Application of collagen-gelatin combined VEGF (vascular endothelial growth factor) mimetic peptide in promoting growth of blood vessels

Abstract

The invention relates to the technical field of medical instruments, and discloses an application of a collagen-gelatin combined VEGF (vascular endothelial growth factor) mimic peptide in promoting growth of blood vessels, the collagen-gelatin combined VEGF mimic peptide is QKCMP-Enhancer, and the sequence of the collagen-gelatin combined VEGF mimic peptide is Ac-KLTWQELYQLKYKGI-(GPO) 5-(KR) 4-(RGD) 4-(KR) 4-GGG-(Gly) 3-NH2. The invention discloses a collagen-gelatin combined VEGF (vascular endothelial growth factor) mimic peptide which shows remarkable biological activity in the aspects of promoting angiogenesis, stimulating cell proliferation and inhibiting cell apoptosis. A new way and a new strategy are developed for treating related diseases; the collagen-gelatin is combined with the VEGF mimic peptide, so that a safer, more efficient and controllable angiogenesis method can be realized, and the collagen-gelatin combined VEGF mimic peptide has remarkable clinical application potential.

Description

Technical Field

[0001] The present invention relates to the technical field of medical devices, and in particular to an application of a collagen-gelatin combined with VEGF mimetic peptide in promoting angiogenesis. Background Art

[0002] New blood vessel formation plays a vital role in embryonic development and maintaining physiological homeostasis. It has a profound impact on key physiological processes such as wound healing, reproduction and placenta formation. Angiogenesis-dependent diseases, which are caused by the imbalance of production or activity between anti-angiogenic factors and pro-angiogenic factors, are the root cause of many diseases. Among these diseases, the role of the endogenous molecule vascular endothelial growth factor (VEGF) is particularly significant. VEGF was originally named vascular permeability factor (VPF) for its ability to enhance vascular permeability. Later, it was found that it also has the function of promoting angiogenesis, so it was renamed VEGF. VEGF plays a key role in new blood vessel formation. It not only helps to regulate normal and pathological angiogenesis processes, but also plays a variety of roles in the body, such as promoting cell division, inhibiting endothelial cell (EC) apoptosis, increasing vascular permeability, and promoting cell migration. In addition, VEGF also has a significant role in bone repair. It accelerates the bone healing process by promoting the transformation of cartilage callus to bone callus.

[0003] In the context of various diseases or tissue damage, angiogenesis-promoting therapy has been shown to play a vital role, especially VEGF (vascular endothelial growth factor). However, since the half-life and activity of VEGF limit its biological function in the body, it is urgent to explore new alternative materials. Summary of the invention

[0004] VEGF mimetic peptides exert pro-angiogenic activity similar to VEGF and can be used to present spatially oriented angiogenic cues in collagen scaffolds. They are considered to be the best alternative to VEGF-based treatments. VEGF mimetic peptides are also known as QKCMP-Enhancers, which are collagen mimetic peptides (CMPs) with an angiogenic QK domain, through which the QK peptide can bind tightly to collagen. Studies have shown that QKCMP-Enhancer can stimulate early angiogenesis of endothelial cells (ECs) and has the potential to promote the formation of new blood vessels in burn wounds. In view of this, the present invention proposes the use of a collagen-gelatin combined VEGF mimetic peptide in angiogenesis promotion, aiming to provide a safer and controllable angiogenesis strategy.

[0005] The present invention provides a collagen-gelatin combined with VEGF mimetic peptide, the sequence of the collagen-gelatin combined with VEGF mimetic peptide is:

[0006] Ac-KLTWQELYQLKYKGI-(GPO) 5 -(KR) 4 -(RGD) 4 -(KR) 4 -GGG-(Gly) 3 -NH 2 ;

[0007] Among them, Ac is the N-terminal acetylation protection; KLTWQELYQLKYKGI is the QK domain; (GPO) 5 To simulate the triple helix structure of collagen; (KR) 4 is a repeated sequence of arginine and lysine; (RGD) 4 Rich in cell adhesion sequences; (KR) 4 -GGG is a sequence rich in arginine and lysine; (Gly) 3 is a flexible linker sequence; NH 2 The C-terminus is amidated.

