Molecular marker Site1773 closely linked with leaf yellowing character of muskmelon and application of molecular marker Site1773

Abstract

The invention discloses a molecular marker Site1773 closely linked with a melon leaf color yellowing character and application of the molecular marker Site1773, and belongs to the field of plant molecular genetic breeding research. The molecular marker is used for detecting leaf yellowing characters in a plurality of natural muskmelon populations, DNA (deoxyribonucleic acid) of a material to be selected is used as a template, a primer pair of the molecular marker Site1773 is used for PCR (polymerase chain reaction) amplification, an amplification product is subjected to polyacrylamide gel electrophoresis, field character analysis is combined, and the identification accuracy rate of the molecular marker in the seedling stage is 100%. The molecular marker has very important value in muskmelon production practice and breeding. The operation method is simple, convenient, high in stability, rapid and accurate, and a novel auxiliary selection method is provided for molecular breeding of muskmelons.

Description

Technical Field

[0001] The invention belongs to the research field of plant molecular genetic breeding and provides a molecular marker Site1773 closely linked to a melon leaf yellowing trait and an application thereof. Background Art

[0002] Muskmelon (Cucumis melo L.) is one of the important economic crops of the Cucurbitaceae family. It is widely loved by consumers for its unique color, fragrance and taste, and is widely cultivated in domestic and foreign markets. Leaves are the main place for photosynthesis in plants, and the color of leaves largely determines the total photosynthetic productivity of plants. However, in the process of cultivation and breeding of melons, various mutation phenomena are often encountered, among which leaf yellowing mutants are a more common mutation. The chlorophyll content of leaf yellowing mutant plants is low, and the photosynthetic rate decreases, causing dwarfing, reduced yield, and lethality, which has a serious negative impact on crop growth and the yield of economic products. In melons, leaf yellowing mutants begin to show yellowing at the cotyledon stage, and the yellowing trait accompanies the entire growth cycle. In addition, the plants of yellowing mutant melons are dwarfed, thin, the fruits are small, the commerciality is poor, the taste is poor, and the fruit setting rate is low, which seriously affects the commercial attributes of melons and directly leads to a decrease in melon yield and economic value for fruit farmers. The fruit of the yellow leaf mutant has yellow skin before maturity and the young fruit expands slowly. This appearance feature greatly reduces the marketability of the fruit. Therefore, timely prediction and elimination of melon leaf yellow mutants is conducive to improving the quality of melon products. Analyzing the genetic basis and regulatory mechanism of the formation and development of melon leaf yellow mutants provides reference value for studying leaf yellow mutants, which has important practical significance for accelerating the research and molecular breeding of melon leaf color. Summary of the invention

[0003] Based on the research of the background technology part, the present invention provides a molecular marker Site1773 closely linked to the yellowing trait of melon leaf color and its application, using the yellowing leaf mutant melon variety ZT00091 as the female parent and the normal leaf color melon variety ZT249 as the male parent, configuring a hybrid combination to obtain F1, and continuously selfing the obtained F1 to obtain its F2, F 2:3 The F2 population was used to initially locate the chlorosis trait of melon leaves, 2:3 The family was used for fine mapping of candidate genes. According to the results of BSA (Bulk Segregating Analysis) sequencing, the 8.49 Mb obtained was obtained by F 2:3 Further fine positioning of the family narrowed the candidate interval and selected more efficient molecular markers linked to the melon leaf yellowing trait, which can be directly used to identify leaf yellowing mutants in the offspring of melon plants.

[0004] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0005] The molecular marker Site1773 closely linked to the melon leaf yellowing trait, the primer sequence of the molecular marker Site1773 is:

[0006] Site1773F:TCCCATACCAAAACACAA,

[0007] Site1773R:AACTTGTTCAGCCGGATTCA.

[0008] The molecular marker Site1773 is used to identify leaf yellowing mutants in the offspring of melon plants at the seedling stage.

[0009] Furthermore, the application is: using the molecular marker for early prediction in the seedling stage of several natural melon populations, using the DNA of the selected material as a template and the primers of the molecular marker Site1773 for PCR amplification, subjecting the amplified product to polyacrylamide gel electrophoresis and combining it with field trait analysis.

[0010] Furthermore, the application is:

[0011] (1) Using the DNA of the material to be identified as a template, the primers of the molecular marker Site1773 are used to perform PCR amplification on it; PCR product detection: the reaction product is electrophoresed on a 7% non-denaturing polyacrylamide gel and stained with silver nitrate;

[0012] (2) Identification of labeled primers: After PCR amplification, the DNA sample can be detected by electrophoresis. The 158bp specific band is a mutant variety with yellow leaf color, the 147bp and 158bp hybrid bands are intermediate varieties, and the 147bp band is a variety with normal leaf color.

