Duckweed-based edible vaccines

Abstract

The invention discloses an edible vaccine based on duckweed. Transgenic duckweed is used to orally deliver its expressed antigen to the intestinal tract, which stimulates the mucosal immune system of the intestinal tract to induce an immune response. The duckweed vaccine is characterized by inducing humoral immunity and mucosal immunity against an antigen in a subject eating the vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and relates to nucleic acid molecules encoding antigenic proteins, recombinant expression vectors and applications thereof, and edible vaccines based on duckweed. Background Art

[0002] Vaccines are the most effective means of preventing infectious diseases. Most pathogens can invade the body through the mucosal site. Mucosal vaccines refer to vaccines that are inoculated at the mucosal site and can successfully induce an immune response. Mucosal vaccines act on the mucosal immune system. In addition to inducing systemic immune responses, they can also induce local mucosal immune responses to produce secretory IgA antibodies to prevent pathogens from infecting the mucosal site. Traditional injectable vaccines can only induce systemic immune responses and it is difficult to activate local mucosal immunity. Therefore, for infectious diseases that are infected through the mucosa, mucosal vaccines have more advantages than injectable vaccines.

[0003] Using edible plants to express antigens and deliver them orally to the intestine, the largest mucosal immune organ in the body, is a new strategy for developing mucosal vaccines. Transgenic edible plants can not only serve as biofactories to express antigens, but also act as oral delivery vehicles. The cell walls of plant cells can protect antigens expressed in plant cells from degradation by the digestive system during oral administration, thereby safely delivering antigens to the intestinal mucosa. This technology does not require expensive downstream extraction and purification processes, has great cost advantages, and the prepared vaccines can be stored at room temperature without the need for a cold chain, which can increase the convenience of vaccine circulation and use.

[0004] Duckweed is the smallest flowering plant on earth and has a very simple structure. Duckweed has a high protein content and has traditionally been used to feed poultry and livestock. Duckweed grows very fast and can double its biomass within 16 to 48 hours under suitable conditions, making it one of the fastest growing plants. In addition, duckweed can be cultivated in a closed system without occupying arable land, thus avoiding the risk of releasing genetically modified organisms into the environment. Therefore, compared with edible plants such as corn, lettuce, and rice, using duckweed to develop edible vaccines has great advantages.

[0005] Poultry is the largest livestock industry in the world. In the poultry industry, the prevention and control of infectious diseases is an important issue. Infectious bronchitis (IB) is an acute, highly contagious disease caused by avian infectious bronchitis virus (IBV), accompanied by respiratory symptoms, urinary and reproductive system failure, leading to low egg production and death in poultry. IBV belongs to the Coronaviridae family and the Coronavirinae genus. Its virion contains a positive single-stranded RNA. Since it was first reported in the United States in 1931, IBV has spread to all countries and regions with poultry farming in the world, causing huge losses to the poultry industry. IBV is transmitted through the respiratory route, mainly colonizing in the respiratory system, followed by the kidneys, reproductive system and intestinal system, causing damage to the trachea, kidneys and reproductive system, reducing the body's immunity and the production and quality of eggs. Chickens infected with IBV will show respiratory symptoms. Due to damage to tracheal cilia, chickens infected with IBV are susceptible to infection by other viruses and bacteria, resulting in a high mortality rate.

[0006] Vaccination is the most effective way to prevent IBV infection. Currently, the IBV vaccines on the market include attenuated vaccines and inactivated vaccines. Attenuated vaccines are the first generation of vaccines used for IBV prevention and control. They are administered by spray or drinking water, and booster immunization is performed 2 to 3 weeks after vaccination. The vaccination method is simple and can induce systemic and mucosal immune responses in the body, but there is a risk of virulence reversion and tissue damage after vaccination. Inactivated vaccines do not replicate in the body and are relatively safe, but they cannot induce strong cellular immune responses or activate mucosal immune responses. In addition, inactivated vaccines need to be injected into each chicken, which has a high labor cost and may cause carcass rejection at the vaccination site, affecting the quality of the chicken. Therefore, the development of oral IBV vaccines with lower production costs, more convenient use, and more safety and effectiveness has become a research hotspot in this field. Summary of the invention

