Lamprey anti-inflammatory peptide LYP and application thereof

Abstract

The invention discloses a lamprey anti-inflammatory peptide LYP and application thereof, and belongs to the technical field of application of peptide anti-inflammatory drugs, and the lamprey anti-inflammatory peptide LYP generates an anti-inflammatory effect by up-regulating expression of anti-inflammatory factors TGF-beta and IL-10 and down-regulating expression of proinflammatory factors TNF-alpha, IL-1beta and MCP-1. A Western Blot experiment further proves that the anti-inflammatory effect of the lamprey anti-inflammatory peptide LYP is also proved. The lamprey anti-inflammatory peptide LYP disclosed by the invention has huge application value and wide prospects in the aspects of preparation of anti-inflammatory drugs, development and utilization of related products and the like, is suitable for being applied to anti-inflammatory reactions, and is particularly applied to preparation of anti-inflammatory drugs, foods or other products.

Description

Technical Field

[0001] The present invention relates to the technical field of application of peptide anti-inflammatory drugs, and in particular to a lamprey anti-inflammatory peptide LYP and application thereof. Background Art

[0002] Inflammation is our body's immune response to external stimuli such as infection, pathogens, and viruses. Inflammation can be divided into two types: acute inflammation and chronic inflammation. Inflammation can trigger a variety of autoimmune diseases, including diabetes, non-alcoholic fatty liver disease, atherosclerosis, inflammatory bowel disease, and rheumatoid arthritis, which seriously threaten human health. Currently, the main treatment for acute and chronic inflammatory diseases relies on non-steroidal anti-inflammatory drugs. However, non-steroidal anti-inflammatory drugs are prone to various side effects, such as reduced healing efficiency, peptic ulcers, gastrointestinal toxicity, etc. Long-term use of non-steroidal anti-inflammatory drugs to treat chronic inflammation can also lead to degradation of the gastric mucosa and increase the incidence of cardiovascular complications such as myocardial infarction.

[0003] In recent years, with the development of molecular biology, a new inflammatory treatment strategy has been provided, namely, anti-tumor necrosis factor (TNF) biological agents targeting interleukins and cytokines, including soluble TNF receptor 2 fusion proteins and antibodies, which have changed the treatment of autoimmune diseases. These drugs inhibit the expression of proinflammatory cytokines and reduce the production of IFN-γ, thus proving the key role of TNF in autoimmune inflammatory diseases. Some anti-tumor necrosis factor drugs, including infliximab, adalimumab, veltuzumab and ustekinumab, have been launched and achieved good commercial results. However, the efficacy of these biological agents will gradually decrease with the extension of treatment time, and the price of monoclonal antibody drugs is relatively high, which is a heavy burden on patients.

[0004] Bioactive peptides are a class of peptides consisting of less than 50 amino acid residues that play a unique role in the function of living cells or organisms. Due to their different biological activities, ability to penetrate cells and low cytotoxicity, bioactive peptides have attracted people's interest as possible therapeutic agents. Anti-inflammatory peptides have shown great potential in the treatment of a variety of diseases related to inflammation. Certain anti-inflammatory peptides have strong antioxidant capacity, which helps to reduce reactive oxygen species and protect cell membranes from lipid oxidation damage, thereby reducing inflammation. The antioxidant capacity of anti-inflammatory peptides depends on whether they contain specific amino acids, including cysteine, tyrosine, histidine and tryptophan. Cysteine ​​and methionine are sulfur-containing amino acids that help eliminate free radicals, thereby helping to treat inflammatory diseases. Anti-inflammatory peptides are widely available and can be obtained from a variety of natural sources, such as algae, fungi, plants and animals. At present, drugs and health products of anti-inflammatory peptides have gradually become popular.

[0005] The lamprey is a primitive jawless vertebrate, some of whose adults feed on blood. As a new model animal for developmental and evolutionary biology, its potential application value has not been effectively developed. In previous studies, proteins with antibacterial, anti-inflammatory and anti-cancer functions have been found in the oral glands of lampreys, indicating that the oral glands of lampreys are rich in bioactive substances. In addition, lampreys are large in size and have high content of oral gland contents, so it is relatively easy to screen and purify active peptides. However, to date, research on the development of bioactive peptides, including anti-inflammatory peptides, in lampreys is still very limited, and the active ingredients in the oral glands of lampreys have not been fully studied to a large extent. Summary of the invention

[0006] The present invention separates a lamprey anti-inflammatory peptide LYP from the oral gland secretion of lamprey, identifies the polypeptide sequence by LC-MS / MS, screens its function by function prediction, artificially synthesizes the polypeptide sequence with a higher score and verifies its immune function and anti-inflammatory activity, so as to solve the above problems.

