Application of non-therapeutic-purpose GLYR1 protein in regulating and controlling proliferation and / or migration of renal clear cell carcinoma cells

Abstract

The invention discloses an application of non-therapeutic GLYR1 protein in regulating and controlling proliferation and / or migration of renal clear cell carcinoma cells, which is characterized in that the expression of GLYR1 is knocked down so as to promote the proliferation and / or migration of the renal clear cell carcinoma cells, a reagent adopted for knocking down the expression of the GLYR1 is si-GLYR1 # 1, a positive-sense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGUCGAAGA, an antisense strand of the si-GLYR1 # 1 is UCUUCGACAGCAUCUACCG, the antisense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGCAUCUACCG is The kit has the characteristics of high sensitivity, strong specificity, short period and the like, is beneficial to early diagnosis and treatment of the clear cell renal carcinoma, and has the potential of becoming a novel biomarker and an effective treatment target in the clear cell renal carcinoma.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and specifically relates to the application of a non-therapeutic GLYR1 protein in regulating the proliferation and / or migration of renal clear cell carcinoma cells. Background Art

[0002] Renal cell carcinoma is a malignant tumor originating from renal tubular epithelial cells. According to histological classification, about 85% of renal cell carcinomas are clear cell renal cell carcinomas (ccRCC). ccRCC mainly originates from the renal tubular epithelium and occurs in the renal parenchyma. Its incidence rate is increasing year by year and is the main cause of renal cancer-related deaths. The 5-year survival rate of patients with early ccRCC after surgery is more than 90%, and the 5-year survival rate of patients with mid-stage is about 80%, but for patients with advanced stage, the survival rate is only about 20%; secondly, ccRCC is not sensitive to chemotherapy. Currently, surgical resection is mostly performed in clinical practice, but up to 1 / 3 of patients will metastasize after surgery; in addition, surgery with or without postoperative adjuvant therapy, chemotherapy, immunotherapy, targeted therapy, etc., the overall prognosis of ccRCC patients is still poor, especially for patients with advanced ccRCC. Therefore, it is urgent to deeply explore the occurrence and development mechanism of ccRCC, and it is very important to find accurate and effective diagnostic markers to improve its treatment effect.

[0003] ccRCC is a highly vascularized tumor, one of the characteristics of which is the Von Hippel-Lindau (abbreviated as VHL ) The incidence of gene inactivation is as high as 50-75%. VHL The gene product, pVHL, plays an important role in downregulating the expression of the hypoxia-inducible factor 1 (HIF1) transcription factor, leading to reduced angiogenesis. VHL Gene inactivation provides a theoretical basis for the development of antiangiogenic drugs (such as sunitinib, pasopanib, sorafenib, and axitinib) for the treatment of ccRCC. Currently, localized ccRCC can be treated with partial nephrectomy or radical nephrectomy. However, about 30% of ccRCC patients cannot receive surgical treatment due to tumor metastasis, and chemotherapy has a poor therapeutic effect on metastatic ccRCC. Therefore, the use of systemic treatments such as targeted therapy and immunotherapy is very important. Targeted therapy drugs include tyrosine kinase inhibitors, which can inhibit the kinase activity of the vascular endothelial growth factor receptor family (such as VEGFR-1 and VEGFR-2) and platelet-derived growth factor receptors (such as PDGFRα and PDGFRβ) and c-Kit. At present, sunitinib is still the first-line treatment for RCC, and sunitinib has also been used as a comparator in phase III clinical trials of RCC. However, sunitinib resistance has become a clinical challenge, and there is an urgent need to find new treatment strategies.

[0004] Glyoxylate reductase 1 homolog (GLYR1) protein is an epigenetic reader involved in chromatin modification and gene expression regulation. It regulates gene expression by demethylating nucleosomes. The role of GLYR1 in cells includes promoting transcription of RNA polymerase II (Pol II) in chromatin. It depolymerizes nucleosomes in an ATP-independent manner by interacting with the proximal centriole of nucleosomes, thereby reducing nucleosome stability and promoting transcription. GLYR1 is highly expressed in almost all tissues and is essential in stem cells. The expression of GLYR1 is different in different diseases: it is highly expressed in breast cancer, and this high expression is associated with poor prognosis; it is downregulated in colorectal cancer, and this downregulation reduces the sensitivity of colorectal cancer cells to 5-fluorouracil; other studies have shown that GLYR1 deficiency can weaken spermatogenesis in mice. There are no published reports on the use of GLYR1 protein as a diagnostic and therapeutic marker in renal clear cell carcinoma. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a non-therapeutic GLYR1 protein with high sensitivity and specificity and negative correlation with the morbidity of renal clear cell carcinoma for use in regulating the proliferation and / or migration of renal clear cell carcinoma cells.

