DsRNA (double-stranded ribonucleic acid) for preventing and controlling small beetles of honeycomb and application thereof

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) for preventing and treating small beetles of honeycomb and application of the dsRNA. According to the invention, a CYP4G279 (AtCYP4G279) gene of the small beetles is taken as a target, dsRNA is designed and injected into the bodies of the small beetles, the sequence of the dsRNA is as shown in SEQ ID NO.2, and the influence on the growth and development of the small beetles is observed; the result shows that after the AtCYP4G279dsRNA is injected, the survival rate of the small beetles is reduced, and the death rate of the small beetles after eclosion development is obviously improved; the method plays an important role in the aspect of influencing insect prevention and control. The compound can be used for preparing a preparation for preventing and treating the small beetles, and has an important effect in the prevention and treatment process of the small beetles.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and in particular relates to dsRNA for preventing and controlling honeycomb beetles and applications thereof. Background Art

[0002] Small hive beetle (Aethina tumida, Small hive beetle, SHB), also known as small beehive beetle or honeycomb beetle, is a Coleoptera insect that undergoes complete metamorphosis (developmental process: egg stage, larval stage, pupal stage and adult stage) and is an important pest that parasitizes bee colonies. It was originally distributed in southern Africa and then spread to Australia, America, Asia and other states and countries, causing varying degrees of harm to bee colonies and economic losses around the world. It is listed as one of the six major pathogens of bees by the World Organization for Animal Health (OIE). Both larvae and adults of small hive beetles can cause serious harm to bees. They feed on pollen, honey and bee larvae, which can lead to the death of bee larvae, fermentation of honey and damage to honeycombs, often causing the collapse of the entire hive and the bee colony to abandon the nest and flee.

[0003] At present, the main means of controlling honeycomb beetles is chemical control, but the large-scale use of chemical pesticides leads to the development of drug resistance, harm to bees and damage to the ecological environment, which is not conducive to the sustainable control of honeycomb beetles. Therefore, the development of green molecular targets for the control of honeycomb beetles is urgent.

[0004] RNA interference (RNAi) is a phenomenon of specific post-transcriptional gene silencing caused by double-stranded RNA (dsRNA) molecules. It is a powerful tool for studying gene function and has great potential in pest control. Pest control methods based on RNAi technology are specific and safe for non-target organisms. Honeycomb beetles belong to the order Coleoptera and have an efficient RNAi mechanism. Injecting dsRNA into honeycomb beetle eggs, larvae, pupae or adults can inhibit the expression of target genes. Therefore, screening out key targets that affect the growth and development of honeycomb beetles is of great significance for accelerating the use of RNAi technology in protecting bees and controlling honeycomb beetles. Summary of the invention

[0005] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art. The inventors took the AtCYP4G279 gene as a target, designed dsRNA, injected it into the body of the honeycomb beetle, and found that the survival rate of the honeycomb beetle was significantly inhibited. This shows that the AtCYP4G279 gene is an important target gene affecting the honeycomb beetle.

[0006] The technical solution adopted by the present invention is:

[0007] In a first aspect of the present invention, a use of an AtCYP4G279 gene inhibitor in any one of (a1) to (a8) is provided.

[0008] (a1) inhibiting the emergence of insects into adults;

[0009] (a2) preparing products for inhibiting the emergence of insects into adults;

[0010] (a3) inhibiting insect growth;

[0011] (a4) preparing products for inhibiting the growth of insects;

[0012] (a5) reduce insect survival rate;

[0013] (a6) preparing products that reduce insect survival;

[0014] (a7) controlling harmful insects;

[0015] (a8) Preparation of products for controlling harmful insects.

[0016] In some embodiments of the present invention, the AtCYP4G279 gene inhibitor includes a substance that inhibits AtCYP4G279 gene expression, silences or knocks out the gene, and / or a substance that inhibits the content and / or activity of the protein encoded by the AtCYP4G279 gene;

[0017] Preferably, the inhibitor comprises at least one of shRNA, siRNA, dsRNA, sgRNA, miRNA, cDNA, antisense RNA / DNA, small molecule compounds, peptides, and antibodies;

[0018] In some embodiments of the present invention, the harmful insects are Coleoptera insects.

[0019] In some embodiments of the present invention, the coleopteran insect is a honeycomb beetle.

[0020] In some embodiments of the present invention, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:2.

[0021] In a second aspect, the present invention provides a dsRNA, wherein the nucleotide sequence of the dsRNA is shown in SEQ ID NO:2.

[0022] In some embodiments of the present invention, the primer sequences for synthesizing the dsRNA are shown in SEQ ID NO:3 and SEQ ID NO:4.