[0008] The present invention also proposes a method for preparing the collagen-gelatin combined with VEGF mimetic peptide, comprising:

[0009] After the resin is soaked and expanded in DMF or NMP, it is treated with a 20% piperidine solution to remove the N-terminal Fmoc protecting group;

[0010] The amino acids with Fmoc protection groups were mixed with HBTU and DIPEA to activate the carboxyl groups;

[0011] In the direction of synthesis from the N-terminus to the C-terminus, the activated amino acid reacts with the amino group on the resin to form a peptide bond; repeating the steps to couple the next amino acid according to the sequence described in claim 1 until the synthesis is completed;

[0012] After the synthesis is completed, all side chain protecting groups are removed, and the polypeptide is cleaved from the resin to obtain the collagen-gelatin combined VEGF mimetic peptide.

[0013] Preferably, after the synthesis is completed, all side chain protecting groups are removed, and the polypeptide is cleaved from the resin to obtain a crude polypeptide;

[0014] The crude polypeptide is freeze-dried, and impurities are removed by gradient elution with water and acetonitrile using a C18 column, and then purified using an ion exchange chromatography column to obtain the collagen-gelatin-bound VEGF mimetic peptide.

[0015] The present invention also proposes an application of the collagen-gelatin combined with VEGF mimetic peptide, which at least includes any one of the following:

[0016] A1) Use of the collagen-gelatin combined with VEGF mimetic peptide in promoting cell proliferation;

[0017] A2) Use of the collagen-gelatin combined with VEGF mimetic peptide in the preparation of a product that promotes cell proliferation;

[0018] A3) Use of the collagen-gelatin combined with VEGF mimetic peptide in promoting blood vessel growth and / or development;

[0019] A4) Use of the collagen-gelatin combined with VEGF mimetic peptide in the preparation of a product that promotes blood vessel growth and / or development

[0020] A5) Use of the collagen-gelatin combined with VEGF mimetic peptide in inhibiting cell apoptosis;

[0021] A6) Use of the collagen-gelatin combined with VEGF mimetic peptide in the preparation of a product for inhibiting cell apoptosis.

[0022] Preferably, the cells are HUVECs.

[0023] The present invention also provides a method for promoting cell growth and / or development, comprising:

[0024] The collagen-gelatin combined with VEGF mimetic peptide is co-cultured with cells.

[0025] The present invention also provides a method for inhibiting cell apoptosis, comprising:

[0026] The collagen-gelatin combined with VEGF mimetic peptide is co-cultured with cells.

[0027] The present invention also provides a method for resisting cell inhibitors, comprising:

[0028] Co-culturing the collagen-gelatin combined with VEGF mimetic peptide and cells;

[0029] Wherein, the cell inhibitor is an inhibitor of the PI3K-AKT signaling pathway.

[0030] Preferably, the cells are HUVECs.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention provides a safer and controllable angiogenesis strategy, which can effectively avoid the side effects and activity limitation problems that VEGF itself may bring by using collagen-gelatin combined with VEGF mimetic peptide (named QKCMP-Enhancer). Through the use of collagen-gelatin combined with VEGF mimetic peptide, precise regulation of the angiogenesis process can be achieved.

[0033] The collagen-gelatin combined with VEGF mimetic peptide of the present invention exhibits significant biological activity in promoting cell proliferation, inhibiting cell apoptosis, etc., and provides new possibilities for the treatment of related diseases. The collagen-gelatin combined with VEGF mimetic peptide of the present invention has potential application value in resisting cell inhibitors, especially in the presence of inhibitors that inhibit the PI3K-AKT signaling pathway, it can still maintain cell growth and development.

[0034] In summary, the present invention provides a collagen-gelatin combined with VEGF mimetic peptide and its application, the polypeptide has significant biological activity in promoting angiogenesis, cell proliferation and inhibiting cell apoptosis, and provides new ideas and methods for the treatment of related diseases. Through the collagen-gelatin combined with VEGF mimetic peptide of the present invention, a safer, more effective and controllable angiogenesis strategy can be achieved, which has important clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Various other advantages and benefits will become apparent to those of ordinary skill in the art by reading the detailed description of the preferred embodiments below. The accompanying drawings are only for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present invention. Moreover, the same reference symbols are used throughout the accompanying drawings to represent the same components. In the accompanying drawings:

[0036] Figure 1 The in vivo and in vitro experiments verify the angiogenesis-promoting effect of QKCMP-Enhancer, among which, Figure A shows the effect of QKCMP-Enhancer on embryonic zebrafish vascular development; Figure B shows the intestinal vascular area; Figure C shows the number of intestinal vascular branches; Figure D shows the cell cycle changes of human umbilical vein endothelial cells after treatment with different concentrations of QKCMP-Enhancer detected by flow cytometry; Figure E shows the percentage of different stages of the cell cycle in each group; Figure F shows the growth curve of HUVECs treated with different concentrations of QKCMP-Enhancer; Figure G shows the changes in cell cycle proteins of HUVECs treated with different concentrations of QKCMP-Enhancer; compared with the control group, ** indicates P < 0.01, *** indicates P < 0.001; compared with the Bev group, ## indicates P < 0.01, ### indicates P < 0.001;