[0006] The technical solution adopted by the present invention to solve the above technical problem is: application of a non-therapeutic GLYR1 protein in regulating the proliferation and / or migration of renal clear cell carcinoma cells.

[0007] Furthermore, the expression of GLYR1 is knocked down to promote the proliferation and / or migration of renal clear cell carcinoma cells. The reagent used to knock down the expression of GLYR1 is si-GLYR1#1. The nucleotide sequence of the positive chain of the si-GLYR1#1 is as shown in SQINO: 1: CGGUAGAUGCUGUCGAAGA, and the nucleotide sequence of the antisense chain of the si-GLYR1#1 is as shown in SQI NO: 2: UCUUCGACAGCAUCUACCG.

[0008] The protein GLYR1 consists of 553 amino acids and has a protein size of about 60 kDa.

[0009] Compared with the prior art, the advantages of the present invention are: the present invention discloses for the first time a protein GLYR1 that can be used to detect renal clear cell carcinoma and its application in the preparation of a reagent for detecting renal clear cell carcinoma or a reagent for assisting in the diagnosis of renal clear cell carcinoma, wherein the detection is mainly completed by immunohistochemistry, and the immunohistochemistry staining images are analyzed, and the expression of GLYR1 protein in renal clear cell carcinoma patient samples and normal samples is calculated and compared by Image J software for assisting in the diagnosis of renal clear cell carcinoma. Compared with the traditional renal clear cell carcinoma detection technology, the present invention has the characteristics of high sensitivity, strong specificity, short cycle, etc., which is conducive to the early diagnosis and treatment of renal clear cell carcinoma, and GLYR1 has the potential to become a new biomarker and an effective therapeutic target in renal clear cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 To verify the expression of GLYR1 in human clear cell renal cell carcinoma tissues and paired adjacent tissues by immunohistochemistry, A is two representative images of GLYR1 immunohistochemical staining in 60 pairs of clear cell renal cell carcinoma tissues and paired adjacent tissues (n=60); B is a stacked bar graph of the immunohistochemical staining results of 60 pairs of human clear cell renal cell carcinoma tissues and paired adjacent tissues (n=60, ****: p <0.0001), negative in the figure indicates that GLYR1 is not expressed or is lowly expressed, and positive indicates that GLYR1 is highly expressed; Figure 2 Screening of siRNA for GLYR1 knockout by protein immunoblotting, where A is ACHN cells for GLYR1 knockout by protein immunoblotting, and B is 786O cells for GLYR1 knockout by protein immunoblotting; si-NC in the figure is si-Negative Control, which is the negative control of si; GAPDH is glyceraldehyde-3-phosphate dehydrogenase, which is an internal reference gene; si-GLYR1#1-4 is no expression or low expression, α-GLYR1 is GLYR1 antibody, and α-GAPDH is GAPDH antibody; Figure 3 The CCK8 experiment verifies the effect of GLYR1 expression level on the growth of renal clear cell carcinoma cells, where A is the CCK8 experiment to detect the effect of GLYR1 expression level on the growth of ACHN cells; B is the CCK8 experiment to detect the effect of GLYR1 expression level on the growth of 786O cells (*: p <0.05,**: p <0.01,***: p <0.001, ****: p<0.0001); in the figure, EV means transfection of empty vector plasmid without target gene, which is used as negative control; oe-GLYR1 means transfection of SFB-GLYR1 plasmid, which is used as overexpression treatment of GLYR1 gene; si-NC means transfection of si-Negative control, which is used as negative control; si-GLYR1 means transfection of si-GLYR1#1, which is used as knockdown treatment of GLYR1 gene; Figure 4 Transwell migration experiment verifies the effect of GLYR1 expression level on the migration of renal clear cell carcinoma cells, where A is the migration experiment of ACHN and 786O cells after overexpression or knockout of GLYR1; B is the quantification of the results of cell migration experiment (*: p <0.05,**: p <0.01,***: p <0.001, ****: p <0.0001); EV, indicates transfection of an empty vector plasmid without the target gene, used as a negative control; oe-GLYR1, indicates transfection of SFB-GLYR1 plasmid, used as an overexpression treatment of the GLYR1 gene; si-NC, indicates transfection of si-Negative control, used as a negative control; si-GLYR1, indicates transfection of si-GLYR1#1, used as a knockdown treatment of the GLYR1 gene; Figure 5 The effect of GLYR1 expression level on the growth of renal clear cell carcinoma cells was verified by cloning assay, where A is the cloning assay to detect the colony formation ability of ACHN and 786O after overexpression or knockout of GLYR1; B is the quantification of the results of the cloning assay (*: p <0.05,**: p <0.01,***: p <0.001, ****: p <0.0001); EV, indicates transfection of an empty vector plasmid without the target gene, used as a negative control; oe-GLYR1, indicates transfection of SFB-GLYR1 plasmid, used as an overexpression treatment of the GLYR1 gene; si-NC, indicates transfection of si-Negative control, used as a negative control; si-GLYR1, indicates transfection of si-GLYR1#1, used as a knockdown treatment of the GLYR1 gene. DETAILED DESCRIPTION

