Molecular marker related to bolting morning and evening of common head cabbage and application of molecular marker

Abstract

The invention discloses a molecular marker related to bolting morning and evening of common head cabbages and application of the molecular marker. According to the method, on the basis of stored morning and evening bolting materials, differential sequence analysis and differential target segment function annotation analysis are carried out according to genome re-sequencing results of the materials in combination with years of phenotype identification results, molecular markers closely related to bolting characters are screened out, and morning and evening bolting common head cabbage DNA is subjected to PCR amplification; close correlation between the molecular marker and the bolting character is further verified by combining the phenotype of the bolting period of continuous years, the primer pair of the molecular marker is utilized to realize early-stage rapid molecular marker identification of the common head cabbage bolting in the morning and evening at the seedling stage of the cabbage, and the breeding efficiency of the bolting-resistant variety of the cabbage is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the bolting time of cabbage and an application thereof. Background Art

[0002] Cabbage is one of the main vegetable crops widely grown in the world. It has a long history of cultivation and rich variety resources. At present, the annual planting area of ​​cabbage in my country is more than 400,000 hectares, accounting for 25% to 30% of the national vegetable planting area. It is the main vegetable cultivated in spring, summer and autumn in Northeast, Northwest, North China and other regions, and is also cultivated on a large scale in the south.

[0003] Bolting and flowering are important agronomic traits in its production. "Premature bolting" reduces the yield and quality of the product and is the main problem in spring cabbage production, causing huge losses to production. Therefore, it is extremely important to develop a molecular marker related to the bolting time of cabbage and use it to screen and identify cabbage varieties with early bolting. Summary of the invention

[0004] One of the purposes of the present invention is to provide an application of an InDel molecular marker in identifying or screening the early or late bolting time of cabbage. The nucleotide sequence of the InDel molecular marker is TCAATCAACTAGTGGAGACAAAAACAAA, which exists in the non-coding region of chromosome 3 of the DNA genome of early-bolting cabbage, but not in the non-coding region of chromosome 3 of the DNA genome of late-bolting cabbage.

[0005] The second object of the present invention is to provide a primer pair Bb3 for use in identifying or screening the early or late bolting time of cabbage, and the sequence of the primer pair Bb3 is as follows: Bb3F: GTCAATCAACTAGTGGAGAC; Bb3R: AGGTCGCTACTTTCTGCCAA.

[0006] The third object of the present invention is to provide a method for identifying early bolting varieties or materials of cabbage, comprising the following steps: Step 1, extracting genomic DNA of the species or material to be identified; Step 2, using the DNA extracted in step 1 as a template, PCR amplification is performed using primer pair Bb3, and the sequence of primer pair Bb3 is as follows: Bb3F:GTCAATCAACTAGTGGAGAC Bb3R: AGGTCGCTACTTTCTGCCAA; Step 3, performing electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 448 bp fragment is obtained, it indicates that the variety or material to be identified is early bolting.

[0007] Furthermore, the reaction system for PCR amplification in step 2 is 20 µL, which contains 1 µL of genomic DNA, 1 µL of upstream and downstream primers, and 10 µL of 2xEasyTaq PCR SuperMix for PAGE.

[0008] Furthermore, the reaction conditions for PCR amplification in step 2 are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min.

[0009] The present invention is based on the preserved early and late bolting materials, performs differential sequence analysis according to the genome resequencing results combined with the phenotypic identification results for many years, performs functional annotation analysis of differential target segments, screens out molecular markers closely related to the bolting trait, performs PCR amplification on DNA of early and late bolting cabbage, and combines the bolting period phenotypes for many consecutive years to further verify that the molecular marker is closely related to the bolting trait, and uses the primer pairs of the molecular marker to realize early rapid molecular marker identification of early and late bolting cabbage in the cabbage seedling stage, thereby improving the breeding efficiency of cabbage varieties with bolting resistance.