[0007] The purpose of the present invention is to provide nucleic acid molecules encoding antigenic proteins, recombinant expression vectors, applications of nucleic acid molecules encoding antigenic proteins, recombinant expression vectors and transgenic duckweed containing the nucleic acid molecules encoding antigenic proteins, as well as edible vaccines based on duckweed, to provide an edible vaccine with lower production cost, more convenient circulation and use, and safe and effective for the prevention or treatment of IBV infection.

[0008] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides a nucleic acid molecule encoding an antigen protein, wherein the nucleotide sequence of the nucleic acid molecule is selected from:

[0010] (a) a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.4; or

[0011] (b) A nucleotide sequence encoding the same antigenic protein as the nucleotide sequence defined in (a).

[0012] In a second aspect, the present invention provides a recombinant expression vector comprising the above-mentioned nucleic acid molecule encoding the antigen protein, wherein the recombinant expression vector is formed by recombining the nucleic acid molecule encoding the antigen protein into a plant overexpression vector driven by a strong promoter.

[0013] The present invention has been experimentally verified that the nucleic acid molecule encoding the antigen protein is recombined into a plant overexpression vector driven by a strong promoter to form a recombinant expression vector, and the obtained recombinant expression vector is introduced into duckweed to overexpress the nucleic acid molecule encoding the antigen protein, thereby obtaining transgenic duckweed. The transgenic duckweed is used as an edible vaccine (an edible vaccine without a vaccine adjuvant), and the edible vaccine without a vaccine adjuvant is orally administered to chickens. In an IBV virus challenge experiment of chickens, the edible vaccine without a vaccine adjuvant can induce IBV-specific IgG antibodies, anti-IBV mucosal antibodies sIgA, and reduce tissue viral load. The transgenic duckweed and a vaccine adjuvant (transgenic duckweed expressing the cytokine IL-17B) were used together as an edible vaccine (edible vaccine containing a vaccine adjuvant). After the edible vaccine containing the vaccine adjuvant was orally administered to chickens, in the IBV virus challenge experiment on chickens, the levels of IBV-specific IgG antibodies, anti-IBV mucosal antibodies sIgA, and reduced tissue viral load induced by the edible vaccine containing the vaccine adjuvant were higher than those of the aforementioned edible vaccine without a vaccine adjuvant.

[0014] In the third aspect, based on the above experimental results, the present invention provides the use of the above nucleic acid molecules encoding antigenic proteins or the above recombinant expression vectors in the preparation of vaccines, drugs or feed additives for preventing or treating IBV infection. The present invention also provides the use of transgenic duckweed containing the above nucleic acid molecules encoding antigenic proteins in the preparation of vaccines, drugs or feed additives for preventing or treating IBV infection. Furthermore, the vaccine for preventing or treating IBV infection includes an edible vaccine.

[0015] In the technical scheme of the above application, the transgenic duckweed containing the nucleic acid molecule encoding the antigen protein is obtained by recombining the nucleic acid molecule encoding the antigen protein into a plant overexpression vector driven by a strong promoter, and introducing the obtained recombinant expression vector into duckweed to overexpress the nucleic acid molecule encoding the antigen protein.

[0016] Furthermore, the present invention also provides the use of the above-mentioned nucleic acid molecules encoding antigenic proteins, the above-mentioned recombinant expression vectors or transgenic duckweed containing the above-mentioned nucleic acid molecules encoding antigenic proteins in preventing infectious diseases, and the use includes the following aspects: (1) inducing mucosal immune response through oral administration, (2) preventing or treating IBV infection-related diseases, (3) preparing IBV antigens or antibodies, (4) delivering antigens, and (5) preparing animal feed.

