Fusion gene for improving stress resistance of plants, and construction method and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a fusion gene capable of improving plant stress resistance and a construction method and application thereof, the fusion gene is named AR1, and the nucleotide sequence of the fusion gene is shown as SEQ NO.1. The fusion gene capable of improving plant stress resistance can remarkably promote plant growth and improve plant stress resistance at the same time. The resistance of plants to high temperature and saline-alkali stress is greatly improved, and the method can be widely applied to the fields of cultivation of new varieties of crops with multiple stress resistance and the like, and has an important application value; according to the construction method of the fusion gene provided by the invention, the fusion gene for improving the plant stress resistance can be successfully constructed, the construction method is simple and convenient to operate, conditions are easy to control, and wide popularization and application are facilitated.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a fusion gene for improving plant stress resistance, and a construction method and application thereof. Background Art

[0002] Plant stress resistance is the ability of plants to resist adverse external factors, such as drought resistance, salinity resistance, waterlogging resistance, wind resistance, frost resistance, disease and pest resistance, etc.

[0003] Under natural conditions, due to different geographical locations and climatic conditions as well as human activities and other reasons, various adverse environments are created that exceed the range that plants can tolerate for normal growth and development, causing damage to plants or even death. These environments that harm plants are called adversity or stress, and the adaptability and resistance of plants to adverse environments are called stress resistance or adversity resistance.

[0004] With global climate change and environmental deterioration, plants are facing threats of high temperature, salinity and other adversities during their growth. These adversities seriously affect the yield and quality of plants, bringing huge challenges to agricultural production. Therefore, improving the resistance of plants to multiple adversities through molecular breeding is of great significance for ensuring food security, optimizing the agricultural industrial structure, and promoting the development of agriculture in a green, efficient and sustainable direction. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the related art. To this end, the first object of the present invention is to provide a fusion gene for improving plant stress resistance; the second object of the present invention is to provide a method for constructing a fusion gene; the third object of the present invention is to provide an application of a fusion gene.

[0006] In order to achieve the first purpose, the technical solution adopted by the present invention is: A fusion gene that improves plant stress resistance ， The nucleotide sequence of the fusion gene is shown in SEQ NO.1, and the nucleotide sequence of the fusion gene from the 5' end to the 3' end is as follows: Furthermore, the stress resistance includes saline-alkali resistance and high temperature resistance.

[0007] In order to achieve the second purpose, the technical solution adopted by the present invention is: A method for constructing a fusion gene, wherein the fusion gene is the above-mentioned fusion gene for improving plant stress resistance, and the fusion gene is named AR1, include AR1-1 and snippets AR1-2 The cloning and fusion construction includes the following steps: S100, His-R10 As template, amplify the fragment AR1-1-1 , the amplified product was connected to pMD18-T The carrier obtains TA-AR1-1-1-HA; S200, from TA-AR1-1-1-HA Plasmid AR1-1-F2 and AR1-1-R2 Primer amplification fragment AR1-1 , using the Arabidopsis genome as a template, AR1-2-F and AR1-2-R As primers, the upstream and downstream Bm I and Pst I restriction site, clone the fragment by PCR amplification AR1-2 ; S300, use Bm I and EcoO65 I ( BnE II) Enzyme Digestion pCAMBIA3301 vector, the fragment amplified by PCR AR1-1 , Fragment AR1-2 and after enzyme digestion pCAMBIA3301 Vector seamless cloning technology homologous recombination to obtain fusion gene AR1, The fusion gene AR1 Connect at pCAMBIA3301 The carrier skeleton AR1-p3301 .

[0008] Furthermore, the primers used for amplification in step S100 are AR1-1-F and AR1-1-R , AR1-1-F The nucleotide sequence from 5' to 3' is shown in SEQ NO.2. AR1-1-R The nucleotide sequence from 5' to 3' end is shown in SEQ NO.3; SEQ NO.2 is as follows: CTGCAGATGGGTCTTCCTCTAATGATGGAGA; SEQ NO.3 is as follows: GGTCACCTCAAGCGTAATCTGGAACATCGTATGGGTAAAACCTCCTTC.

[0009] In order to achieve the third purpose, the technical solution adopted by the present invention is: An application of a fusion gene, wherein the fusion gene is the above-mentioned fusion gene for improving plant stress resistance, and the application includes using the above-mentioned fusion gene construction method to carry out plant transformation or breeding for improving plant stress resistance.