[0037] Figure 2The results of screening of differentially expressed genes (DEGs), where A is a volcano plot, in which red (equilateral triangle) represents up-regulated genes and green (inverted triangle) represents down-regulated genes; B is a heat map of the expression distribution of DEGs in the control group and the treatment group; C is the scale-free fitting index of the soft threshold and average connectivity; D is the heat map and feature correlation of gene modules; E is a Venn diagram of 65 overlapping genes; F is the biological process (BP) functional enrichment result of overlapping genes; G is the KEGG pathway enrichment result of overlapping genes;

[0038] Figure 3 Figure 1 is the key gene module selected by WGCNA, among which Figure A is the biological function and pathway enrichment analysis of 65 genes; Figure B is the transcriptome expression levels of CSF3, LAPR6, GNG11, ITGA10 and VWF in different treatment groups; Figure C is the expression levels of VWF and ITGA10 in HUVECs; Figure D is the protein levels of VWF and ITGA10 in HUVECs; compared with 0 μM, ** indicates p < 0.01, *** indicates p < 0.001;

[0039] Figure 4 Figure 1 is an analysis of the gene and protein levels related to the PI3K / AKT pathway, where Figure A shows the protein levels of AKT and p-AKT in HUVECs; Figure B shows the proliferation level of HUVECs after CCK-8 detection of PI3K / AKT inhibitors; Figure C shows the expression levels of YAP and CTGF; Figure D shows the protein levels of p-YAP, YAP and CTGF in HUVECs; compared with 0 μM, * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, and **** indicates p < 0.0001. DETAILED DESCRIPTION

[0040] Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art. It should be noted that, in the absence of conflict, the embodiments of the present invention and the features described in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0041] Example 1

[0042] Preparation of collagen-gelatin combined with VEGF mimetic peptide QKCMP-Enhancer:

[0043] A1) The synthetic sequence of the collagen-gelatin combined with VEGF mimetic peptide QKCMP-Enhancer is: "Ac-KLTWQELYQLKYKGI-(GPO) 5 -(KR) 4 -(RGD) 4 -(KR) 4 -GGG-(Gly) 3 -NH 2 "Ac represents the N-terminal acetylation protection to prevent the N-terminal degradation of the peptide chain during synthesis. KLTWQELYQLKYKGI is the QK domain, which mimics the biological activity of VEGF and helps promote angiogenesis. (GPO) 5 Mimics the triple helix structure of collagen to enhance the binding force with gelatin. (KR) 4 A repeating sequence of arginine and lysine that helps enhance electrostatic interactions with gelatin. (RGD) 4 Rich in cell adhesion sequences, promoting cell-material interactions. (KR) 4 -GGG reintroduces an arginine- and lysine-rich sequence that enhances binding to gelatin and may provide additional structural stability. (Gly) 3 It is a flexible linker sequence that increases the flexibility of the peptide chain and makes it easier to adapt to the structure of gelatin. 2 It represents C-terminal amidation to improve the stability and biological activity of the peptide chain.

[0044] A2) In the preparation stage, the solid phase peptide synthesis (SPPS) method is selected to synthesize from the N-terminus to the C-terminus. Fmoc-protected amino acids are prepared and an appropriate resin (polystyrene resin) is selected.

[0045] A3) During the synthesis process, the resin is first soaked in DMF or NMP to fully swell it. The resin is then treated with a 20% piperidine solution to remove the N-terminal Fmoc protecting group. The amino acid with the Fmoc protecting group is mixed with HBTU and DIPEA to activate the carboxyl group. The activated amino acid is reacted with the amino group on the resin to form a peptide bond. The next amino acid is coupled repeatedly according to the sequence until the synthesis is complete. All side chain protecting groups are removed using a reagent such as TFA. The peptide is cleaved from the resin using a reagent such as TFA.

[0046] A4) During the purification process, the crude polypeptide obtained by cleavage is first freeze-dried. Then, a C18 column is used to remove impurities by gradient elution with water and acetonitrile. Further purification is performed using an ion exchange chromatography column to ensure purity.