[0007] In order to achieve the above object, the technical solution of the present invention is:

[0008] In one aspect, the present invention provides a lamprey anti-inflammatory peptide LYP, wherein the amino acid sequence of the lamprey antibacterial peptide LYP is shown as SEQ ID NO.1.

[0009] Another aspect of the present invention provides the use of the lamprey anti-inflammatory peptide LYP in the preparation of anti-inflammatory drugs or products.

[0010] The beneficial effects of the present invention are:

[0011] The lamprey anti-inflammatory peptide LYP disclosed in the present invention is an endogenous polypeptide separated from the oral gland secretion of lamprey. It is verified to have good anti-inflammatory effect after artificial synthesis, and can up-regulate the expression of anti-inflammatory factors TGF-β and IL-10 genes, and down-regulate the expression of pro-inflammatory factors TNF-α, IL-1β, and MCP-1 genes. The lamprey anti-inflammatory peptide LYP has great application value and broad prospects in the preparation of anti-inflammatory drugs and the development and utilization of related products, and also lays a theoretical foundation for the in-depth development and utilization of lampreys. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0013] Figure 1This is a diagram showing the HPLC purification results of lamprey anti-inflammatory peptide LYP;

[0014] Figure 2 The results of the effects of different groups (control, LPS, lamprey anti-inflammatory peptide LYP+LPS) on TGF-β gene expression in cells;

[0015] Figure 3 The results of the effects of different groups (control, LPS, lamprey anti-inflammatory peptide LYP+LPS) on the expression of IL-10 gene in cells;

[0016] Figure 4 The results of the effects of different groups (control, LPS, lamprey anti-inflammatory peptide LYP+LPS) on the expression of TNF-α gene in cells;

[0017] Figure 5 The results of the effects of different groups (control, LPS, lamprey anti-inflammatory peptide LYP+LPS) on the expression of IL-1β gene in cells;

[0018] Figure 6 The results of the effects of different groups (control, LPS, lamprey anti-inflammatory peptide LYP+LPS) on the expression of MCP-1 gene in cells;

[0019] Figure 7 The graph shows the effects of different groups (control, LPS, lamprey anti-inflammatory peptide LYP+LPS) on the expression of TNF-α and TGF-β proteins in cells. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] When using the lamprey anti-inflammatory peptide LYP provided by the present invention, those skilled in the art can obtain it by artificial synthesis. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0022] The present invention will be further explained below through specific implementation modes.

[0023] Example 1: Extraction and identification of polypeptides from lamprey oral glands

[0024] The oral gland secretions of lampreys were aspirated with a sterile 1 mL syringe, and endogenous peptides were prepared and identified by LC-MS / MS. The anti-inflammatory peptide prediction website AIPpred (http: / / www.thegleelab.org / AIPpred / ), AntiInflam

[0025] (http: / / metagenomics.iiserb.ac.in / antiinflam / Antimicrobial) and PreAIP (http: / / kurata14.bio.kyutech.ac.jp / PreAIP / ) screened out a polypeptide with anti-inflammatory activity in the oral gland of lamprey, namely, lamprey anti-inflammatory peptide LYP, whose amino acid sequence is PFFVSLNLPYSVVRGEQFVVQALVF (SEQ ID NO.1)

[0026] Example 2: Synthesis of lamprey anti-inflammatory peptide LYP

[0027] The lamprey anti-inflammatory peptide LYP was synthesized by Nanjing Jiepeptide Biotechnology Co., Ltd. The lamprey anti-inflammatory peptide LYP was synthesized by N-9-fluorenylmethoxycarbonyl (Fmoc) chemistry using a fully automatic peptide synthesizer (Titan357) and purified using an AKTA pure chromatography system. The purity of the lamprey anti-inflammatory peptide LYP was analyzed using a reversed-phase high-performance liquid chromatography system. The results are as follows Figure 1 As shown, the purity of the peptide purified by HPLC was >90%, which met the requirements of the activity detection related experiments. The synthesized lamprey anti-inflammatory peptide LYP was dissolved in sterile ultrapure water and stored at -20°C for future use.

[0028] Example 3: Using real-time fluorescence quantitative PCR to verify the effect of LYP on five inflammatory factor genes (TGF-β, IL-10, TNF-α, IL-1β, MCP-1) and the anti-inflammatory activity of lamprey anti-inflammatory peptide LYP

[0029] The method for verifying the anti-inflammatory activity of lamprey anti-inflammatory peptide LYP by real-time fluorescence quantitative PCR comprises the following steps:

[0030] 1. Cultivate cells: Human mononuclear THP-1 cells were placed in RPMI 1640 medium containing 10% (v / v) fetal bovine serum (FBS) and 1% penicillin-streptomycin, and cultured at 37°C and 5% CO2. The cells were passaged every 1-2 days.