[0011] The present invention is further described in detail below with reference to the accompanying drawings.

[0012] 1. Experimental methods

[0013] 1. Collection of renal clear cell carcinoma tissue specimens: The 60 pairs of renal clear cell carcinoma tissue slides included in the study were from Shanghai Xinchao Biotechnology Co., Ltd. All human tissue specimens involved in this experiment were applied for by the research team and approved by the Human Ethics Committee of Ningbo University School of Medicine, and were limited to laboratory research.

[0014] 2. Immunohistochemical staining of specimens, the steps are as follows: (1) Baking: Place the tissue chip on a preheated 63°C baking machine for 1 hour, or place it in a 37°C oven overnight; (2) Dewaxing and rehydration: Take the tissue chip out of the oven and put it into the fully automatic staining machine for dewaxing. The specific dewaxing process is: soak the tissue chip in xylene for 15 minutes twice; soak it in anhydrous ethanol solution for 7 minutes twice; soak it in 90% ethanol solution for 5 minutes once; soak it in 80% ethanol solution for 5 minutes once; soak it in 70% ethanol solution for 5 minutes once, and finally place the slide rack in deionized water for 5 minutes. (3) Antigen retrieval: Antigen retrieval was performed using the DAKO fully automated immunohistochemistry pretreatment system. (4) Primary antibody incubation: After repair, remove the slide and rinse it with PBST buffer three times, 1 min each time; remove the GLYR1 rabbit primary antibody (brand proteintech, model 14833-1-AP) from the refrigerator and centrifuge it at 7200 rpm for 1 min; remove the GLYR1 rabbit primary antibody and dilute it with antibody diluent at a dilution of 1:500; add the GLYR1 rabbit primary antibody dropwise and store in a refrigerator at 4°C overnight; (5) Secondary antibody incubation: Rewarm the slides at room temperature for more than 30 min, then rinse with PBST buffer three times, 1 min each time; wipe off the liquid around the tissue, add appropriate concentration of HRP-labeled rabbit secondary antibody to the tissue so that the antibody completely covers the tissue, close the wet box lid, and incubate at 37°C for 1 h; (6) DAB color development: Rinse with PBST buffer three times, 1 min each time; add DAB color development solution to the location of the tissue on the slide, place the slide on an inverted microscope to observe the tissue staining, shake off the color development solution when the staining intensity reaches the optimal level, and rinse with deionized water for 5 min; (7) Hematoxylin counterstaining: Add SIGMA to the slide for 1 min, immerse in 0.25% hydrochloric acid alcohol for at least 2 s, and rinse with tap water for more than 2 min. (8) Sealing: Let the slides dry at room temperature and then seal them; (9) Scoring: All samples were reviewed by two independent pathologists experienced in IHC evaluation who were blinded to the clinical outcomes of the patients. We evaluated the percentage of positively stained cells and the staining intensity to semi-quantitatively determine GLYR1 expression. The percentage of positively stained cells was scored as follows: 0, none; 1, <=50%; 2, >=50%. The staining intensity was graded as follows: 0 (none or weak staining = light yellow), 1 (moderate staining = yellow-brown), and 2 (strong staining = brown). The total score for GLYR1 expression was the sum of the percentage of cells scored for positive staining and the staining intensity score, with a total score ranging from 0 to 4. For statistical analysis, the final score was a combination of the independent scores assigned by the two pathologists reported in this study. Any discrepancies in the scores were resolved by discussion between the two pathologists.