[0047] A5) During the identification and storage stage, use MALDI-TOF MS and other techniques to identify the molecular weight of the peptide. Analyze the amino acid composition of the peptide. Store the purified peptide in aliquots at -80°C to avoid repeated freezing and thawing.

[0048] Example 2

[0049] 1. Effect of QKCMP-Enhancer on the proliferation and cell cycle of human umbilical vein endothelial cells (HUVECs)

[0050] 1. Animal Experiments

[0051] All zebrafish were raised in fish culture water at 28°C. At 24 hours postfertilization (1 dpf), zebrafish of the transgenic vascular green fluorescent Fli-1 strain were randomly selected and placed in 6-well plates, with 30 per well. A control group, a bevacizumab (Bev) group, and a Bev+QKCMP-Enhancer high / medium / low dose (100 μM, 50 μM, and 0 μM, respectively) group were set up. Bevacizumab was injected into the yolk sac by injection. After 48 hours of treatment at 28°C, 6 zebrafish were randomly selected from each experimental group and photographed under a fluorescence microscope. Data were collected using NIS Elements D 3.20 advanced image processing software to analyze the area and number of subintestinal vessels. The statistical analysis results of the above indicators will be used to evaluate the induced effect of bevacizumab injection on zebrafish vascular injury.

[0052] 2. Cell Culture

[0053] Human umbilical vein endothelial cells (HUVECs) were cultured in a medium specifically for HUVECs and maintained at 37°C and 5% CO. 2 in a humid environment. In order to explore the effect of QKCMP-Enhancer on the growth of HUVECs, the cells were treated with 0μM, 50μM and 100μM QKCMP-Enhancer for 5 days, respectively, of which the 0μM group served as a control group without QKCMP-Enhancer, and 3 replicates were set up in each group. After treatment, HUVECs continued to be cultured in a culture medium dedicated to HUVECs. In addition, the present invention also established an inhibitor group, using PI3K-AKT signaling pathway inhibitors (LY294002, HY-10108) to treat MCE, as well as HUVECs treated with QKCMP-Enhancer, and then continued to be cultured in the culture medium for 24 hours for detection. The morphological changes of HUVECs were observed under an optical microscope and recorded by taking pictures.

[0054] 3. Cell Proliferation

[0055] Cell counting kit 8 (CCK-8) was used to evaluate cell proliferation. First, human umbilical vein endothelial cells (HUVECs) were seeded into 96-well plates and cultured. According to the instructions of the kit, the cells were incubated with CCK-8 reagent at 37°C for 2 hours. Then, the cells were treated with QKCMP-Enhancer at concentrations of 0μM, 50μM, and 100μM, and incubated under the same conditions for 0 hours, 12 hours, 24 hours, 48 ​​hours, and 72 hours. Finally, the absorbance (OD) value at a wavelength of 450nm was measured by an enzyme reader.

[0056] 4. Flow cytometry (apoptosis and cell cycle)

[0057] The apoptosis rate and cell cycle changes of HUVEC cells were evaluated by flow cytometry. In terms of detecting cell apoptosis, the Annexin V-FITC / propidium iodide (PI) apoptosis detection kit was used for evaluation. Cell samples treated with 0μM, 50μM, and 100μM QKCMP-Enhancer were collected, washed with phosphate buffered saline (PBS), and stained with AnnexinV-FITC / PI. Subsequently, the cells were detected by flow cytometry. As for the analysis of the cell cycle, the cell samples were collected and processed according to the above steps, centrifuged and washed with PBS. The cells were fixed in 70% methanol at 4°C overnight, then resuspended with PI staining solution at room temperature and incubated in the dark for 1 hour, and finally measured by flow cytometry.

[0058] 5. Western Blot (WB)

[0059] HUVECs were washed and lysed in phosphate buffered saline (PBS), and the supernatant was collected by centrifugation. The protein concentration was determined using a bicinchoninic acid (BCA) kit, and then the loading buffer was added and the proteins were separated by polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane for immunoblotting analysis. The primary antibodies used were purchased from abcam, including: anti-p21 antibody (ab109520), anti-p27 antibody (ab32034), anti-cyclin B1 antibody (ab32053), anti-cyclin-dependent kinase 2 (CDK2) antibody (ab32147), anti-connective tissue growth factor (CTGF) antibody (ab209780), anti-Yes-associated protein (YAP) antibody (ab205270), anti-protein kinase B (AKT) antibody (ab8805), and anti-phosphorylated protein kinase B (p-AKT) antibody (ab38449). β-actin was used as an internal reference and incubated with horseradish peroxidase-labeled secondary antibody for 1 hour before protein content detection.