[0010] Furthermore, the conversion comprises the following steps: S400, use AR1-p3301 Transform GV1301 Agrobacterium to obtain the fusion gene AR1 Transformation of Agrobacterium tumefaciens; Wherein, the breeding is carried out using the transformed Agrobacterium, comprising the following steps: S500, obtaining transgenic plants carrying the fusion gene by infecting the explants or inflorescences of recipient plants with Agrobacterium transformation, AR1 T0 generation seeds.

[0011] Further, in step S400, the transformed Agrobacterium is cultured using a screening medium containing antibiotics to screen out the successfully introduced fusion gene. AR1 Transformation of Agrobacterium tumefaciens; The culture medium is not particularly limited, for example, the culture medium can be an LB plate culture medium containing kanamycin, gentamicin and rifampicin.

[0012] Furthermore, the method further comprises the following steps: S600, use antibiotics or herbicides to screen the resistance of T0 generation seeds, and obtain the successful transfer of fusion genes AR1 T1 generation seeds; The resistance screening is not particularly limited, and for example, Basta resistance screening can be performed.

[0013] Furthermore, the breeding includes breeding of agricultural crops and horticultural crops.

[0014] Furthermore, the agricultural crops include but are not limited to at least one of rice, wheat, corn, cotton, soybean, rapeseed, potato, fruits and vegetables, and the horticultural crops include but are not limited to at least one of trees and flowers.

[0015] The above one or more technical solutions in the embodiments of the present invention have at least one of the following technical effects: Fusion gene for improving plant stress resistance provided by the present invention AR1,It can significantly promote plant growth and greatly improve the plant's resistance to high temperature and salinity, and can be widely used in the fields of breeding new crop varieties with multiple stress resistance, and has important application value. The present invention also provides a method for constructing a fusion gene, according to which the fusion gene for improving plant stress resistance can be successfully constructed. AR1, The method is easy to operate and the conditions are easy to control, which is conducive to wide promotion and use.

[0016] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is the fusion gene provided in Example 1 of the present invention AR1 Results of AR1 protein level detection in transgenic lines.

[0018] Figure 2 These are images of the growth conditions of rosette leaves of different plants provided in Experimental Example 1 of the present invention.

[0019] Figure 3 These are images of the height growth conditions of different plants provided in Experimental Example 1 of the present invention.

[0020] Figure 4 The WT and AR1-4 Images of plant growth after high temperature treatment.

[0021] Figure 5 These are images of the growth conditions of different plants under saline-alkali conditions provided by Experimental Example 3 of the present invention.

[0022] Figure 6 This is an image of the root growth status of different plants at 18 days old under saline-alkali conditions provided in Experimental Example 3 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0024] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0025] Example 1 Fusion gene AR1 's construction.

[0026] (I) Fusion gene AR1 (as shown in SEQ NO.1), the nucleotide sequence of SEQ NO.1 from 5' to 3' is as follows:

[0027] (II) Fusion gene AR1 amplification.

[0028] By carrier His-R10 As a template, amplify the fragment involved in the inventor's existing patent (CN114032229A) AR1-1-1 , upstream and downstream are introduced Pst I and EcoO65 I ( BnE II) restriction site, the primers used are AR1-1-F (as shown in SEQNO.2) and AR1-1-R (as shown in SEQ NO.3), the amplified product was connected to pMD18-T Vector obtained TA-AR1-1-1- HA .from TA-AR1-1-1-HA Plasmid AR1-1-F2 (as shown in SEQ NO.4) and AR1-1-R2 (as shown in SEQ NO.5) is the primer amplification fragment AR1-1 ; Using the Arabidopsis genome as a template, AR1-2-F (as shown in SEQ NO.6) and AR1-2-R (as shown in SEQ NO.7) is the primer cloned fragment AR1-2 , and introduce them into the upstream and downstream Bm I and Pst I restriction site. Bm I and EcoO65 I ( BnE II) Enzyme Digestion pCAMBIA3301 vector, the fragment amplified by PCR AR1-1 , Fragment AR1-2 and after enzyme digestion pCAMBIA3301 Vector seamless cloning technology homologous recombination to obtain fusion gene AR1 Connect at pCAMBIA3301 On the carrier skeleton ( AR1-p3301 ), Kan for bacterial resistance and Basta for plant resistance. AR1-F (as shown in SEQ NO.8) and AR1-R (As shown in SEQ NO.9) primers are used to amplify the target gene.