[0031] 2. Treating cells: THP-1 cells were pre-incubated with the synthetic lamprey anti-inflammatory peptide LYP (final concentration of 100 μM) at 37°C and 5% CO2 for 1 h, 3 h and 6 h, respectively, and then lipopolysaccharide (LPS, 100 ng / mL) was added to stimulate the THP-1 cells for 12 h (1 h + LPS, 3 h + LPS, 6 h + LPS). At the same time, THP-1 cells stimulated with lipopolysaccharide (LPS, 100 ng / mL) for 12 h were used as the positive control (LPS), and THP-1 cells without the addition of lamprey anti-inflammatory peptide LYP and LPS were used as blank controls (control).

[0032] 3. Extract total RNA from treated cells:

[0033] (1) Take approximately 1×10 6 Add 1 mL of RNAiso reagent to each THP-1 cell treated with the above method into a 1.5 mL centrifuge tube, and use a pipette to repeatedly and slowly blow until the cells are lysed and completely dissolved, and then place on ice for 5 min.

[0034] (2) Centrifuge at 4°C, 12,000 rpm for 10 min and transfer 730 μL of the supernatant to a 1.5 mL tube;

[0035] (3) Add 200 μL of chloroform, shake vigorously until no stratification occurs, and place on ice for 5 min;

[0036] (4) Centrifuge at 4°C, 12,000 rpm for 10 min. Take 500 μL of the supernatant solution and transfer it to a 1.5 mL RNase-free centrifuge tube. Add 500 μL of isopropanol, invert the tube to mix the solution thoroughly, and place it on ice for 5 min.

[0037] (5) Centrifuge at 4°C, 12,000 rpm for 10 min and discard the supernatant;

[0038] (6) Add 1 mL of 75% ethanol (pre-cooled at -20°C) (prepared with DEPC water) to wash the white precipitate.

[0039] (7) Centrifuge at 4°C, 12,000 rpm for 10 min. Discard the supernatant, retain the precipitate, and add 20 μL RNase free water to dissolve the RNA precipitate. Reverse the extracted RNA into cDNA as a template.

[0040] 4. Real-time quantitative fluorescence PCR (qPCR): tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), transforming growth factor-β (TGF-β), interleukin-10 (IL-10) and monocyte chemoattractant protein-1 (MCP-1) genes were selected for real-time quantitative PCR. Primers for real-time quantitative PCR analysis were constructed by Primer Premier 5.0, and the primer efficiency was 90% to 105%. The primer sequences were:

[0041] qTNF-α-F: AAGGACACCATGAGCACTGAAAGC (SEQ ID NO. 2), qTNF-α-R: AGGAAGGAGAAGAGGCTGAGGAAC (SEQ ID NO. 3); qIL-1β-F: GGACAGGATATGGAGCAACAAGTGG (SEQ ID NO. 4), qIL-1β-R: TCATCTTTCAACACGCAGGACAGG (SEQ ID NO. NO.5); qTGF-β-F: TATTGAGCACCTTGGGCACTGTTG (SEQ ID NO.6), qTGF-β-R: CCTTAACCTCTCTGGGCTTGTTTCC (SEQ ID NO.7); qIL-10-F: GCCGTGGAGCAGGTGAAGAATG (SEQ ID NO.8), qIL-10-R: ATAGAGTCGCCACCCTGATGTCTC (SEQ ID NO.7); NO.9); qMCP-1-F: GGCTGAGACTAACCCAGAAACATCC (SEQ ID NO.10), qMCP-1-R: GGGAATGAAGGTGGCTGCTATGAG (SEQ ID NO.11); qβ-actin-F: CAGATGTGGATCAGCAAGCAGGAG (SEQ ID NO.12), qβ-actin-R: CGCAACTAAGTCATAGTCCGCCTAG (SEQ ID NO.11); ID NO.13).

[0042] qPCR was performed in a 20 μL reaction system, and the reaction system was: 2× dye method silver light quantitative special premix (chamQ SYBR Color qPCR Master Mix (low ROX Rremixed)) (10 μM), forward primer (10 μM), reverse primer (10 μM) and 200 ng cDNA template. Real-time fluorescence quantitative PCR was performed by 7500 Real Time PCR System. The following program was used for real-time fluorescence quantitative PCR: 95°C 30s; 95°C 10s, 60°C 30s (40 cycles). The threshold cycle difference (ΔCT) was calculated by subtracting the average CT of β-actin mRNA from the average CT of the target gene. GraphPad Prism 9 was used to analyze the data, and all results were expressed as the average of three independent experiments, and each experiment was repeated three times.