[0060] 6. Results

[0061] Compared with the control group, bevacizumab injection significantly reduced angiogenesis in zebrafish. However, QKCMP-Enhancer significantly promoted vascular development in zebrafish, and this effect became more significant with increasing concentration (see Figure 1 A). Furthermore, by comparing the area and number of subintestinal blood vessels in each group of zebrafish, we concluded that QKCMP-Enhancer can significantly enhance the growth of blood vessels in zebrafish (see Figure 1 B and 1C). In order to explore the biological effects of QKCMP-Enhancer on human umbilical vein endothelial cells, we used CCK-8 and flow cytometry for detection. The study found that the changes in the cell cycle showed that the cells were mainly arrested in the S phase and G2 phase (see Figure 1 D and 1E). The results of CCK-8 detection further revealed that QKCMP-Enhancer has the effect of promoting cell proliferation, and this effect is positively correlated with the concentration of QKCMP-Enhancer (see Figure 1 F). By using Western blotting (WB) to detect the expression of proteins related to the cell cycle pathway, we found that as the concentration of QKCMP-Enhancer increased, the expression levels of p21 and p27 proteins also increased (see Figure 1 G).

[0062] 2. Molecular mechanism of QKCMP-Enhancer activating PI3K / AKT pathway to promote angiogenesis

[0063] 1. Real-time quantitative polymerase chain reaction (qRT-PCR)

[0064] Total RNA from HUVEC was isolated using Trizol reagent, and its concentration and quality were tested. cDNA template was synthesized using PrimeScript RT kit, and qRT-PCR was performed on a real-time PCR instrument using 2 -ΔΔCt The relative expression level was calculated by the PCR method. GAPDH was used as the endogenous reference and the primer sequences used were as follows:

[0065] CTGF,Forward primer:TTGCGAAGCTGACCTGGAA;

[0066] CTGF,Reverse primer:TGCTGGTGCAGCCAGAAA.

[0067] YAP,Forward primer:CAACTCCAACCAGCAGCAAC;

[0068] YAP,Reverse primer:TTGGTAACTGGCTACGCAGG.

[0069] VWF,Forward primer:CCGATGCAGCCTTTTCGGA;

[0070] VWF,Reverse primer:TCCCCCAAGATACACGGAGAGG.

[0071] ITGA10,Forward primer:AACATCACCCACGCCTATTCC;

[0072] ITGA10,Reverse primer:GTTGGTAGTCACCTAAGTGGC.

[0073] GAPDH,Forward primer:CTGGGCTACACTGAGCACC;

[0074] GAPDH,Reverse primer:AAGTGGTCGTTGAGGGCAATG.

[0075] 2. RNA sequencing (RNA-seq)

[0076] Total RNA was extracted from treated HUVECs using the Trizol kit. After enrichment, the mRNA was fragmented and reverse transcribed into cDNA. After enrichment, the mRNA was fragmented and reverse transcribed into cDNA. Double-stranded cDNA fragments were purified, end-repaired, and PCR amplified. Sequences were compared and analyzed to detect gene integrity and expression, and a complete gene expression matrix containing three groups was obtained.

[0077] 3. Difference Analysis

[0078] The samples were divided into a control group (0uM) and a treatment group (50uM, 100uM), and the two groups of samples were differentially analyzed using the R package limma. The screening threshold was |log2FC|>1, P<0.05, and the up- and down-regulated genes with differential expression were obtained.

[0079] 4. Weighted Gene Co-expression Analysis (WGCNA)

[0080] WGCNA is a method for clustering genes based on sample characteristics. By selecting an appropriate soft threshold (β), a gene topology matrix is ​​constructed, a gene dendrogram is constructed, and module colors are determined. Genes are clustered into different color modules based on the correlation between sample characteristics and genes. The gene module with the greatest correlation is selected for subsequent analysis.

[0081] 5. Functional Pathway Enrichment Analysis

[0082] The intersection genes of differentially expressed genes (DEGs) and key gene modules were visualized using Venn diagrams. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed on the obtained overlapping genes using ClusterProfiler software to obtain important biological functions or methods. Metascape (https: / / www.metascape.org) was used for protein interaction analysis to analyze the biological and signaling pathway enrichment of overlapping genes. Signaling pathways with p < 0.05 were significant.