[0017] In a fourth aspect, based on the above experimental results, the present invention also provides an edible vaccine based on duckweed, wherein the edible vaccine includes a transgenic duckweed containing the above nucleic acid molecule encoding the antigen protein. The edible vaccine uses the transgenic duckweed containing the above nucleic acid molecule encoding the antigen protein as the only component or the main component, and whether other auxiliary components are used or what auxiliary components are used can be determined by referring to the prior art.

[0018] Furthermore, in the technical solution of the above-mentioned duckweed-based edible vaccine, the edible vaccine also contains a vaccine adjuvant, and the vaccine adjuvant is a transgenic plant expressing the cytokine IL-17B. Furthermore, the transgenic plant expressing the cytokine IL-17B is a transgenic duckweed expressing the cytokine IL-17B. When the edible vaccine contains a vaccine adjuvant, the edible vaccine uses the transgenic duckweed containing the nucleic acid molecule encoding the antigen protein and the vaccine adjuvant as the main components, and whether to use other auxiliary components or what kind of auxiliary components to use can be determined by referring to the existing technology.

[0019] The technical solution provided by the present invention produces the following beneficial technical effects:

[0020] 1. The present invention provides a nucleic acid molecule encoding an antigen protein and a recombinant expression vector, and constructs a transgenic duckweed containing the nucleic acid molecule encoding the antigen protein based on the nucleic acid molecule encoding the antigen protein or the recombinant expression vector. The present invention verifies through experiments that after the transgenic duckweed is used as an edible vaccine (an edible vaccine without a vaccine adjuvant), or the transgenic duckweed and a vaccine adjuvant are used together as an edible vaccine (an edible vaccine with a vaccine adjuvant), and the edible vaccine is orally administered to chickens, in an IBV virus challenge experiment on chickens, the edible vaccines without a vaccine adjuvant and with a vaccine adjuvant both obtain a 100% protection rate, which is consistent with the protection rate of a commercial IBV H120 vaccine administered orally to chickens; the edible vaccine without a vaccine adjuvant is superior to the IBV H120 vaccine in some immunological indicators, for example, the serum IBV-specific IgG antibody level induced by the edible vaccine without a vaccine adjuvant and the ability to reduce the viral load in tracheal tissue are significantly higher than those of the IBV H120 vaccine; the edible vaccine with a vaccine adjuvant is superior to the IBV H120 vaccine in most of the indicators tested. H120 vaccine, for example, the edible vaccine containing vaccine adjuvant induces serum IBV-specific IgG antibody levels, tracheal tissue mucosal antibody sIgA levels, intestinal tissue mucosal antibody sIgA levels, and the ability to reduce tracheal tissue viral load are significantly higher than IBV H120 vaccine, which indicates that the humoral immune response and mucosal immune response induced by the edible vaccine containing vaccine adjuvant of the present invention are stronger than those of IBV H120 vaccine.

[0021] 2. The edible vaccine based on duckweed provided by the present invention uses duckweed as a plant factory to express IBV antigens, and uses duckweed as an oral delivery carrier to deliver antigens. Compared with traditional vaccines, the edible vaccine based on duckweed of the present invention has the following advantages: (1) The production cost of the edible vaccine based on duckweed is low, and it can be directly taken orally without separating and purifying the antigen, avoiding the expensive downstream extraction and purification process, and having great cost advantages. At the same time, duckweed has an extremely fast growth rate and a short growth cycle, and can be mass-produced through a three-dimensional cultivation mode, which is conducive to further reducing production costs; (2) The edible vaccine based on duckweed can be stored at room temperature and does not require a cold chain, making it more convenient to circulate and use; (3) The edible vaccine based on duckweed is immunized orally and does not require injection. When used for livestock and poultry epidemic prevention, it can also be made into feed or feed additives for use, which is not only convenient to use, but also can save the labor cost of injection; (4) The edible vaccine based on duckweed can induce mucosal immune response through oral administration, which is more advantageous for infectious diseases infected by mucosa. Therefore, the edible vaccine based on duckweed of the present invention has great application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the structure of the plant binary expression vector used in Example 2 for expressing antigens in plants.