[0023] The third aspect of the present invention provides a biological material related to the dsRNA according to the second aspect of the present invention, wherein the biological material is any one of the following (b1) to (b8):

[0024] (b1) a nucleic acid molecule encoding the dsRNA;

[0025] (b2) an expression cassette containing the nucleic acid molecule described in (b1);

[0026] (b3) a recombinant vector containing the nucleic acid molecule described in (b1);

[0027] (b4) a recombinant vector containing the expression cassette described in (b2);

[0028] (b5) a recombinant microorganism containing the nucleic acid molecule described in (b1);

[0029] (b6) a recombinant microorganism containing the expression cassette described in (b2);

[0030] (b7) a recombinant microorganism containing the recombinant vector described in (b3);

[0031] (b8) A recombinant microorganism containing the recombinant vector described in (b4).

[0032] The fourth aspect of the present invention provides the use of the dsRNA described in the second aspect of the present invention or the related biological material described in the third aspect of the present invention in any one of (a1) to (a8),

[0033] (a1) inhibiting the emergence of insects into adults;

[0034] (a2) preparing products for inhibiting the emergence of insects into adults;

[0035] (a3) inhibiting insect growth;

[0036] (a4) preparing products for inhibiting the growth of insects;

[0037] (a5) reduce insect survival rate;

[0038] (a6) preparing products that reduce insect survival;

[0039] (a7) controlling harmful insects;

[0040] (a8) Preparation of products for controlling harmful insects.

[0041] In some embodiments of the present invention, the harmful insects are Coleoptera insects.

[0042] In some embodiments of the present invention, the coleopteran insect is a honeycomb beetle.

[0043] The fifth aspect of the present invention provides a product, comprising the dsRNA described in the fourth aspect of the present invention or the related biological material described in the fifth aspect.

[0044] In some embodiments of the present invention, the function of the product is any one of (a1) to (a8),

[0045] (a1) inhibiting the emergence of insects into adults;

[0046] (a2) preparing products for inhibiting the emergence of insects into adults;

[0047] (a3) inhibiting insect growth;

[0048] (a4) preparing products for inhibiting the growth of insects;

[0049] (a5) reduce insect survival rate;

[0050] (a6) preparing products that reduce insect survival;

[0051] (a7) controlling harmful insects;

[0052] (a8) Preparation of products for controlling harmful insects.

[0053] In some embodiments of the present invention, the harmful insects are Coleoptera insects.

[0054] In some embodiments of the present invention, the coleopteran insect is a honeycomb beetle.

[0055] In some embodiments of the present invention, the product is a spray formulation or a bait.

[0056] The sixth aspect of the present invention provides a method for controlling harmful insects, the method comprising: the method comprising: down-regulating the expression or activity of the AtCYP4G279 gene in the harmful insects.

[0057] In some embodiments of the present invention, the method for down-regulating the expression or activity of the AtCYP4G279 gene in the body of the harmful insect comprises: knocking out or silencing the AtCYP4G279 gene in the genome of the harmful insect; or transferring a down-regulator that down-regulates the transcription, polypeptide expression or polypeptide activity of the AtCYP4G279 gene into the body of the harmful insect.

[0058] In some embodiments of the present invention, the method utilizes the AtCYP4G279 gene inhibitor described in the first aspect of the present invention to be transferred into the body of the harmful insect.

[0059] In some embodiments of the present invention, the AtCYP4G279 gene inhibitor includes the dsRNA or dsRNA-related biological materials in the use described in the second aspect of the present invention.

[0060] In some embodiments of the present invention, the harmful insects are Coleoptera insects.

[0061] In some embodiments of the present invention, the coleopteran insect is a honeycomb beetle.

[0062] The beneficial effects of the present invention are:

[0063] The present invention takes the AtCYP4G279 gene as a target, designs dsRNA and injects it into the body of a small honeycomb beetle, observes the effect on the growth and development of the small honeycomb beetle, and finds that after the AtCYP4G279 dsRNA is injected, the survival rate of the small honeycomb beetle is reduced, and the mortality rate of the small honeycomb beetle after emergence and development is significantly increased; this has an important effect on insect control; for example, it is used to prepare a preparation for controlling the small honeycomb beetle, and plays an important role in the control process of the small honeycomb beetle. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 This is a diagram showing the effect of dsAtCYP4G279 on the expression of the AtCYP4G279 gene in the honeycomb beetle: where ** indicates P < 0.01.

[0065] Figure 2 is a diagram showing the effect of dsAtCYP4G279 on the phenotype of honeycomb beetles.