[0083] 6. Results

[0084] 6.1 Key genes and biological function analysis results

[0085] The samples were divided into a control group (0uM) and an experimental group (50uM, 100uM). After differential analysis, we identified 1575 differentially expressed genes (DEGs). The volcano plot revealed the expression distribution of genes in the samples, including 1043 up-regulated genes and 532 down-regulated genes (see Figure 2 A). The heat map shows the distribution of gene expression in the two groups of samples (see Figure 2B). We used weighted gene co-expression network analysis (WGCNA) to analyze gene modules that were highly associated with traits. Figure 2 C shows the scale-free fit index and average connectivity under different soft thresholds. By analyzing the correlation between gene modules and features, we found that the darkgreen module was more correlated with the 50uM drug concentration (R = 0.81, p = 8.7e-3), while the black module (R = 0.83, p = 5.3e-3), grey60 (R = 0.89, p = 1.1e-3) and lightcyan (R = 0.71, p = 0.03) were most correlated with the 100uM drug concentration (see Figure 2 D). Therefore, we selected these four modules for subsequent analysis.

[0086] The Venn diagram visualized the intersection of DEGs and gene modules, revealing 65 overlapping genes (see Figure 2 E). Next, we performed enrichment analysis of GO functions and KEGG pathways for these overlapping genes. The analysis results showed that these overlapping genes were mainly enriched in biological processes such as vascular morphogenesis, vascular development, cardiovascular system development, and endothelial cell adhesion (BP) (see Figure 2 F), as well as the interaction between cytokines and cytokine receptors, the PI3K-Akt signaling pathway, and other disease or metabolic synthesis processes (see Figure 2 G).

[0087] 6.2QKCMP-Enhancer activates the PI3K / AKT pathway

[0088] By performing protein interaction analysis on 65 overlapping genes, we found that signaling pathways or biological processes such as blood vessel morphogenesis, Cytokine-cytokine receptor interaction, and PI3K-Akt-mTOR-signalingpathway were significantly enriched (see Figure 3 A). This paper focused on the PI3K-Akt-mTOR-signaling pathway and collected five differentially expressed genes (DEGs) related to this signaling pathway, namely CSF3, LPAR6, GNG11, ITGA10 and VWF. Then, we compared the expression levels of these five DEGs in different treatment groups and found that their transcription levels increased with the increase of QKCMP-Enhancer concentration. In particular, VWF and ITGA10 showed significant expression differences among the three groups (see Figure 3B). Therefore, we decided to use qRT-PCR and WB methods for further detection. The qRT-PCR results showed that the expression levels of VWF and ITGA10 gradually increased with the increase of QKCMP-Enhancer concentration (see Figure 3 C), and the protein expression results in WB detection were consistent with this (see Figure 3 D).

[0089] 6.3 The angiogenesis-promoting effect of QKCMP-Enhancer is closely related to the PI3K-AKT / Hippo signaling pathway

[0090] With the increase of QKCMP-Enhancer concentration, we observed that the mRNA and protein expression levels of AKT and its phosphorylated form (p-AKT) in human umbilical vein endothelial cells (HUVECs) increased significantly (see Figure 4 A). However, after application of PI3K inhibitor LY294002, the proliferation activity of HUVECs was significantly inhibited (see Figure 4 B). These findings indicate that QKCMP-Enhancer can activate the PI3K / AKT signaling pathway, but when this pathway is inhibited, the promoting effect of QKCMP-Enhancer on blood vessel growth is also inhibited. In our previous studies, we have found that the Hippo signaling pathway plays a role in the process of QKCMP-Enhancer promoting rapid endothelialization of blood vessels. Therefore, in the present invention, we detected the expression of key proteins of the Hippo signaling pathway in HUVECs. The results showed that in HUVECs treated with QKCMP-Enhancer, the mRNA levels of CTGF and YAP increased with the increase of QKCMP-Enhancer concentration (see Figure 4 C). However, after LY294002 treatment, the expression levels of YAP and CTGF were significantly decreased (see Figure 4 D). This result further confirmed that QKCMP-Enhancer can activate the Hippo signaling pathway.

[0091] Discussion

[0092] Angiogenesis is a key process in organisms, involving the degradation of the extracellular matrix, the migration, differentiation, proliferation, microtubule formation and the formation of new capillary branches of endothelial cells. Under normal physiological conditions, this process is strictly controlled by a variety of complex regulatory networks. The present invention explores the effects of QKCMP-Enhancer on angiogenesis in vivo and in vitro. Through zebrafish experiments, we found that QKCMP-Enhancer can significantly promote the formation and development of blood vessels, and as the concentration of QKCMP-Enhancer increases, the effects of angiogenesis and development become more significant. In vitro experiments further confirmed that QKCMP-Enhancer can promote the proliferation of human umbilical vein endothelial cells (HUVECs) and inhibit cell apoptosis.