[0023] Figure 2 This is the experimental result of Example 3, in which the PCR technique was used to screen the antigen gene-positive stable expression strain at the DNA level. In the figure, M: Marker.

[0024] Figure 3 This is the experimental result of Example 3, which uses Western Blot technology to screen the antigen protein-positive stable expression strain at the protein level. In the figure, M: Marker, w: non-transgenic wild-type duckweed ZH0403.

[0025] Figure 4 This is the test result of IBV-specific antibodies in the serum induced by the vaccine in Example 4. In the figure, *: p<0.05, ***: p<0.001.

[0026] Figure 5 These are the test results of the anti-IBV mucosal antibody sIgA levels in tracheal and intestinal tissues induced by the vaccine in Example 4, wherein (a) shows the tracheal mucosal antibody sIgA levels, and (b) shows the intestinal mucosal antibody sIgA levels. In the figures, *: p<0.05, **: p<0.01.

[0027] Figure 6 These are the test results of the viral loads in the trachea, kidney, and lung tissues after the virus attack in Example 4. In the figure, *: p<0.05, **: p<0.01, ***: p<0.001. DETAILED DESCRIPTION

[0028] The nucleic acid molecules encoding antigenic proteins, recombinant expression vectors, nucleic acid molecules encoding antigenic proteins, recombinant expression vectors or transgenic duckweed containing nucleic acid molecules encoding antigenic proteins provided by the present invention, and edible vaccines based on duckweed are further described by the following examples. The test methods used in the following examples are conventional methods in the art unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. In the following examples, the duckweed ZH0403 is derived from the duckweed germplasm resource bank of the Chengdu Institute of Biology, Chinese Academy of Sciences.

[0029] Example 1: Optimization of nucleotide sequences encoding IBV antigenic proteins

[0030] Using IBV multi-epitope peptide as antigen protein, codon optimization is performed according to the known codon preference of duckweed to obtain a nucleotide sequence encoding an antigen protein suitable for expression in duckweed as shown in SEQ ID NO.1. The signal peptide is preferably the signal peptide (PR-1a signal peptide) of tobacco PR-1a protein (GenBank Accession NO: X12737) and the KDEL endoplasmic reticulum retention signal peptide. The PR-1a signal peptide and His tag are added to the antigen protein, and the nucleotide sequence encoding the antigen protein with the PR-1a signal peptide and His tag is shown in SEQ ID NO.2. The KDEL signal peptide and His tag are added to the antigen protein, and the nucleotide sequence encoding the antigen protein with the KDEL signal peptide and His tag is shown in SEQ ID NO.3. The PR-1a signal peptide, KDEL signal peptide and His tag are added to the antigen protein, and the nucleotide sequence encoding the antigen protein with double signal peptides and His tag is shown in SEQ ID NO.4. The nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.4 are synthesized.

[0031] Example 2: Construction of IBV antigen protein expression vector

[0032] The nucleotide sequence shown in SEQ ID NO.4 was cloned into the pCambia2301 plant binary expression vector. The pCambia2301 vector map is shown in Figure 1 The specific steps are as follows:

[0033] (1) PCR amplification of target gene

[0034] Design primers containing vector sequences and restriction sites to amplify the target gene by PCR reaction. The primer sequences are shown in Table 1, and the PCR reaction system is shown in Table 2:

[0035] Table 1

[0036]

[0037] Table 2

[0038]

[0039]

[0040] (2) Linearization of expression vector plasmid

[0041] The target gene is inserted through the restriction sites NcoI and PmlI at both ends of the GUS reporter gene on the vector to replace the GUS sequence on the vector. Since there are two NcoI sites on the vector, the vector is first digested with the restriction endonuclease XhoI. The digestion reaction system is shown in Table 3. After digestion, the large fragment is recovered by gel and connected overnight with T4-DNA ligase. The ligation product is transferred into DH5α competent cells, and a single clone is picked for sequencing verification. The bacterial solution with correct sequencing is selected to extract the plasmid. The plasmid is double-digested with restriction endonucleases NcoI and PmlI. The digestion system is shown in Table 3. After double digestion, the large fragment is recovered by gel.