[0013] Furthermore, in step (1), the PCR amplification system is 10 μL: including 1 μL of Site1773F, 1 μL of Site1773R, 3 μL of Taq Master Mix, 1 μL of DNA template, and 4 μL of ddH2O.

[0014] Furthermore, in step (1), the PCR amplification procedure was: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, (denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s for 35 cycles), extension at 72°C for 10 min, and storage at 4°C.

[0015] The beneficial effects of the present invention compared to the prior art are:

[0016] 1. InDel (Insertion-deletion) molecular marker is a marker designed based on the sequence on both sides of the insertion / deletion site for PCR amplification with specific primers. It is essentially a length polymorphism marker and can be typed using polypropylene gel electrophoresis. Based on BSA sequencing technology, the present invention compares the melon genome data, designs and develops InDel markers linked to the melon leaf yellowing trait, and uses the InDel molecular marker-assisted breeding method to identify the probability of leaf yellowing mutants in the offspring of melon plants during the melon seedling stage. By using this molecular marker, the investment in manpower and material resources is greatly reduced, the breeding cost is reduced, and the breeding period is shortened.

[0017] 2. By using the specific primers provided by the present invention to detect the genomic DNA of the melon to be tested by the PCR method, the InDel molecular marker Site1773 was amplified. The gene amplification product of the melon leaf color yellowing mutant material was 158 bp, and the gene amplification product of the melon normal leaf color trait material was 147 bp. Through this molecular marker, breeders can more effectively predict and screen melon plants with the genetic characteristics of melon leaf color yellowing, greatly improving the breeding efficiency of melon.

[0018] 3. The molecular markers of the present invention have important value in melon production practice and breeding.

[0019] 4. The operation method of the present invention is simple and has strong stability, and provides a new method for melon molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a fine-grained mapping of the yellowing trait of melon leaves;

[0021] Figure 2 Electropherograms of the melon Site1773 marker tested in 24 natural populations. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and embodiments, but is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention that does not depart from the spirit and scope of the technical solution of the present invention should be included in the protection scope of the present invention.

[0023] The present invention studies the genetic mechanism and gene location of the chlorotic leaf mutant of melon. The melon variety ZT00091 with chlorotic leaf mutant is used as the female parent and the melon variety ZT249 with normal leaf color is used as the male parent to prepare a hybrid combination, construct an F2 segregating population and an F 2:3 The gene of the melon leaf yellowing mutant was initially located using the F2 segregating population. 2:3The family was further fine-mapped to identify the candidate region controlling yellow leaf color and to design molecular markers linked to the yellow leaf color mutation in melon.

[0024] Specific implementation method 1: This implementation method describes a molecular marker Site1773 that is closely linked to the melon leaf yellowing mutation, and its primer sequence is:

[0025] Site1773F:GCACAACTCTTAAAGAAAACCCA,

[0026] Site1773R:TCCCATACCAAAACACAA.

[0027] The method for obtaining the above molecular marker Site1773 is as follows:

[0028] 1. Construction of melon genetic population

[0029] The yellow leaf mutant muskmelon variety ZT00091 was used as the female parent and the normal leaf color muskmelon variety ZT249 was used as the male parent to configure the hybrid combination "ZT00091×ZT249" to obtain the F1 population, and the F1 was self-pollinated to obtain the F2 segregation population, and the obtained F2 segregation population was self-pollinated to obtain the F 2:3 Family. The hybridization of the male and female parent can produce numerous F1 plants, the genotype and phenotype of these plants are the same, and the F1 plants can be randomly selected and self-fertilized to obtain F2 plants, and the F2 plants can be randomly selected and self-fertilized to obtain F 2:3 family lineage;

[0030] In 2022, ZT00091 (20 plants), ZT249 (20 plants), F1 plants (20 plants), and F2 segregating populations (193 plants) were planted at the Aerospace Breeding Base of Heilongjiang Bayi Agricultural University; in 2023, F 2:3 Families (320 families in total, 10 plants in each family), the above melon materials were all planted in greenhouses, the cultivation method was conventional water and fertilizer management, and single plant pollination.

[0031] 2. Extraction of genomic DNA and construction of gene pool

[0032] CTAB method was used to extract 320 F 2:3 Genomic DNA of the pedigree.