[0093] The study first used bioinformatics analysis to identify a group of genes associated with QKCMP-Enhancer, and revealed the biological pathways involved in these genes through functional enrichment analysis. The overlapping genes between differentially expressed genes (DEGs) and key gene modules in weighted gene co-expression network analysis (WGCNA) were mainly enriched in biological functions such as angiogenesis and development, indicating that QKCMP-Enhancer plays an important role in regulating angiogenesis. In addition, these genes also showed significant enrichment in cytokine interactions and PI3K-AKT signaling pathways.

[0094] Further in vitro experiments showed that QKCMP-Enhancer may promote vascular endothelialization by regulating the PI3K-AKT and Hippo signaling pathways, thereby enhancing the proliferation of HUVECs, inhibiting cell apoptosis, and promoting cell growth. The growth of vascular endothelial cells involves multiple processes such as proliferation, adhesion, and migration, which play a key role in preventing blood coagulation. VEGF, as an important factor in promoting endothelial cell regeneration and angiogenesis, plays an important role in embryonic development, wound healing, and angiogenesis. The present invention is based on collagen-gelatin combined with VEGF mimetic peptide QKCMP-Enhancer, and its effect of promoting HUVEC cell proliferation and inhibiting cell apoptosis is verified by in vitro experiments. Studies have shown that high concentrations of QKCMP-Enhancer can be fixed on a new artificial matrix and play a role in promoting angiogenesis in vivo. The study focused on analyzing the interaction between QKCMP-Enhancer and the PI3K / AKT signaling pathway and the Hippo signaling pathway, both of which are involved in the regulation of cell growth and are closely related to angiogenesis.

[0095] Literature shows that the PI3K / AKT signaling pathway is closely related to cancer progression and promotes tumor development through gene regulation as a key signaling pathway. The formation of new blood vessels is a key step in tumor growth and metastasis, because active endothelial cells release a variety of pro-angiogenic factors, thereby promoting blood vessel growth. VEGF-A is one of the key pro-angiogenic factors, which plays an important role in embryonic development, wound healing and angiogenesis. The PI3K / AKT signaling pathway is an essential regulatory pathway for angiogenesis. The expression of VEGF-A can promote angiogenesis and tumor growth by inducing the PI3K / AKT signaling pathway. Studies have shown that nanomaterials can activate the PI3K / AKT signaling pathway by releasing VEGF, thereby affecting the endothelialization of vascular endothelial cells. In the present invention, by verifying the effect of QKCMP-Enhancer on two key proteins in the PI3K / AKT signaling pathway, it was found that the levels of these proteins were positively correlated with the concentration of QKCMP-Enhancer. This suggests that QKCMP-Enhancer, a collagen-gelatin-binding VEGF mimetic peptide, can regulate the PI3K / AKT signaling pathway and may promote angiogenesis by activating this pathway.

[0096] Another signaling pathway associated with endothelial cell proliferation and angiogenesis is the Hippo signaling pathway. The Hippo pathway is an evolutionarily conserved signaling cascade composed of Mst-mediated kinase cascade reactions, which is involved in biological processes such as regulating cell growth, controlling organ size and regeneration. Studies have shown that the Hippo-YAP signaling pathway has become a new pathway for vascular development. YAP and CTGF are key target genes of the Hippo signaling pathway, which regulates the shape and behavior of endothelial cells through actin cytoskeleton dynamics. VEGF signals are associated with the Hippo signaling pathway when they are transmitted to the transcriptional program. VEGF expression helps activate YAP, and YAP-mediated changes in gene expression also indirectly promote vascular growth and endothelial cell remodeling. In the present invention, QKCMP-Enhancer promotes the increase in the expression levels of YAP and CTGF in HUVECs, while inhibiting the Hippo signaling pathway. However, after treatment with LY294002, the levels of YAP and CTGF decreased significantly, and the proliferation of HUVECs was affected. This may be because LY294002 hinders the action of QKCMP-Enhancer and inhibits LATS1 / 2, resulting in the inability of unphosphorylated YAP to translocate into the nucleus and regulate the expression of downstream CTGF. Therefore, it is clear that QKCMP-Enhancer regulates vascular development through the PI3K / AKT / Hippo signaling pathway.