[0029] The nucleotide sequence of SEQ NO.2 from 5' to 3' is as follows: CTGCAGATGGGTCTTCCTCTAATGATGGAGA; The nucleotide sequence of SEQ NO.3 from 5' to 3' is as follows: GGTCACCTCAAGCGTAATCTGGAACATCGTATGGGTAAAACCTCCTTC; The nucleotide sequence of SEQ NO.4 from 5' to 3' is as follows: AGCTCTAAGAAAAAAACTGCAGATGGGTCTTCCTCTA; The nucleotide sequence of SEQ NO.5 from 5' to 3' is as follows: GGGGAAATTCGAGCTGGTCACCTCAAGCGTAATCTGG; The nucleotide sequence of SEQ NO.6 from 5' to 3' is as follows: CGGGGATCCTCTAGAGGATCCAGTGTAAATGGATAGC; The nucleotide sequence of SEQ NO.7 from 5' to 3' is as follows: TAGAGGAAGACCCATCTGCAGTTTTTTCTTAGAGCTT; The nucleotide sequence of SEQ NO.8 from 5' to 3' is as follows: CGGGGATCCTCTAGAGGATCCAGTGTAAATGGATAGC; The nucleotide sequence of SEQ NO.9 from 5' to 3' is as follows: GGTCACCTCAAGCGTAATCTGGAACATCGTATGGGTAAAACCTCCTTC; (III) Screening and identification of transgenic Arabidopsis thaliana.

[0030] Will AR1-p3301 The vector was transformed into GV3101 Agrobacterium. The specific process was as follows: 1 μg DNA was added to 200 μL Agrobacterium competent cells, placed on ice for 30 min, then frozen with liquid nitrogen for 1 min, and then warmed at 37 °C until thawed. 1 mL YEP liquid medium was added to the tube and cultured at 28 °C for 4 h. The cells were collected by centrifugation and spread on LB plates containing 50 μg / mL kanamycin, 25 μg / mL gentamicin, and 25 μg / mL rifampicin, and placed in an inverted culture in a 28 °C incubator. Single colonies were picked and the primers were used to generate the primers. AR1-F2 (as shown in SEQ NO.10) and AR1-R2 (as shown in SEQ NO.11) was identified by PCR; the positive clones identified by PCR were shaken to OD 600 When the concentration is greater than 1.0, it is used for infection of Arabidopsis inflorescence.

[0031] The nucleotide sequence of SEQ NO.10 from 5' to 3' is as follows: AGCTCTAAGAAAAAAACTGCAGATGGGTCTTCCTCTA; The nucleotide sequence of SEQ NO.11 from 5' to 3' is as follows: GGGGAAATTCGAGCTGGTCACCTCAAGCGTAATCTGG.

[0032] The wild-type Col was transformed by Agrobacterium-mediated infection of Arabidopsis inflorescence. The specific process of inflorescence infection is as follows: centrifuge the bacterial solution, collect the precipitate, and resuspend the bacteria in the prepared transformation solution (10 mM 1 / 2MS, 2.5 mM MES, 5% sucrose, 1 mg / mL 6-BA). Before infecting Arabidopsis, add SilwetL-77 (50 mL / L) to fully contact the inflorescence of Arabidopsis with the bacterial solution. After infection, culture in the dark for 24 hours, and then culture under normal conditions until the end of the growth cycle. After harvesting the seeds, Basta resistance screening medium was used to screen the T1 generation seeds combined with genomic PCR identification. The positive plants obtained by soil culture screening were collected. After maturity, T2 generation seeds were collected for Basta resistance screening. Single copy strains were identified according to the segregation ratio of Mendel's law of inheritance until T3 generation single copy homozygous strains were obtained.

[0033] The specific method of genomic PCR is: sampling, extracting genomic DNA, 1301-1-F and Nos-1-R Primers for PCR amplification.

[0034] The PCR amplification system is shown in Table 1.

[0035] Table 1 PCR amplification system Components Addition volume (μL) 2×Taq PCR Mix (GenStar) 10 <![CDATA[ddH2O]]> 8 (As shown in SEQ NO.12) (10 μmol / L) 0.5 (As shown in SEQ NO.13) (10 μmol / L) 0.5 Template DNA 1

[0036] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min30 s, 31 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0037] The nucleotide sequence of SEQ NO.12 from 5' to 3' is as follows: TTCCGGCTCGTATGTTGTGTG; The nucleotide sequence of SEQ NO.13 from 5' to 3' is as follows: ATAATCATCGCAAGACCGGCAACAG.