[0042] Table 3

[0043]

[0044] Note: The amount of enzyme added in the double enzyme digestion system is 1 μL each

[0045] (3) Linearized plasmid and target gene ligation

[0046] The target gene and the linearized plasmid obtained in the above two steps were measured for concentration and connected by homologous recombination. The connection reaction system is shown in Table 4. After the reaction system is mixed, react at 37°C for 30 minutes and immediately cool on ice.

[0047] Table 4

[0048]

[0049]

[0050] Note: X and Y are calculated based on the concentration and content requirements. The DNA content contained in the linearized plasmid volume XμL is (0.02×the number of base pairs of the plasmid) ng; the DNA content contained in the target gene volume YμL is (0.02×the number of base pairs of the target gene) ng.

[0051] (4) Identification

[0052] The antigen protein expression vector constructed above was transferred into competent cells DH5α, single clones were picked for colony PCR, colonies with target size fragments were shaken to extract plasmids, and the plasmids were sent for sequencing.

[0053] Example 3: Construction of transgenic duckweed expressing IBV antigen protein

[0054] (1) Inducing duckweed callus

[0055] The preserved duckweed ZH0403 was inoculated into Hoagland liquid medium for resuscitation, and the revived duckweed fronds were inoculated into callus induction medium for callus induction. The callus induction medium was formed by adding 5 μM 2,4-dichlorophenoxyacetic acid, 0.5 μM thidiazuron, 30 g / L sucrose, and 3.5 g / L gellan gum to MS basal medium, and the pH of the callus induction medium was 5.6.

[0056] (2) Transformation of Agrobacterium with antigen protein expression vector

[0057] The IBV antigen protein expression vector constructed in Example 2 was transformed into Agrobacterium tumefaciens GV3101 by heat shock method. After transformation, the plate was coated, and the colonies on the plate were picked for colony PCR and sent for sequencing. The bacteria with correct sequencing were stored at -80°C.

[0058] (3) Callus transformation

[0059] The callus of duckweed was infected with the successfully sequenced Agrobacterium GV3101. The process was repeated three times independently. The infection steps were as follows: the successfully transformed Agrobacterium GV3101 was activated overnight; 500 μL of the activated bacterial solution was inoculated into the liquid LB medium containing Kan antibiotics and continued to be cultured. When the bacterial concentration reached OD 600 =0.6, terminate the culture; resuspend the centrifuged bacteria with a resuspension solution and place at room temperature for 1 hour; pick 3g of bright green callus tissue and put it in the resuspended bacteria, and after 3 to 5 minutes, place the callus tissue in a solid co-culture medium and culture it in a 25°C incubator in the dark for 3 days. The co-culture medium is formed by adding 1μM 2,4-dichlorophenoxyacetic acid, 0.2μM 6-benzylaminoadenine, 100μM acetosyringone, 30g / L sucrose, and 3.5g / L gellan gum to MS basal culture medium, and the pH of the co-culture medium is 5.6.

[0060] (4) Screening and regeneration of stable expression strains

[0061] The co-cultured callus was placed on the callus screening medium and cultured in an incubator for 30 days. The conditions in the incubator were a temperature of 25°C, a photoperiod of 16h:8h, and a light intensity of 50 μmol m -2 s -1 The selected callus tissue was transferred to the regeneration medium and maintained at a temperature of 25°C, a photoperiod of 24 h, and a light intensity of 200 μmol m -2 s -1 During the callus regeneration process, the callus gradually differentiated into complete leaves. The leaves grown from each callus were picked, numbered and placed on a plate for growth.