[0015] 3. Screening of si-GLYR1 by western blotting, the steps are as follows: (1) si-GLYR1 is a small interfering RNA of GLYR1, which is responsible for silencing the expression of the GLYR1 gene. The small interfering RNA primers were designed as follows: the nucleotide sequence of the sense strand of si-GLYR1#1 is shown in SQI NO: 1: 5'-CGGUAGAUGCUGUCGAAGA-3', and the nucleotide sequence of the antisense strand of si-GLYR1#1 is shown in SQI NO: 2: 5'-UCUUCGACAGCAUCUACCG-3'; The nucleotide sequence of the sense strand of si-GLYR1#2 is shown in SQI NO: 3: 5′-GACCAGUCUGACAACGAUA-3′, and the nucleotide sequence of the antisense strand of si-GLYR1#2 is shown in SQI NO: 4: 5′-UAUCGUUGUCAGACUGGUC-3′; The nucleotide sequence of the sense strand of si-GLYR1#3 is shown in SQI NO: 5: 5′-CGGAGUCUAGUACCGUGAA -3′, and the nucleotide sequence of the antisense strand of si-GLYR1#3 is shown in SQI NO: 6: 5′-UUCACGGUACUAGACUCCG-3′; The nucleotide sequence of the sense strand of si-GLYR1#4 is shown in SQI NO: 7: 5′-GCAAUCACGAAGAAGUUGA -3′, and the nucleotide sequence of the antisense strand of si-GLYR1#4 is shown in SQI NO: 8: 5′-UCAACUUCUUCGUGAUUGC-3′; (2) Take cells from a 12-well plate and transiently transfect Negative Control (control group) and si-GLYR1#1-4. After 48 h, remove the culture medium from the well-growing ACHN and 7860 renal clear cell carcinoma adherent cells and add 100 ul RIPA lysis buffer (weak) to each well. After shaking at 4°C for 20 minutes, transfer to -80°C and freeze overnight. (3) Take the sample out from -80℃, melt it at 4℃, transfer it into a 1.5ml centrifuge tube, centrifuge it at 4℃ and 12000rpm for 20min, take the supernatant, add sodium dodecyl sulfate (SDS), and boil it in a metal bath at 95℃ for 5min; (4) Prepare 10% WB gel in advance, run electrophoresis at a constant voltage of 80V, transfer at a constant current of 220mA for 120min, wash the membrane with TBST for 5min, block with 5% milk powder prepared in TBST for 40min, then wash the membrane, and apply the corresponding antibody overnight; (5) Prepare the developer, water and fixer in the darkroom in advance. After the film is dripped with ECL luminescent liquid, shake it dry and spread it flat on plastic wrap. Then fix it in a dark box and expose it in the darkroom. After the exposure, open the dark box, take out the film, immerse it in the developer, observe it under red light until strips appear, rinse it in water and put it in the fixer. Then turn on the light to observe the exposure results, and finally scan the film to analyze the results.

[0016] 4. CCK8 cell proliferation assay (1) After transient transfection with PCIN4 plasmid, SFB-GLYR1 plasmid, negative control (control group), and si-GLYR1 for 24 hours, well-growing ACHN and 786O renal clear cell carcinoma adherent cells were digested into a uniform cell suspension; (2) Pipette 20 µL of the above uniform cell suspension into a cell counting plate, measure its concentration using a cell counter, dilute the cell suspension according to the corresponding ratio, and pipette it evenly; (3) Take three 96-well cell plates and add 1.5×10 3 cells, 0.1 mL was used for quantification, 6 replicate wells were set for each treatment group, and the wells were shaken using the "8" method and placed in a constant temperature incubator; (4) When the three 96-well cell culture plates were cultured for 0, 1, 2, 3, 4, and 5 days respectively, 10 µL CCK8 reagent was added to each well under light-proof conditions and placed in a constant temperature incubator for 2 h. The plates turned orange-yellow. The wavelength of the microplate reader was set to 450 nm, and the absorbance of each well was measured. The absorbance was repeated 3 times, and the corresponding data were recorded and organized.