[0038] The protein level detection method of the T3 generation single copy homozygous strains is as follows: the total plant protein of different single copy homozygous strains was extracted with protein extraction buffer, and the fusion gene was detected by SDS-PAGE electrophoresis combined with Western blot immunoblotting, and HA antibody (Abcam ab9110) was used to detect AR1 level, Actin antibody (Abmart: M20009L) was used as the loading control, and the AR1 protein accumulation level of each single copy homozygous strain in the T3 generation was as follows: Figure 1 As shown, actin protein was used as a loading control, the wild type (WT) was used as a negative control without genetic modification, the exposure time of α-HA was 5 s, and the exposure time of α-actin was 5 s.

[0039] The composition of protein extraction buffer is as follows: 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.5 M EDTA (pH 8.0), 1% TritonX-100, EDTA-free protease inhibitors.

[0040] Experimental Example 1 Growth and development phenotype observation experiment.

[0041] The three fusion genes AR1 The transgenic Arabidopsis thaliana (lines 4, 6, and 25) and wild-type Col seeds were soaked in 1% (v / v) NaClO for 2-3 min, washed 6-8 times with sterile distilled water, and planted on normal 1 / 2 MS medium. After two days of dark treatment, they were placed in an Arabidopsis incubator under the conditions of 20-22°C, long daylight (16 h light, 8 h dark), relative humidity of 60%-70%, and light intensity of 90-110 μmol m -2 s -1 After 12 days of growth, the cells were transplanted into soil for further cultivation at 20-22°C with long daylight (16 h light, 8 h dark). AR1 The rosette leaves and plant height of transgenic plants were significantly higher than those of WT plants. Figures 2 to 3 As shown, L4 is the 4th plant line, L6 is the 6th plant line, and L25 is the 25th plant line. The results show that the fusion gene AR1 It can significantly promote plant growth.

[0042] Experimental Example 2 High temperature stress phenotype observation experiment.

[0043] The fusion gene AR1 One of the independent transgenic lines ( AR1-4) Arabidopsis thaliana and wild-type Col seeds were soaked in 1% (v / v) NaClO for 2-3 min, washed 6-8 times with sterile distilled water, placed in a 4°C refrigerator, and dark-treated for two days before being spread on normal 1 / 2 MS medium and placed in an Arabidopsis incubator. The culture conditions were 20-22°C, long day (16 h light, 8 h dark), relative humidity of 60%-70%, and light intensity of 90-110 μmol m -2 s -1 After 11 days of growth, the treated groups were placed in a 44°C water bath for 18 min and then placed in an Arabidopsis incubator under the conditions of 20–22°C, long daylight (16 h light, 8 h dark), 60%–70% relative humidity, and 90–110 μmol m -2 s -1 The results showed that under normal culture conditions, WT and AR1-4 There was no significant difference in the growth of WT, but after high temperature treatment, the survival rate of WT was significantly reduced, and the fusion gene AR1 The survival rate of overexpressing Arabidopsis was almost not inhibited and was significantly higher than that of WT, showing obvious high temperature tolerance, such as Figure 4 shown.

[0044] Experimental Example 3 Observation of salt-alkali stress phenotype.

[0045] (A) Salt-alkali stress survival rate experiment.

[0046] The three fusion genes AR1 Seeds of independent transgenic lines (lines 4, 6, and 25) and wild-type Col were soaked in 1% (v / v) NaClO for 2–3 min, washed 6–8 times with sterile distilled water, and planted in normal 1 / 2 MS medium and 1 / 2 MS medium containing 10 mM NaHCO3. After two days of dark treatment, they were placed in an Arabidopsis incubator under the conditions of 20–22°C, long daylight (16 h light, 8 h dark), relative humidity of 60%–70%, and light intensity of 90–110 μmol m -2 s -1 After 14 days of growth, the WT and AR1 Survival rate of Arabidopsis thaliana overexpressing fusion genes 。 The results showed that under normal culture conditions, WT and AR1 The survival rate of Arabidopsis thaliana with overexpression of fusion gene was 100%, while the survival rate of WT was 21% under saline-alkali stress. AR1 The survival rate of Arabidopsis thaliana overexpressing the fusion gene exceeded 80%, significantly higher than that of WT, showing obvious salt-alkali resistance. Figure 5 shown.

[0047] (B) Root growth experiment under salt-alkali stress.