[0062] The callus screening medium is formed by adding 1 μM 2,4-dichlorophenoxyacetic acid, 0.2 μM 6-benzylaminoadenine, 100 mg / L G418, 200 mg / L cephalosporin, 30 g / L sucrose, and 3.5 g / L gellan gum to the MS basic medium, and the pH of the callus screening medium is 5.6. The regeneration medium is formed by adding 5 g / L sucrose, 100 mg / L G418, 200 mg / L cephalosporin, and 3.5 g / L gellan gum to the 1 / 2SH medium, and the pH of the regeneration medium is 5.6.

[0063] (5) Identification

[0064] The 67 numbered thallus strains on the plate were selected to extract genomic DNA and total protein, and positive strains were identified at the DNA level and protein level. The genomic DNA was tested by PCR using specific primers for IVB antigen (primer sequences are shown in Table 5). The results of agarose gel electrophoresis are shown in Figure 2 The total protein was detected by Western Blot using anti-His antibody. The experimental results are shown in Figure 3 According to the results of Western Blot experiments, the strain with the highest expression of IBV antigen protein was selected for subsequent experiments.

[0065] Table 5

[0066]

[0067] (6) Expanding the culture to prepare edible vaccines

[0068] The strain stably expressing the IBV antigen protein selected in step (5) is expanded and cultured, and then the transgenic duckweed is harvested and frozen and stored at -80°C for later use. The frozen transgenic duckweed is taken out and placed in a vacuum freeze dryer until the water evaporates completely. After the sample returns to room temperature, it is crushed into powder, and the powder is stored at 4°C for later use. The powder is an edible vaccine based on duckweed.

[0069] Example 4: Oral immunization of chickens with the vaccine and IBV virus challenge, and comparison with commercial IBV H120 vaccine

[0070] (1) Grouping, immunization procedures and IBV virus challenge plan for SPF chickens

[0071] The SPF chicks hatched from SPF eggs were transferred to SPF isolators for feeding, and when the chicks were seven days old, they were randomly divided into a PBS control group (PBS), a positive reference H120 group (H120), a duckweed vaccine group (IBVag), and a duckweed vaccine + vaccine adjuvant group (IBVag-IL17B), with ten chicks in each group. The positive reference was a commercialized IBV H120 attenuated vaccine (Huakezhi, manufactured by Sichuan Huapai Bioengineering Group Co., Ltd.). The vaccine used in the duckweed vaccine group (IBVag) was the edible duckweed-based vaccine prepared in Example 3. In the duckweed vaccine + vaccine adjuvant group (IBVag-IL17B), the vaccine used was the edible duckweed-based vaccine prepared in Example 3, and the vaccine adjuvant used was the IL-17B transgenic duckweed prepared by the duckweed expression system (for the preparation method of the vaccine adjuvant and the adjuvant activity, see the document Xiao Tan. et al. Biomolecules 2022, 12, 1881)

[0072] The positive reference H120 group (H120) was orally vaccinated with IBVH120 vaccine at the manufacturer's recommended dose at 7 and 21 days of age. The duckweed vaccine group (IBVag) was orally fed with duckweed-based edible vaccine at 7, 14, 21 and 28 days of age, with each oral dose of 0.3 g / chicken. The duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) was orally fed with duckweed-based edible vaccine and vaccine adjuvant at 7, 14, 21 and 28 days of age, with the dose of duckweed oral vaccine and vaccine adjuvant being 0.3 g / chicken. The PBS control group (PBS) was orally fed with PBS buffer at 7, 14, 21 and 28 days of age.

[0073] The first vaccination day at 7 days old was marked as 0dpv (day post vacation, dpv), and the marking method for the date after the first vaccination was similar. At 28dpv, the chickens were challenged with IBV SCMY-19 strain by nasal drops and oral administration, with a challenge dose of 200 μL per bird (containing 105.8EID50 IBV).