[0066] Figure 3 This is a graph showing the effect of dsAtCYP4G279 on the survival rate of honeycomb beetles. DETAILED DESCRIPTION

[0067] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0068] Example 1 Obtaining the sequence of AtCYP4G279 and its dsRNA of the honeycomb beetle

[0069] 1. Obtaining the gene sequence of AtCYP4G279 of the honeycomb beetle

[0070] Based on the genome and transcriptome database of the honeycomb beetle, the sequence of the CYP4G gene of the honeycomb beetle was searched by bioinformatics methods. After sequence analysis and alignment, a honeycomb beetle CYP4G15-like (LOC126266327) sequence was obtained, which was further named CYP4G279 gene by the Cytochrome P450 Nomenclature Committee and the gene sequence ID after submission to NCBI was PQ120686. Based on the above gene fragments, the upstream and downstream primers were designed using Primer premier 5.0 software and synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0071]

[0072] 2. dsRNA synthesis of AtCYP4G279 in the honeycomb beetle

[0073] 1) Design of dsRNA primers for AtCYP4G279 of the honeycomb beetle

[0074] Based on the sequence of AtCYP4G279 of the honeycomb beetle obtained in 1, dsRNA primers were designed using Primer premier 5.0 software, and their sequences were SEQ ID NO: 3 (taatacgactcactatagggTATCCATCTCCGTCACACGA) and SEQ ID NO: 4 (taatacgactcactatagggTCTTGTACGACGCGTTCTTG), and then sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis.

[0075] 2) Synthesis of AtCYP4G279 dsRNA of the honeycomb beetle

[0076] The AtCYP4G279 gene plasmid obtained in 1 was used as a template, and SEQ ID NO: 3 and SEQ ID NO: 4 were used as upstream and downstream primers for PCR amplification. The amplified PCR product was purified and then purified by T7 RiboMAX TMThe dsAtCYP4G279 was synthesized by in vitro transcription using the Express RNAi System (Promega) kit. The sequence of the nucleic acid molecule synthesized by dsAtCYP4G279 is TATCCATCTCCGTCACACGAAATTCTGGCTCAGACCTGA CCTGATTTTCAACTTCACTAAATACGGAAACTATCAAGAAAAGCTTATCAACACAATTCACAGTTTAACGCGTAAAGTTATCAAGAGGAAGAAGGCTGATTTTATGCAAGGTATTCGTGGATCTACTGCTGAAGTGCCTGAAAATTTGAAAACTAAGAACTACGAGAAACAAGAGGCCAAGAACAAGACCGTTGTTGAAGGATTATCATATGGACAATCAGCAGGCCTTA AGGATGATCTGGATGTTGATGATGATATTGGAGAGAAGAAGAGAATGGCTTTCTTGGATCTTATGATTGAAGCTTCACAAAACGGCGTTGTTATCAACGATGAGGAAATTAAGGAACAAGTGGATACCATTATGTTTGAGGGACACGATACCACTGCTGCAGGAAGCAGTTTCTTCTTGTCAATGATGGGTATTCACCCACATATTCAAGAACGCGTCGTACAAGA (SEQ ID NO: 2). NanoDrop 2000 (Thermoscientific) was used for quantification to make the final concentration reach 1.0 μg / μL and stored in a -20°C low-temperature refrigerator for future use.

[0077] Example 2 Application of AtCYP4G279 dsRNA of honeycomb beetle

[0078] 1. Injection of dsRNA specific for the AtCYP4G279 gene of the honeycomb beetle

[0079] 1 μL (1 μg) of dsRNA (dsAtCYP4G279) composed of nucleotides shown in SEQ ID NO: 2 and nucleotides shown in its reverse complementary sequence was injected into the seventh-day-old larvae of honeycomb beetles using a 10 μL microsyringe, and a total of 60 larvae were injected. The same volume concentration of dsGFP was injected into the control group, and the sequence of the nucleic acid molecule synthesizing dsGFP was (SEQ ID NO: 5), and a total of 60 larvae were injected. The injected honeycomb beetles were placed in a 30°C constant temperature biochemical incubator for breeding.

[0080] 2. Detection of gene silencing efficiency of AtCYP4G279 in honeycomb beetle

[0081] 48 hours after dsRNA injection, the whole larvae were taken for RNA extraction and reverse transcribed into the first-chain cDNA. Real-time PCR was used to detect the relative expression levels of the target gene (AtCYP4G279) and the housekeeping gene (GAPDH) to calculate the silencing efficiency of the target gene: the reaction system was as follows: 10 μL of SYBR Green mixture, 0.8 μL of each upstream and downstream primers (10 μM), 2 μL of the above-mentioned first-chain cDNA template diluted 10 times, and 6.4 μL of deionized water. The reaction procedure was as follows: pre-denaturation at 95°C for 1 min, denaturation at 95°C for 15 s; annealing and extension at 60°C for 31 s, 40 cycles, fluorescence detection at 60°C, DNA melting analysis at 60-95°C, with an increase of 1°C per step; the primer sequences were as follows: AtCYP4G279-F: GTTCCCAGTTCGGGACTGTT (SEQ ID NO: 6); AtCYP4G279-R: TCCGGGAATCTTTTCGGCAA (SEQ ID NO: 7); GAPDH-F: GAAAACTGTCGACGGT CCCT (SEQ ID NO: 8); GAPDH-R: TGGGACACGGAAAGCCATAC (SEQ ID NO: 9). Four biological replicates were set up, and three larvae were taken for each biological replicate.

