

10. A system for detecting gene editing materials, characterized in that: include: A data acquisition module, used to construct a variety of specific recognition sequences; A sequencing module, used for sequencing the gene fragments according to the specific recognition sequence; The analysis module is used to perform mutation analysis on the sequencing results using SuperDecode software.

Images