[0074] (2) Vaccine-induced IBV-specific antibodies in serum

[0075] Blood was collected from chickens under the wings at 0dpv, 7dpv, 14dpv, 21dpv and 28dpv (before infection), and the collected blood was placed at 37℃ for 1h and then at 4℃ overnight. The serum on the blood was aspirated and stored at -80℃ for later use. The IBV antibody ELISA test kit (IDEXX) was used to determine the IBV-specific IgG antibodies in the serum. The specific operation steps were carried out according to the instructions of the kit. The wells without samples were set as negative wells, and the wells containing the positive controls specified in the kit were set as positive wells. The OD value at a wavelength of 650nm was measured using an enzyme reader. The S / P value was calculated based on the OD value. The titer of the antibody was calculated using the S / P value, and the specific formula is as follows: S / P = (OD value of the sample well - OD value of the negative well) / (OD value of the positive well - OD value of the negative well). An S / P value greater than 0.2 is positive, and a value less than 0.2 is negative. The results are as follows Figure 4 shown.

[0076] Depend on Figure 4 It can be seen that the antibody levels of the PBS control group were negative at all time points. At 21dpv and 28dpv after the first vaccination, the IBV-specific IgG antibody levels of the positive reference H120 group (H120), duckweed vaccine group (IBVag), and duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) were all positive. At 21dpv and 28dpv, the IBV-specific IgG antibody levels of the duckweed vaccine group (IBVag) and the duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) were significantly higher than those of the positive reference H120 group (H120) (p<0.001); the IBV-specific IgG antibody level of the duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) was the highest among the three groups, significantly higher than that of the duckweed vaccine group (IBVag) (p<0.05).

[0077] (3) Vaccine-induced anti-IBV mucosal antibody sIgA

[0078] At 28 dpv (before infection), 3 chickens in each group were killed by blood sampling from the heart, and 5 cm of the trachea and intestine (including PP node) were taken respectively, and repeatedly rinsed with 2 mL PBS buffer, centrifuged at 12000 rpm for 10 min at 4 ° C, and the supernatant was collected and stored at -80 ° C for later use. The tracheal or intestinal lavage fluid was added to the 96-well ELISA plate (IDEXX) coated with IBV antigen protein for incubation, and detected with HRP-labeled goat anti-chicken IgA antibody (Abcam). The OD value at a wavelength of 620 nm was measured using an ELISA instrument. The results are shown in Figure 5 shown.

[0079] Depend on Figure 5It can be seen that in tracheal tissue, the mucosal antibody sIgA level detected in the duckweed vaccine group (IBVag) was comparable to that in the positive reference H120 group (H120); the mucosal antibody sIgA level detected in the duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) was the highest among the three groups, significantly higher than that in the positive reference H120 group (H120) (p<0.05) and the duckweed vaccine group (IBVag) (p<0.05); in intestinal tissue, the mucosal antibody sIgA level was IL17B)>positive reference H120 group (H120)>duckweed vaccine group (IBVag). The intestinal mucosal antibody sIgA level detected in the duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) was the highest among the three groups, significantly higher than the positive reference H120 group (H120) (p<0.05) and the duckweed vaccine group (IBVag) (p<0.01). The intestinal mucosal antibody sIgA level in the positive reference H120 group (H120) was significantly higher than that in the duckweed vaccine group (IBVag) (p<0.05).

[0080] (4) Protective effect of vaccine after challenge

[0081] After infection, the symptoms of the chickens were observed for 10 consecutive days, including feeding, ruffled feathers, mental state, drinking water and rales, and the survival rate of chickens in each group was recorded every day. The specific calculation formula is as follows: survival rate = number of survivors in each group on the nth day / total number × 100%.