[0097] The present invention has conducted an in-depth study on the angiogenic effect of the PI3K / AKT / Hippo signaling pathway and analyzed its connection with QKCMP-Enhancer. The results show that QKCMP-Enhancer promotes HUVEC cell proliferation and accelerates vascular endothelialization by regulating PI3K / AKT / Hippo signaling, which is characterized by increasing the levels of YAP and CTGF in the Hippo signaling pathway by activating PI3K / AKT signaling. In summary, the present invention confirms that QKCMP-Enhancer has the effect of promoting proliferation and inhibiting apoptosis on HUVEC, and this effect is positively correlated with the concentration of QKCMP-Enhancer. In addition, the study also confirmed that PI3K / AKT / Hippo signaling is an important way for QKCMP-Enhancer to regulate the rapid endothelialization of HUVECs.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the specific implementation methods of the present invention can still be modified or replaced by equivalents. Any modification or equivalent replacement that does not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A collagen-gelatin combined with VEGF mimetic peptide, characterized in that: The sequence of the collagen-gelatin combined with VEGF mimetic peptide is: Ac-KLTWQELYQLKYKGI-(GPO)5-(KR)4-(RGD)4-(KR)4-GGG-(Gly)3-NH2; Among them, Ac is the N-terminal acetylation protection; KLTWQELYQLKYKGI is the QK domain; (GPO)5 is a triple helix structure that simulates collagen; (KR)4 is a repeated arginine and lysine sequence; (RGD)4 is a cell adhesion-rich sequence; (KR)4-GGG is a sequence rich in arginine and lysine; (Gly)3 is a flexible linker sequence; NH2 is C-terminal amidation.

2. A method for preparing the collagen-gelatin combined with VEGF mimetic peptide according to claim 1, characterized in that: include: After the resin is soaked and expanded in DMF or NMP, it is treated with a 20% piperidine solution to remove the N-terminal Fmoc protecting group; The amino acids with Fmoc protection groups were mixed with HBTU and DIPEA to activate the carboxyl groups; In the direction of synthesis from the N-terminus to the C-terminus, the activated amino acid reacts with the amino group on the resin to form a peptide bond; repeating the steps to couple the next amino acid according to the sequence described in claim 1 until the synthesis is completed; After the synthesis is completed, all side chain protecting groups are removed, and the polypeptide is cleaved from the resin to obtain the collagen-gelatin combined VEGF mimetic peptide.

3. The preparation method according to claim 2, characterized in that: After the synthesis is completed, all side chain protecting groups are removed and the peptide is cleaved from the resin to obtain the crude peptide; The crude polypeptide is freeze-dried, and impurities are removed by gradient elution with water and acetonitrile using a C18 column, and then purified using an ion exchange chromatography column to obtain the collagen-gelatin-bound VEGF mimetic peptide.

4. An application of the collagen-gelatin combined with VEGF mimetic peptide according to claim 1, characterized in that: The application includes at least one of the following: A1) Use of the collagen-gelatin combined with VEGF mimetic peptide in promoting cell proliferation; A2) Use of the collagen-gelatin combined with VEGF mimetic peptide in the preparation of a product that promotes cell proliferation; A3) Use of the collagen-gelatin combined with VEGF mimetic peptide in promoting blood vessel growth and / or development; A4) Use of the collagen-gelatin combined with VEGF mimetic peptide in the preparation of a product that promotes blood vessel growth and / or development A5) Use of the collagen-gelatin combined with VEGF mimetic peptide in inhibiting cell apoptosis; A6) Use of the collagen-gelatin combined with VEGF mimetic peptide in the preparation of a product for inhibiting cell apoptosis.

5. The use according to claim 4, characterized in that: The cells are HUVECs.

6. A method for promoting cell growth and / or development, characterized in that: include: The collagen-gelatin combined with VEGF mimetic peptide according to claim 1 is co-cultured with cells.

7. A method for inhibiting cell apoptosis, characterized in that: include: The collagen-gelatin combined with VEGF mimetic peptide according to claim 1 is co-cultured with cells.

8. A method for resisting cytostatic agents, characterized in that: include: Co-culturing the collagen-gelatin combined with VEGF mimetic peptide according to claim 1 with cells; Wherein, the cell inhibitor is an inhibitor that inhibits the PI 3K-AKT signaling pathway.

9. The method according to any one of claims 6 to 8, characterized in that: The cells are HUVECs.

Images