[0010] The molecular markers and primer pairs for identifying the early and late bolting of cabbage provided by the present invention can be used for the rapid identification of early bolting-resistant cabbage breeding materials, overcoming the shortcomings of the traditional method such as the long time period and high inaccuracy; and are also conducive to the establishment of a molecular marker-assisted breeding system for bolting resistance of cabbage. Therefore, the present invention is of great significance in the practice of cabbage vegetable breeding and the theoretical research on bolting resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 These are the statistical results of the bolting time of early-bolting cabbage and late-bolting cabbage, where the top short line represents the maximum value, the bottom short line represents the minimum value, the inner horizontal line represents the median, the inner box represents the mean value, and “*” represents the P value.

[0012] Figure 2 This is the alignment of the different Indel nucleotide sequences between early and late bolting.

[0013] Figure 3Figure 1 is the agarose gel electrophoresis result of PCR amplification of primer pair Bb3 in different varieties of cut cabbage, where: M is DL2000 Marker, lanes 4, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18, 20, 21, 22, 25, 27, 29, 30, 36, 37 are early-bolting varieties, and lanes 1, 2, 3, 7, 9, 13, 17, 19, 23, 24, 26, 28, 32, 33, 34, 37, 38, 39, 40 are late-bolting varieties. DETAILED DESCRIPTION

[0014] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0015] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0016] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Example 1

[0017] Statistics of early-bolting and late-bolting cabbage The bolting time of different cabbages was investigated in the field, and 32 early-bolting cabbages and 28 late-bolting cabbages were screened out. The bolting time of early-bolting and late-bolting cabbages was counted for three consecutive years, and the results were as follows: in 2018, the average bolting time of early-bolting cabbage was 188.71±9.12 days, and the average bolting time of late-bolting cabbage was 199.25±8.71 days, and the bolting time of late-bolting cabbage was about 11 days later than that of early-bolting cabbage; in 2019, the average bolting time of early-bolting cabbage was 193.31±8.15 days, and the average bolting time of late-bolting cabbage was 20 8.22±6.92 days, the bolting time of late-bolting cabbage was about 15 days later than that of early-bolting cabbage; in 2020, the mean bolting time of early-bolting cabbage was 191.26±10.58 days, and the mean bolting time of late-bolting cabbage was 208.05±9.75 days, the bolting time of late-bolting cabbage was about 17 days later than that of early-bolting cabbage; the bolting time of late-bolting cabbage was significantly later than that of early-bolting cabbage (P<0.01).

[0018] According to the genome resequencing results of early and late bolting cabbage materials, the differences in genome sequences of materials with different bolting characteristics were analyzed, and the differential sequences were functionally analyzed to screen the target differential segments, and primer pairs were designed. Early and late bolting cabbage with a sample number greater than 25 were selected, and PCR amplification was performed respectively to compare and screen the segments with statistical differences in the genome of early and late bolting cabbage; further sequencing verification was performed to obtain the differential segment gene sequences of early and late bolting cabbage, and the nucleotide sequence information of the differential segments was obtained by combining the anchored segments with statistical differences; according to the differential segment nucleotide sequence information obtained in the step, primer pairs were designed to amplify and verify the cabbage genome DNA; combined with the bolting period phenotypic data of early and late bolting cabbage, a molecular marker was identified and obtained, and the sequence was: TCAATCAACTAGTGGAGACAAAAACAAA. The molecular marker is located at the non-coding region 61,4018-61,4045 of chromosome 3 of the genome, has a length of 28 bp, is missing in the non-coding region of the late-bolting cabbage genome, and contains in the non-coding region of the early-bolting cabbage genome. Example 2