[0082] Two days after the infection, typical clinical symptoms of IBV began to appear in the chickens in the PBS control group, including loose feathers, decreased food intake, lowered head, open mouth breathing, huddling, runny nose, etc. The symptoms gradually worsened over time, and chickens with obvious symptoms began to die one after another. As of 4 days after the infection, the survival rate of chickens in the PBS control group was 0%, while the survival rates of the duckweed vaccine group (IBVag), duckweed vaccine + vaccine adjuvant group (IBVag-IL17B), and positive reference H120 group (H120) were all 100%.

[0083] (5) Vaccines reduce viral load in tissues after challenge

[0084] All chickens were killed 10 days after the challenge, and the trachea, kidney, and lung tissues of the chickens that died during the course of the challenge and those that were finally killed were dissected and collected. The tissue total RNA was extracted and reverse transcribed into cDNA, and then the RT-PCR absolute quantitative method was used to determine the viral load in the tissue after the challenge, so as to evaluate the immune effect of the vaccine. The details are as follows:

[0085] Construct the plasmid pEASY-Blunt-N containing the N gene, measure the concentration and perform 10-fold gradient dilution, and repeat each gradient three times. Perform RT-PCR detection using the diluted plasmid as a template. The PCR primer sequences are as follows:

[0086] Forward primer (5'CGCTCAAGTTCAAGACCTGCTA3'), reverse primer (5'CATCATCCTGCTTCTTGGCTT3').

[0087] A standard curve was established with concentration as the horizontal axis and CQ value as the vertical axis. The equation of the standard curve was Y = -3.1773X + 38.931, where R 2 =0.9967, indicating that the equation can be used to calculate the viral load. The calculation results of the viral load are as follows: Figure 6 shown.

[0088] Depend on Figure 6 It can be seen that after IBV virus infects chickens, the highest load is in the chicken's trachea, followed by the lungs and kidneys. The duckweed vaccine group (IBVag), duckweed vaccine + vaccine adjuvant group (IBVag-IL17B), and positive reference H120 group (H120) can significantly reduce the colonization of the virus in the trachea, lungs, and kidneys, with the significance levels being p<0.001 for trachea, p<0.01 for lungs, and p<0.01 for kidneys. In tracheal tissue, the viral loads of the duckweed vaccine group (IBVag) and duckweed vaccine + vaccine adjuvant group (IBVag-IL17B) were comparable, significantly lower than the positive reference H120 group (H120) (p<0.05). In the lungs and kidneys, the viral load levels of the three groups were comparable, with no significant differences.

Claims

1. A nucleic acid molecule encoding an antigen protein, characterized in that: The nucleotide sequence of the nucleic acid molecule is selected from: (a) a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.4; or (b) A nucleotide sequence encoding the same antigenic protein as the nucleotide sequence defined in (a).

2. A recombinant expression vector comprising the nucleic acid molecule encoding the antigen protein according to claim 1.

3. Use of the nucleic acid molecule encoding the antigen protein according to claim 1 or the recombinant expression vector according to claim 2 in the preparation of a vaccine, a medicine or a feed additive for preventing or treating IBV infection.

4. Use of transgenic duckweed containing the nucleic acid molecule encoding the antigen protein according to claim 1 in the preparation of vaccines, medicines or feed additives for preventing or treating IBV infection.

5. The use according to claim 3 or 4, characterized in that: The vaccines for preventing or treating IBV infection include edible vaccines.

6. An edible vaccine based on duckweed, characterized in that The edible vaccine comprises transgenic duckweed containing the nucleic acid molecule encoding the antigen protein according to claim 1.

7. The edible vaccine based on duckweed according to claim 6, characterized in that: The edible vaccine also contains a vaccine adjuvant, which is a transgenic plant expressing the cytokine IL-17B.

8. The edible vaccine based on duckweed according to claim 7, characterized in that: The transgenic plant expressing cytokine IL-17B is a transgenic duckweed expressing cytokine IL-17B.

Images