[0082] The results are as follows Figure 1 As shown: Compared with the control group (injected with dsGFP), the expression of AtCYP4G279 gene in the experimental group (injected with dsAtCYP4G279) was significantly reduced.

[0083] 3. Effects of dsRNA injection on the growth and development of honeycomb beetles

[0084] The seventh-day-old larvae were injected with dsRNA to detect the effect of dsRNA injection on the growth and development of the honeycomb beetle;

[0085] The results are as follows Figure 2 As shown in the figure: 100% of the larvae (48) in the control group (injected with dsGFP) emerged as normal adults; while 45% of the larvae (48) in the experimental group (injected with dsAtCYP4G279) showed a lethal phenotype of adults unable to unfold their wings when they emerged. The survival rate of the adults that emerged normally after injection of dsAtCYP4G279 was further counted every 12 hours, as shown in the figure: Figure 3 As shown, the survival rate of the small beetles in the experimental group was significantly lower than that in the control group (log-rank test P<0.0001).

[0086] In summary, targeted silencing of the AtCYP4G279 gene through RNA interference technology can effectively inhibit the expression of the AtCYP4G279 gene, thereby increasing the mortality rate of the honeycomb beetle after emergence and development.

[0087] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of an AtCYP4G279 gene inhibitor in any one of (a1) to (a8), (a1) inhibiting the emergence of insects into adults; (a2) preparing products for inhibiting the emergence of insects into adults; (a3) inhibiting insect growth; (a4) preparing products for inhibiting the growth of insects; (a5) reduce insect survival rate; (a6) preparing products that reduce insect survival; (a7) controlling harmful insects; (a8) preparing products for controlling harmful insects; The harmful insects are Coleoptera insects; the Coleoptera insects are small beetles.

2. The use according to claim 1, characterized in that: The gene inhibitor includes substances that inhibit the expression of AtCYP4G279, silence or knock out the gene, and / or substances that inhibit the content and / or activity of the protein encoded by AtCYP4G279; Preferably, the inhibitor comprises at least one of shRNA, siRNA, dsRNA, sgRNA, miRNA, cDNA, antisense RNA / DNA, small molecule compounds, peptides, and antibodies; Preferably, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

3. A dsRNA, the nucleotide sequence of which is shown in SEQ ID NO:

2.

4. The dsRNA according to claim 3, characterized in that The primer sequences for synthesizing the dsRNA are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

5. The dsRNA-related biological material according to claim 3 or 4, wherein the related biological material is any one of the following (b1) to (b8): (b1) a nucleic acid molecule encoding the dsRNA; (b2) an expression cassette containing the nucleic acid molecule described in (b1); (b3) a recombinant vector containing the nucleic acid molecule described in (b1); (b4) a recombinant vector containing the expression cassette described in (b2); (b5) a recombinant microorganism containing the nucleic acid molecule described in (b1); (b6) a recombinant microorganism containing the expression cassette described in (b2); (b7) a recombinant microorganism containing the recombinant vector described in (b3); (b8) A recombinant microorganism containing the recombinant vector described in (b4).

6. Use of the relevant biological material according to claim 5 in any one of (a1) to (a8), (a1) inhibiting the emergence of insects into adults; (a2) preparing products for inhibiting the emergence of insects into adults; (a3) inhibiting insect growth; (a4) preparing products for inhibiting the growth of insects; (a5) reduce insect survival rate; (a6) preparing products that reduce insect survival; (a7) controlling harmful insects; (a8) preparing products for controlling harmful insects; Preferably, the harmful insects are Coleoptera insects; Preferably, the coleopteran insect is a honeycomb beetle.

7. A product comprising the dsRNA of claim 3 or 4 or the related biological material of claim 5.

8. The product according to claim 7, characterized in that The product is a sprayable preparation or a bait.

9. A method for controlling harmful insects, the method comprising: Down-regulating the expression or activity of the AtCYP4G279 gene in the body of the harmful insect; preferably, the method for down-regulating the expression or activity of the AtCYP4G279 gene in the body of the harmful insect comprises: knocking out or silencing the AtCYP4G279 gene in the genome of the harmful insect; or transferring a down-regulator that down-regulates the transcription, polypeptide expression or polypeptide activity of the AtCYP4G279 gene into the body of the harmful insect.

10. The method according to claim 9, characterized in that The method comprises transferring the dsRNA of claim 3 or 4 or the related biological material of claim 5 into the body of the harmful insect.

Images