[0017] 5. Transwell migration experiment, the steps are as follows: (1) After 24 h of transient transfection with PCIN4 plasmid, SFB-GLYR1 plasmid, negative control (control group), and si-GLYR1, well-growing ACHN and 786O renal clear cell carcinoma adherent cells were digested into a uniform cell suspension; (2) Collect the cell suspension into a 1.5 mL centrifuge tube and centrifuge at 1,000 rpm for 4 min. (3) Discard the supernatant, resuspend the cell pellet with 1 mL of PBS solution, centrifuge again as above, resuspend the cells with 1 mL of DMEM medium, count them on a cell counting plate, and dilute with DMEM as needed; (4) Use sterile forceps to pick up four Transwell chambers and place them into a new 24-well cell plate. Add 200 µL of the above cell suspension to each upper chamber and quantify 2×10 4 cells, add 700 µL of complete culture medium to the lower chamber, let it stand for 30 minutes, and then put the plate into a constant temperature incubator; (5) After 24 h, discard the culture medium inside and outside the chamber and rinse the chamber and the bottom of the well plate twice with PBS buffer; (6) Add 500 µL of pre-cooled ice methanol into the chamber and place on ice for 5 min. (7) Discard the fixative solution, rinse twice with PBS solution, add 500 μL of 0.1% crystal violet dye, and place the plate on a shaker for staining for 30 min; (8) Recover the stain, rinse with PBS solution three times, air dry the chamber, take photos and calculate the statistics.

[0018] 6. Clone formation, the steps are as follows: (1) After 24 h of transient transfection with PCIN4 plasmid, SFB-GLYR1 plasmid, negative control (control group), and si-GLYR1, well-growing ACHN and 786O renal clear cell carcinoma adherent cells were digested into a uniform cell suspension; (2) Pipette 20 µL of the above uniform cell suspension into a cell counting plate, measure its concentration using a cell counter, dilute the cell suspension according to the corresponding ratio, and pipette it evenly; (3) Take several 6-well cell plates and add 1×10 3 10 cells, quantify 2 mL, set up 4 replicate wells for each treatment group, shake well using the "8" method, place in a constant temperature incubator, change the medium every 5 days, and culture for a total of 10-15 days; (4) When cell colonies are visible in the 6-well plate, discard the culture medium in the wells, rinse twice with PBS buffer, add an appropriate amount of ice-cold methanol to each well to fix the cells, and leave for 30 min; (5) Discard the fixative solution, rinse twice with PBS buffer, add 1 ml of 0.1% crystal violet dye to each well, stain on a shaker for 30 min, recover the dye, rinse three times with PBS buffer, place in a 37°C oven overnight, and after the six-well plate is dried, take photos and calculate the statistics.

[0019] 7. The result analysis method is as follows: This experiment ensured that the experimental data and the collected original clinical data were fully checked, proofread, and sorted to ensure that the data were as complete, accurate, and correct as possible. Then, Excel software was used to establish tissue and cell databases, group and summarize the original clinical data involved, and enter them into tables. Finally, SPSS 26.0 statistical software was used to sort and analyze the final experimental data. All data statistical tests were bilaterally tested at the test level of α=0.05. p <0.05, the difference between the two groups was considered statistically significant, otherwise the difference was considered statistically insignificant. The drawing of experimental result graphs such as bar graphs and line graphs was completed using GraphPad Prism 10.0 and SPSS 26.0 software.

[0020] 2. Experimental results.

[0021] To examine the expression of GLYR1 in clear cell renal cell carcinoma tissues, we collected 60 pairs of tissue microarrays of clear cell renal cell carcinoma tissues and adjacent paracancerous tissues and used immunohistochemical staining to detect the expression level of GLYR1 in clinical samples.