[0033] 3. InDel molecular marker screening

[0034] By using the yellowing leaf mutant melon variety ZT00091 and the normal leaf color melon variety ZT249 as the male parents for high-throughput sequencing, the genome sequence information of the two parents was obtained, and the differential sites between the two parents were analyzed and compared. The molecular markers closely linked to the yellowing leaf mutant of melon were obtained using the BSA method. A total of 30 pairs of molecular markers were designed and developed. PCR amplification and polymorphism screening were performed between the gene pool of the yellowing leaf mutant melon and the gene pool of the normal leaf color melon varieties, and a total of 8 pairs of primers were screened. Figure 1 As shown, based on the molecular markers linked to the melon leaf yellowing mutant trait, Site1773 was found to be tightly linked to the melon leaf yellowing mutant trait.

[0035] Specific implementation method 2: This implementation method provides a method for molecular marker Site1773 linked to the trait of melon leaf yellowing mutant, and the specific steps are as follows:

[0036] (1) Extract DNA from the sample to be tested and perform PCR amplification using the molecular marker Site1773. The 10μL PCR reaction system is: 1μL 50-100ng / μL DNA, 1μL each of the upstream and downstream primers of Site1773, 3μL Taq enzyme Mix, and 4μL ddH2O. The PCR amplification conditions are: pre-denaturation at 95℃ for 5min, denaturation at 95℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 45s, 35 cycles from step 2 to step 4, extension at 72℃ for 10min, and storage at 4℃.

[0037] (2) After the DNA sample to be tested is amplified by PCR, the 158 bp fragment detected by electrophoresis is the melon material with yellow leaf color mutant, while the fragment size of 147 bp is the melon material with normal leaf color. Figure 2 As shown, M DNA2000Maker, band 1 represents the female parent, the yellow leaf mutant melon ZT00091; band 2 represents the male parent, the normal leaf color melon ZT249; band 3 is the F1 heterozygous band, the phenotype is normal leaf color; bands 4-11 are varieties with the same bands as ZT00091, the yellow leaf type; bands 12-19 are varieties with the same bands as ZT249, the normal leaf color variety; 20-27 are intermediate varieties, the offspring can be separated into the yellow leaf phenotype, and the accuracy rate of melon leaf color yellow trait identification is 100%. Therefore, the amplification of tightly linked markers can accurately distinguish the different genotypes of the melon leaf color yellow mutant trait loci, achieving the purpose of auxiliary breeding.

Claims

1. Molecular marker Site1773, which is tightly linked to the melon leaf yellowing trait, is characterized by: The primer sequence of the molecular marker Site1773 is: Site1773F:TCCCATACCAAAACACAA, Site1773R:AACTTGTTCAGCCGGATTCA.

2. Use of the molecular marker Site1773 described in claim 1 in identifying leaf yellowing mutants in offspring of melon plants at the seedling stage.

3. The use of the molecular marker Site1773 according to claim 2 in identifying leaf yellowing mutants in offspring of melon plants at the seedling stage, characterized in that: The application is: using the molecular marker to make early predictions at the seedling stage of several natural melon populations, using the DNA of the selected material as a template and the primers of the molecular marker Site1773 to perform PCR amplification, performing polyacrylamide gel electrophoresis on the amplified product and combining it with field trait analysis.

4. The use of the molecular marker Site1773 according to claim 3 in identifying leaf yellowing mutants in offspring of melon plants at the seedling stage, characterized in that: The application is: (1) Using the DNA of the material to be identified as a template, PCR amplification is performed using the primers of the molecular marker Site1773; PCR product detection: The reaction products were electrophoresed on 7% non-denaturing polyacrylamide gel and stained with silver nitrate; (2) Identification of labeled primers: After PCR amplification, the DNA sample can be detected by electrophoresis. The 158bp specific band is a mutant variety with yellow leaf color, the 147bp and 158bp hybrid bands are intermediate varieties, and the 147bp band is a variety with normal leaf color.

5. The use of the molecular marker Site1773 according to claim 4 in identifying leaf yellowing mutants in offspring of melon plants at the seedling stage, characterized in that: In step (1), the PCR amplification system is 10 μL: including 1 μL of Site1773F, 1 μL of Site1773R, 3 μL of Taq Master Mix, 1 μL of DNA template, and 4 μL of ddH2O.

6. The use of the molecular marker Site1773 according to claim 4 in identifying leaf yellowing mutants in offspring of melon plants at the seedling stage, characterized in that: In step (1), the PCR amplification procedure was: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, (denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s for 35 cycles), extension at 72°C for 10 min, and storage at 4°C.

Images