[0048] The three fusion genes AR1 The seeds of Arabidopsis thaliana and wild-type Col of independent transgenic lines (lines 4, 6, and 25) were soaked in 1% (v / v) NaClO for 2-3 min, washed 6-8 times with sterile distilled water, and spread on normal 1 / 2 MS medium and 1 / 2 MS medium containing 5 mM NaHCO3. After two days of dark treatment, the seeds were placed in an Arabidopsis incubator under the conditions of 20-22°C, long daylight (16 h light, 8 h dark), relative humidity of 60%-70%, and light intensity of 90-110 μmol m -2 s -1 , the results are as follows Figure 6 As shown, under normal culture conditions, WT and AR1 There was no significant difference in root length of Arabidopsis thaliana overexpressing the fusion gene, but under saline-alkali stress, the root length growth of WT was inhibited. AR1 The root growth of Arabidopsis thaliana overexpressing the fusion gene was almost not inhibited and was significantly higher than that of WT, showing obvious salt-alkali resistance.

[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fusion gene for improving plant stress resistance, characterized in that: The nucleotide sequence of the fusion gene is shown in SEQ NO.

1.

2. The fusion gene for improving plant stress resistance according to claim 1, characterized in that: The stress resistance includes saline-alkali resistance and high temperature resistance.

3. A method for constructing a fusion gene, characterized in that: The fusion gene is a fusion gene for improving plant stress resistance as claimed in claim 1 or 2, and the fusion gene is named AR1, Include snippet AR1-1 and snippets AR1-2 The cloning and fusion construction includes the following steps: S100, His-R10 As template, amplify the fragment AR1-1-1 , the amplified product was connected to pMD18-T The carrier obtains TA- AR1-1-1-HA; S200, from TA-AR1-1-1-HA Plasmid AR1-1-F2 and AR1-1-R2 Primer amplification fragment AR1-1 , using the Arabidopsis genome as a template, AR1-2-F and AR1-2-R As primers, the upstream and downstream Bm I and Pst I restriction site, clone the fragment by PCR amplification AR1-2 ; S300, use Bm I and EcoO65 I digestion pCAMBIA3301 vector, the fragment amplified by PCR AR1-1 , Fragment AR1-2 and after enzyme digestion pCAMBIA3301 Vector seamless cloning technology homologous recombination to obtain fusion gene AR1 , fusion gene AR1 Connect at pCAMBIA3301 The carrier skeleton AR1-p3301 .

4. The method for constructing the fusion gene according to claim 3, characterized in that: The primers used for amplification in step S100 are AR1-1-F and AR1-1-R , AR1-1-F The nucleotide sequence from 5' to 3' is shown in SEQ NO.

2. AR1-1- R The nucleotide sequence from 5' to 3' end is shown in SEQ NO.

3.

5. An application of a fusion gene, characterized in that: The fusion gene is the fusion gene for improving plant stress resistance as claimed in claim 1 or 2, and the application includes using the construction method of the fusion gene as claimed in claim 3 or 4 to carry out plant transformation or breeding for improving plant stress resistance.

6. The use of the fusion gene according to claim 5, characterized in that: The transformation comprises the following steps: S400, use AR1-p3301 Transform GV1301 Agrobacterium to obtain the fusion gene AR1 Transformation of Agrobacterium tumefaciens; Wherein, the breeding is carried out using the transformed Agrobacterium, comprising the following steps: S500, obtaining transgenic plants carrying the fusion gene by infecting the explants or inflorescences of recipient plants with Agrobacterium transformation, AR1 T0 generation seeds.

7. The use of the fusion gene according to claim 6, characterized in that: Step S400 includes culturing the transformed Agrobacterium using a screening medium containing antibiotics to screen out the successfully introduced fusion gene. AR1 Transformation of Agrobacterium tumefaciens; Wherein, the culture medium includes LB plate culture medium containing kanamycin, gentamicin and rifampicin.

8. The use of the fusion gene according to claim 6, characterized in that: The following steps are also included: S600, use antibiotics or herbicides to screen the resistance of T0 generation seeds, and obtain the successful transfer of fusion genes AR1 T1 generation seeds.

9. The use of the fusion gene according to claim 5, characterized in that: The breeding includes breeding of agricultural crops and horticultural crops.

10. The use of the fusion gene according to claim 9, characterized in that: The agricultural crops include at least one of rice, wheat, corn, cotton, soybean, rapeseed, potato, fruit and vegetables, and the horticultural crops include at least one of trees and flowers.

Images