[0043] The results are as follows Figure 2 and Figure 3 As shown in the figure, the expression of anti-inflammatory factors TGF-β and IL-10 genes in THP-1 cells was significantly reduced after LPS stimulation (LPS in the figure), while the expression of anti-inflammatory factors TGF-β and IL-10 genes in THP-1 cells was significantly upregulated after pre-incubation with lamprey anti-inflammatory peptide LYP for 1h, 3h and 6h (1h+LPS, 3h+LPS and 6h+LPS in the figure). Figure 4-Figure 6 As shown, the expression of proinflammatory factors TNF-α, IL-1β, and MCP-1 in THP-1 cells was significantly upregulated after LPS stimulation (LPS in the figure), while after the lamprey anti-inflammatory peptide LYP was pre-incubated for 1h, 3h, and 6h (1h+LPS, 3h+LPS, and 6h+LPS in the figure), the expression of proinflammatory factors TNF-α, IL-1β, and MCP-1 in THP-1 cells was significantly reduced. Therefore, it is shown that the lamprey anti-inflammatory peptide LYP has obvious anti-inflammatory activity.

[0044] Example 4: Western Blot Verification of the Anti-inflammatory Activity of Lamprey Anti-inflammatory Peptide LYP

[0045] Western Blot was used to detect the expression of TNF-α and TGF-β proteins in cells, including the following steps:

[0046] (1) Sample preparation: The THP-1 cells after each treatment were collected by centrifugation at 1000 rpm for 5 min, the culture medium was discarded, RIPA cell lysis buffer was added and pipetted, and the cell samples were placed on ice for 30 min to lyse the cells;

[0047] (2) Sample loading: Load 20 μL of sample into the wells of SDS-PAGE gel for electrophoresis detection;

[0048] (3) Transfer: Use a semi-dry transfer apparatus to transfer the membrane;

[0049] (4) Blocking: 5% skim milk powder, 37°C for 2 h;

[0050] (5) Incubation with primary antibody: primary antibody (TNF-α, TGF-β and β-actin) diluted 1:2000, incubated overnight at 4°C on a shaker;

[0051] (6) Washing the membrane: Wash the membrane with 1× TBST for 5 times, 8 min each time;

[0052] (7) Incubation with secondary antibody: dilute the secondary antibody at a ratio of 1:5000 and incubate at 37°C on a shaker for 45 min;

[0053] (8) Washing the membrane: Wash the membrane with 1× TBST for 5 times, 8 min each time;

[0054] (9) Luminescence: Mix solution A and solution B in a 1:1 ratio and drop the developer onto the surface of the PVDF membrane to detect the target protein.

[0055] The results are as follows Figure 7 As shown, the results showed that the expression of pro-inflammatory factor TNF-α protein in THP-1 cells was significantly upregulated after LPS stimulation, while the expression was significantly reduced after pre-incubation with lamprey anti-inflammatory peptide LYP for 1h, 3h and 6h. In contrast, the expression of anti-inflammatory factor TGF-β protein was significantly reduced after LPS stimulation, while the expression of TGF-β protein was significantly upregulated after pre-incubation with lamprey anti-inflammatory peptide LYP for 1h, 3h and 6h. This result further confirmed that lamprey anti-inflammatory peptide LYP has anti-inflammatory activity.

[0056] In summary, the present invention identifies a lamprey anti-inflammatory peptide LYP from the oral gland of lamprey. The lamprey anti-inflammatory peptide LYP is artificially synthesized, and its anti-inflammatory activity is verified by real-time fluorescence quantitative PCR. The lamprey anti-inflammatory peptide LYP produces an anti-inflammatory effect by up-regulating the expression of anti-inflammatory factors TGF-β and IL-10 and down-regulating the expression of pro-inflammatory factors TNF-α, IL-1β, and MCP-1, and the anti-inflammatory effect of the lamprey anti-inflammatory peptide LYP is further confirmed by Western Blot experiments. The lamprey anti-inflammatory peptide LYP is suitable for use in anti-inflammatory reactions, especially for use in the preparation of anti-inflammatory drugs, foods or other products.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A lamprey anti-inflammatory peptide LYP, characterized in that The amino acid sequence of the lamprey antimicrobial peptide LYP is shown in SEQ ID NO.

1.

2. Use of the lamprey anti-inflammatory peptide LYP according to claim 1 in the preparation of anti-inflammatory drugs or products.

Images