[0019] The present invention provides a method for identifying early bolting of cabbage, comprising the following steps: Step 1: Extraction of genomic DNA from cabbage leaves Take 0.1g of young cabbage leaves, grind them with liquid nitrogen, add 500µL CTAB lysis buffer, transfer to a 1.5mL centrifuge tube, cool in a 65℃ water bath for 0.5~1h, add an equal volume of chloroform / isoamyl alcohol mixture and shake gently, centrifuge at 12000r / min for 8~10min, extract the supernatant with chloroform / isoamyl alcohol mixture 1~2 times, add pre-cooled isopropanol, let stand at 4℃ for more than 3 hours, collect flocculent DNA, wash with 70% ethanol by volume, dry and save in TE buffer, test the purity and concentration of DNA, dilute to 50ng / µL, and store in a -20℃ refrigerator for later use; The composition of the CTAB lysis solution is as follows: 2% CTAB, 2mol / L NaCl2, 20mmol / L EDTA, 100mmol / L Tris-HCl, pH=8.0, and 0.2% β-mercaptoethanol by volume; the volume ratio of chloroform to isoamyl alcohol in the chloroform / isoamyl alcohol mixture is 24:1.

[0020] Step 2, amplification of primer pair Bb3 in the cabbage genome The PCR reaction system was 20 µL, including 1 µL of genomic DNA template, 1 µL of upstream and downstream primers, and 10 µL of 2xEasyTaqPCR SuperMix for PAGE.

[0021] The sequences of primer pair Bb3 are as follows: Bb3F: GTCAATCAACTAGTGGAGAC; Bb3R: AGGTCGCTACTTTCTGCCAA.

[0022] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, and extension at 72°C for 60 s, for 35 cycles; extension at 72°C for 10 min, and then storage at 4°C.

[0023] Step 3, agarose gel electrophoresis detection After PCR amplification, 1.2% agarose gel electrophoresis was performed with 1×TAE buffer, 10 μL of sample was loaded, and electrophoresis was performed at 150 V for 20 min. The samples were then observed and photographed using a gel imager.

[0024] The electrophoresis results are as follows Figure 3 It can be seen that the early-bolting varieties in lanes 4, 5, 6, 8, 10, 11, 12, 14, 15, 16, 18, 20, 21, 22, 25, 27, 29, 30, 36, and 37 can all amplify fragments of 448 bp, while the late-bolting varieties in lanes 1, 2, 3, 7, 9, 13, 17, 19, 23, 24, 26, 28, 32, 33, 34, 37, 38, 39, and 40 do not have fragments of about 448 bp.

[0025] From the above results, it can be seen that if the 448 bp fragment can be amplified by using the marker primer Bb3 to amplify the variety or material of cabbage with early bolting, it indicates that the cabbage has the early bolting trait.

Claims

1. Application of InDel molecular markers in identifying or screening the early or late bolting time of cabbage, characterized in that: The nucleotide sequence of the InDel molecular marker is TCAATCAACTAGTGGAGACAAAAACAAA, which exists in the non-coding region of chromosome 3 of the DNA genome of early-bolting cabbage, but not in the non-coding region of chromosome 3 of the DNA genome of late-bolting cabbage.

2. The use of primer pair Bb3 in identifying or screening the early or late bolting time of cabbage, characterized in that: The sequence of the primer pair Bb3 is as follows: Bb3F: GTCAATCAACTAGTGGAGAC; Bb3R: AGGTCGCTACTTTCTGCCAA.

3. A method for identifying early-bolting varieties or materials of cabbage, characterized in that: The following steps are involved: Step 1, extracting genomic DNA of the species or material to be identified; Step 2, using the DNA extracted in step 1 as a template, PCR amplification is performed using primer pair Bb3, and the sequence of primer pair Bb3 is as follows: Bb3F:GTCAATCAACTAGTGGAGAC Bb3R: AGGTCGCTACTTTCTGCCAA; Step 3, performing electrophoresis separation on the PCR amplification products of step 2 to obtain the banding pattern of each sample. If a 448 bp fragment is obtained, it indicates that the variety or material to be identified is early bolting.

4. The method according to claim 3, characterized in that The reaction system for PCR amplification in step 2 is 20 µL, which contains 1 µL of genomic DNA, 1 µL of upstream and downstream primers, and 10 µL of 2xEasyTaq PCR SuperMix for PAGE.

5. The method according to claim 3, characterized in that The reaction conditions for PCR amplification in step 2 are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 s, 56°C for 50 s, extension at 72°C for 60 s, 35 cycles; extension at 72°C for 10 min.

Images