[0022] like Figure 1 As shown in Figure A, the immunohistochemical staining results showed that GLYR1 staining was brown-yellow in different shades and was mainly located in the cytoplasm of adjacent tissues and a small amount of renal clear cell carcinoma tissue. Compared with renal clear cell carcinoma tissue, GLYR1 was more strongly expressed in the corresponding adjacent tissues. The immunohistochemical staining pictures were analyzed using Image J software, and the results showed that the expression levels of GLYR1 in renal clear cell carcinoma tissue and adjacent adjacent tissues were concentrated in the two grades of Negative (0-1 points) and (2-4 points). Figure 1 As shown in Figure B, in renal clear cell carcinoma tissue, the positive expression rate of GLYR1 was 25% (15 / 60), while that in the adjacent tissue was as high as 92% (55 / 60), and the difference was statistically significant ( p <0.0001). The expression level of GLYR1 in renal clear cell carcinoma tissues was significantly lower than that in the corresponding adjacent tissues ( p <0.0001).

[0023] In order to further verify the function of GLYR1 protein in the cell function experiment, we first screened si-GLYR1, used si-GLYR1 to knock down GLYR1 in the renal clear cell carcinoma cell lines ACHN and 786O, selected effective si-GLYR1, and further confirmed it by western blotting. Figure 2 Middle A, Figure 2 As shown in B, the final results show that si-GLYR1#1 is an effective knockdown siRNA, and si-GLYR1#1 is the si-GLYR1 described in subsequent experiments.

[0024] In the experiment to further verify the effect of GLYR1 on the proliferation and migration ability of renal clear cell carcinoma cells, we used CCK8 assay, Transwell migration assay and clone formation assay. Figure 3 Middle A, Figure 3 As shown in B, the CCK8 experiment showed that compared with the renal clear cell carcinoma cells in the NC group, the cell proliferation rate of the GLYR1 high expression group was significantly slower, while the si-GLYR1 group showed faster proliferation than the NC group. This shows that GLYR1 has the ability to inhibit the proliferation of renal clear cell carcinoma cells.

[0025] like Figure 4 Middle A, Figure 4 As shown in B, the Transwell migration experiment showed that in renal clear cell carcinoma cells, the number of cells penetrating the Transwell chamber in the GLYR1 high expression group was significantly reduced compared with the NC group, while the number of cells penetrating the Transwell chamber in the si-GLYR1 group was significantly increased compared with the NC group. This shows that GLYR1 has the ability to inhibit the migration of renal clear cell carcinoma cells.

[0026] like Figure 5 Middle A, Figure 5 As shown in B, the clone formation experiment showed that compared with the NC group renal clear cell carcinoma, the number of cell colonies in the GLYR1 high expression group was significantly reduced, while the number of cell colonies in the si-GLYR1 group was significantly increased compared with the NC group. This shows that GLYR1 has the ability to inhibit the proliferation and colony formation of renal clear cell carcinoma cells.

[0027] These results suggest that the detection of GLYR1 protein has a high diagnostic value, especially immunohistochemistry. The expression level of GLYR1 in renal clear cell carcinoma tissue is significantly lower than that in the corresponding adjacent tissue (p<0.0001). Therefore, the detection of GLYR1 protein expression in renal clear cell carcinoma tissue can achieve high sensitivity and specificity in the diagnosis of renal clear cell carcinoma.

[0028] This invention detects the expression of GLYR1 in renal clear cell carcinoma tissue and the effects of high and low expression of GLYR1 on the proliferation and migration of renal clear cell carcinoma cells, and combines statistical principles and modern biological techniques to provide a detection method with high sensitivity, strong specificity, short cycle and stable results, providing a scientific basis for the diagnosis and treatment of renal clear cell carcinoma patients and offering the possibility for molecular targeted therapy.

[0029] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A non-therapeutic use of GLYR1 protein in regulating the proliferation and / or migration of renal clear cell carcinoma cells.

2. The use of a non-therapeutic GLYR1 protein according to claim 1 in regulating the proliferation and / or migration of renal clear cell carcinoma cells, characterized in that: Knock down the expression of GLYR1, thereby promoting the proliferation and / or migration of renal clear cell carcinoma cells. The reagent used to knock down the expression of GLYR1 is si-GLYR1#1. The nucleotide sequence of the positive chain of the si-GLYR1#1 is as shown in SQI NO: 1: CGGUAGAUGCUGUCGAAGA, and the nucleotide sequence of the antisense chain of the si-GLYR1#1 is as shown in SQI NO: 2: UCUUCGACAGCAUCUACCG.

Images